CN102827938A - Primer for diagnosing lung lesions caused by chrysotile and man-made mineral fiber by using RT-PCR method - Google Patents
Primer for diagnosing lung lesions caused by chrysotile and man-made mineral fiber by using RT-PCR method Download PDFInfo
- Publication number
- CN102827938A CN102827938A CN2012103284256A CN201210328425A CN102827938A CN 102827938 A CN102827938 A CN 102827938A CN 2012103284256 A CN2012103284256 A CN 2012103284256A CN 201210328425 A CN201210328425 A CN 201210328425A CN 102827938 A CN102827938 A CN 102827938A
- Authority
- CN
- China
- Prior art keywords
- primer
- mir
- man
- group
- mineral fiber
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a primer for diagnosing lung lesions caused by chrysotile and man-made mineral fiber by using an RT-PCR method. The primer comprises a primer pair 1, a primer pair 2 and a primer pair 3 which are respectively used for amplifying miR-29a, miR-29b and miR-29c, and a base sequence is showed as SEQ ID NO.4-9. An miRNA amplification primer is designed on the basis of rat lung tissue pathological mechanism expressions by building a rat dust dying model, expression situations of miR-29 family members in dust dying rat lung tissues are detected, and an effective tool of early diagnosis and screening of health hazards caused by exposure of the chrysotile and the man-made mineral fiber is provided.
Description
Technical field
The present invention relates to a kind of primer, relate in particular to a kind of primer of diagnosing pulmonary lesion due to chrystile and the man-made mineral fiber.
Background technology
Asbestos are silicates mineral substance of natural fiber shape, owing to have good performances such as heat-resisting, insulation, wear-resisting, electrical isolation and resistance to chemical attack, are widely used in the manufacturing of eternit, textiles, insulation friction materials etc. for many years.The asbestos kind is more, can be divided into two big types of amphibole asbestos (comprising krocodylite, amosite asbestos etc.) and chrysotiles (chrystile) according to the difference of chemical composition.Asbestos are because its fibrous characteristic, after being sucked by human body, adhere to and are deposited on lung, can cause the generation of pulmonary fibrosis, mesothelioma and pleura spot etc.What harm was maximum in the asbestos family is krocodylite, and it has stronger carinogenicity, and is disabled in most countries.And chrystile has soft and acid nonfast characteristic, and with hard and amphibole asbestos acid and alkali-resistance are compared, relatively poor in the intravital persistence of people, it is external that easy-clear goes out, so its harm is less relatively.Yet about the multinomial epidemiological study and the toxicologic study of chrystile security all point out us the harm of chrystile potential biology to can not be ignored.Chrystile connects that dirt workman's lung function index (comprising FVC, FEV1 etc.) is more non-to be met the dirt crowd and all descend to some extent.The chrystile that is exposed to low dosage for a long time can cause the generation of pleura spot, and chrystile exposes also can cause pleural calcification, causes the generation of fibrosis lesion and asbestosis.Simple chrystile exposes and can cause and connect the occurred frequently of dirt crowd lung cancer and mesothelioma, and chrystile has been considered to the major cause that mesothelioma is fallen ill.A large amount of relevant mammiferous dirt experiment confirm chrystiles that connect can cause the generation of pneumonia reaction, asbestoic body and fibrosis lesion to take place.
The production of chrystile and use are limited gradually or are forbidden that meanwhile various countries are also actively developing the production use of asbestos substitute, harm and safeguard procedures research in worldwide at present.Man-made mineral fiber (man-made vitreous fibers; MMVFs) be the fibrous silicate material of one type of non-crystal structure that obtains as raw material production through the mineral material of processing etc. by glass, rock, slag or other; Comparatively similar at aspects such as form and performances with asbestos, therefore also as the widespread use of asbestos substitute.Man-made mineral fiber's production and application development are very fast, at present commonly used comprise refractory ceramic fibre, spun glass, rock wool etc., and along with mass production and widespread use in recent years, they have also caused people's extensive concern to the harm of HUMAN HEALTH., refractory ceramic fibre just have research to confirm that through the method for body cavity injection refractory ceramic fibre can cause the generation of mesothelioma in the rat body soon after commercially producing.The long-term further lung tissue that confirms refractory ceramic fibre main damage rat and hamster of experiment that sucks; Suck and to observe macrophages infiltration, the outer epithelial cell paraplasm of alveolar and granulomatous formation after 3 months, can be observed tangible focal fibrosis of pleura after 6 months.Cytokinetics that some research groups provide and physicochemical data show that but spun glass can cause fiberization in mouse and hamster body.People such as Takahashi research group and Guber have reported that respectively at 1996 and 2006 an example sucks the pulmonary fibrosis pathology that spun glass brings out for a long time.People such as McConnell have carried out a Study on Pathogenicity about rock wool in 1999, suck experiment through dust, observe the appearance of hamster lung fibrosis phenomenon.
Respirable dust can get into lung through respiratory tract and cause that a large amount of pulmonary alveolar macrophages swim out of; Generations such as oxyradical have not only been caused in this process; Destroy the 26S Proteasome Structure and Function of cytolemma; Also can stimulate the various cytokines of secretion such as pulmonary alveolar macrophage, neutrophil leucocyte, these cytokines can enter into interstitial lung through impaired alveolar epithelium, cause their pathological change thereby act on corresponding target cell.When cytokine acts on inoblast, impel cell to breed in a large number, or the enhancing of inducing cell epimatrix protein expression, cause inoblast a large amount of depositions of extracellular matrix proteins such as propagation and collagen in a large number, also can cause the generation of pulmonary fibrosis.The mechanism that respirable dust causes pulmonary lesion is very complicated, and latent period is longer, does not still have effective means at present it is assessed and early screening in early days.
MicroRNA (miRNA) has become one type of important gene expression regulation molecule in recent years, has extensively various biological function.MiRNA comes to light in nematode first, participates in the developmental regulation of larva.The forming process of ripe miRNA molecule comprises some steps: at first transcribe synthetic original miRNA (pri-miRNA) through rna plymerase ii, cut through nucleicacidase Drosha enzyme and produce the miRNA precursor (pre-miRNA) with loop-stem structure; Pre-miRNA transfers in examining the kytoplasm through transporting sub-Exportin 5, after the Dicer enzyme is sheared, forms the microRNA that sophisticated about 22 Nucleotide are formed, promptly sophisticated miRNA molecule.The member of sophisticated miRNA and Argonaute protein family is assembled into nucleic acid-protein complex body miRNP, through combining to cause that with target mRNA 3 ' end non-translational region sequence the degraded of target mRNA or translation suppress.
MiR-29 family comprises miR-29a, miR-29b-1, miR-29b-2 and miR-29c, and the sequence of rat miR-29b-1 and miR-29b-2 is identical, lay respectively at No. 4 and No. 13 karyomit(e) on.MiR-29 family member's target gene is more; Comprise multiple tropocollagen molecules such as type i collagen directly related and III Collagen Type VI, and matrix metalloproteinase, Thr6 PDGF BB and Delicious peptide etc. have confirmed and the closely-related molecule of pulmonary fibrosis with pulmonary fibrosis.It is relevant with multiple fibrosis lesion that miR-29 has been proved, comprises hepatic fibrosis, myocardial fibrosis, renal fibrosis and pulmonary fibrosis.Interior or the external expression miR-29 that crosses of body can reduce the collagen expression amount, suppresses miR-29 and expresses the rising that then can cause the collagen expression amount, the fibrosis lesion aggravation.MiR-29 is suppressed by TGF-β/SMAD signal path, further regulates and control its known target gene type i collagen and other fibrosis associated molecule, as integrates element, fibrillin etc.Existing many pieces of documents point out that miR-29 can be used as fibrosis lesion potential treatment novel targets and uses.Existing research confirms that miR-29 participates in the idiopathic pulmonary fibrosis of bleomycin induced, miR-29 is imported to cross in the mouse body to express through the transposon system can alleviate its lung tissue fibrosis, also can reduce the infiltration of inflammatory cell simultaneously.But do not appear in the newspapers as yet at present about related between miR-29 and the pulmonary lesion that respirable dust causes.
Along with people's deepens continuously to miRNA understanding, and relevant with it research means and technological method become increasingly abundant also in continuous maturation.Aspect the detection by quantitative of miRNA, because ripe miRNA does not possess poly (A) tail, and sequence is very short, and conventional oligo d (T) or random primer can not be used for its reverse transcription reaction.Stem-loop method commonly used is a few days ago used the synthetic cDNA of the reverse transcriptase primer that has loop-stem structure, and this primer not only specifically to certain miRNA, can also increase the sequence length of cDNA chain, is convenient to subsequent P CR amplified reaction.This quantitative detecting method has been simplified the detection of miRNA expression amount in all kinds of biological specimens greatly, reduces and detects cost, has promoted development and the application of miRNA at biomedical sector.And miRNA is because its small molecules, stability characteristics such as strong; Become comparatively ideal biomarker of clinical application just gradually; And the continuous development of new technology also makes the miRNA detection by quantitative have more advantage aspect specificity and the susceptibility, therefore uses miRNA to have feasibility preferably as the biomarker of early stage assessment of Health hazard and early screening.
Summary of the invention
The invention provides the primer of pulmonary lesion due to a kind of RT-PCR method diagnosis chrystile and the man-made mineral fiber, utilize this primer to cause pulmonary lesion and carry out early screening and assessment chrystile.
The primer of pulmonary lesion is primer sets A, primer sets B or primer sets C due to a kind of RT-PCR method diagnosis chrystile and the man-made mineral fiber, and every group of primer comprises reverse transcriptase primer and pcr amplification primer;
Primer sets A:
Reverse transcriptase primer: GTCGTATCCAGTGCAGGGTCCGAGGT
ATTCGCACTGGATACGACTAACCG；
The upstream primer of pcr amplification primer: GCGGCGGTAGCACCATCTGAAAT;
Primer sets B:
Reverse transcriptase primer: GTCGTATCCAGTGCAGGGTCCGAGG
TATTCGCACTGGATACGACAACACT；
The upstream primer of pcr amplification primer: GCGGCGGTAGCACCATTTGAAATC;
Primer sets C:
Reverse transcriptase primer: GTCGTATCCAGTGCAGGGTCCGAGG
TATTCGCACTGGATACGACTAACCG；
The upstream primer of pcr amplification primer: GCGGCGGTAGCACCATTTGAAAT;
The downstream primer of all primer sets pcr amplifications is: GTGCAGGGTCCGAGGT.
MiRNA is as a kind of microRNA, and the expression in tissue and peripheral blood all has specificity and stability preferably, makes it in the diagnosis of disease and examination, show significant advantage.The present invention finds that the miR-29 family member shows significant expression in the rat lung that fibre dusts such as chrystile expose and changes, and proposes the possibility of miR-29 as the potential effect biomarker.
The present invention dyes the dirt model through setting up rat, on the basis of lung tissue of rats pathological manifestations, detects the expression of miR-29 family member in dying the dirt lung tissue of rats.The result shows that miR-29b in 6 months all fibres dust exposed group down-regulated expression takes place, therefore can be used as the potential effect biomarker that chrystile and man-made mineral fiber cause pulmonary lesion; Significantly reduce and miR-29c shows expression amount in the chrystile exposed group of 3 months and 6 months, can be used for the early screening that chrystile causes pulmonary lesion.
The present invention is a technology platform with the miRNA detection by quantitative; Amplification microRNA miR-29 family member's primer is proposed; Thereby realize the expression of miR-29 effect biomarker, for the diagnosis and the examination of pulmonary lesion due to chrystile and the man-made mineral fiber provides a kind of strong detection means as pulmonary lesion due to chrystile and the man-made mineral fiber.
Description of drawings
Fig. 1 is control rats lung tissue (* 100) section Electronic Speculum figure.
A:HE dyeing; B:VG dyeing.
Fig. 2 is for dying 3 months chrystile group lung tissue of rats section Electronic Speculum figure behind the dirt.
A:HE dyeing * 100; B:VG dyeing * 100; C: electron microscopic observation * 10000.
Fig. 3 organizes lung tissue of rats (* 100) section Electronic Speculum figure for 3 months man-made mineral fibers after dying dirt.
A:HE dyeing; B:VG dyeing; A1:RWS; A2:GWF; A3:RFS; A4:RF; B1:RF; B2:RFS.
Fig. 4 organizes and chrystile group lung tissue of rats (* 100) section Electronic Speculum figure for 6 months man-made mineral fibers after dying dirt.
A:HE dyeing; B:VG dyeing; The A1:AS group; The B1:AS group; A2:RFS, B2:RWS.
Fig. 5 is the expression figure of chrystile and man-made mineral fiber's EXPOSED RATS lung tissue miR-29a/b/c.
A: dyed dirt 3 months; B: dyed dirt 6 months.
Embodiment
1, dust preparation
Spun glass, rock wool, refractory ceramic fibre factory material and chrystile sample are added water grind to form powdery in agate mortar, 180 degree baking 2h continued are ground to superfine little Powdered.Behind standard substance dust 180 degree baking 2h, weigh, be ground to superfine powder in the agate mortar.Dispersity is as shown in the table:
2, the dirt rat model is dyed in foundation
The powder that mill is good is dissolved in saline water, is made into suspension (the chrystile suspension is 10mg/ml, and man-made mineral fiber's suspension is 20mg/ml).For use behind the autoclaving.
90 two all male SD rats are divided into 9 groups at random, comprise blank group (BL), saline water group (NS), chrystile group (AS), rock wool standard substance group (RWS), refractory ceramic fibre standard substance group (RFS), spun glass standard substance group (GWS), rock wool group (RW), refractory ceramic fibre group (RF), spun glass group (GW).Adopt non-exposure formula tracheae perfusion to dye dirt (elder generation is to its numbering and body weight weighing before irritating lung), detailed process is following:
A) rat is used an amount of etherization;
B) postanesthetic rat neck skin is clamped, its mouth is opened, health hangs down naturally;
C) open the mouth of rat, under spot light lamp, find tracheae, syringe needle is inserted tracheae;
D) extract 1ml suspension (the NS group is equivalent saline water) with syringe, with syringe needle connect tight after, twitch syringe, have the gas suction then solution all to be got to lung; Represent that then syringe needle inserts in the rat stomach, must extract again and insert if can not twitch syringe;
E) extract syringe needle, aim at rat tracheae place with rubber pipette bulb and blow repeatedly, impel solution to get into lung better, it is residual to reduce the upper respiratory tract.
F) rat is decontroled, carry neck and gently tremble up and down, impel solution to get into lung.
G) observe the physiological situation of rat, treat rat change wake up after, continue to raise.
3, lung tissue pathology morphologic observation
Every group of rat drawn materials respectively at execution in 3 months, 6 months after dying dirt.Lung tissue segment is used 10% formaldehyde fixed, behind dehydration, paraffin embedding, by thickness section back row hematoxylin-eosin (HE) dyeing and Van Gieson (VG) dyeing (Cao Shufen etc., 2007 of 4 μ m; Zheng Jiyi, 2005).Electron microscopic sample is through 2.5% LUTARALDEHYDE and 1% osmic acid double fixed, and phosphoric acid buffer cleans, and 50%, 80%, 100% acetone dewaters step by step, epoxy resin 816 embeddings, polymerization, and ultrathin section(ing) is through 0.5% uranyl acetate and the dual electron stain of lead citrate.Pathomorphism respectively at observing lung tissue under light microscopic and the Electronic Speculum changes, and, to the degree pathological grading that each lung tissue is carried out alveolitis and pulmonary fibrosis the result is analyzed according to Szapiel method (Szapiel et al., 1979).
Opticmicroscope is observed down; Blank group, saline water group are not all seen obvious pathology at these two time points, and lung tissue structure is clear, and alveolar septum is not seen and thickened; NIP, oedema and fibrosis performance, no obvious inflammatory exudate and the epithelium that comes off (Fig. 1) in the alveolar space.The down visible interstitial pulmonary fibrosis of chrystile group lung tissue of rats light microscopic; Change varying degree from bronchiole, surrounding blood vessel and contiguous alveolus wall to whole lobe of the lung diffusivity; VG dyeing demonstration is wine-colored collegen filament, in the visible scavenger cell endochylema a large amount of cavitys is arranged under the Electronic Speculum, and swelling and degeneration is obvious; Alveolar septum has than multifilament, and chrystile group lung tissue of rats was local with cellular change and alveolar structure destruction (Fig. 2) on the basis of above-mentioned pathology in 6 months.Rock wool standard substance group, refractory ceramic fibre standard substance group, spun glass standard substance group, rock wool group, refractory ceramic fibre group, spun glass group lung tissue of rats are not all seen obvious fibrosis; Obvious collegen filament are not seen in VG dyeing; Mainly show as in the alveolar space inflammatory reaction such as visible scavenger cell, the epithelial cell that comes off and a small amount of transudate and alveolus wall and thicken, with refractory ceramic fibre standard substance group and refractory ceramic fibre group particularly evident (Fig. 3).6 months each man-made mineral fibers organize above-mentioned pathology and increase the weight of to some extent, but do not see obvious fibrosis (Fig. 4).
The man-made mineral fiber has the inflammatory reaction of causing ability, shows as tangible inflammation and invades alveolus wall and contiguous alveolar space, and II type alveolar epithelial cells substitutes I type epithelial cell.It mainly is the scavenger cell alveolitis that the man-made mineral fiber exposes the lung tissue of rats morphological change that causes, does not produce fibrosis lesion.The pulmonary fibrosis ability that causes of pointing out these dust than the asbestos group a little less than, or do not have the pulmonary fibrosis of causing ability.
4, miR-29 detection of expression
At first inquire about miRBase DB (http://www.mirbase.org/), obtain rat miR-29 family member's mature sequence, be respectively:
Rno-miR-29a：5’-uagcaccaucugaaaucgguua-3’
Rno-miR-29b-1/-2：5’-uagcaccauuugaaaucaguguu-3’
Rna-miR-29c：5’-uagcaccauuugaaaucgguua-3’
According to stem-loop method principle, design reverse transcriptase primer and the pcr amplification primer of miR-29a, miR-29b and miR-29c respectively.The upper reaches of pcr amplification primer are special primer, and downstream are universal primer.Primer sequence sees the following form:
Get lung tissue segment, every 100mg tissue adds 1ml RNAiso reagent (Takara, article No. D9108A) and extracts total RNA.Use synthetic cDNA first chain of M-MLV reversed transcriptive enzyme (Promega, article No. M1705), reaction adds total RNA 500 μ g as template, 1 μ M miRNART primer, 0.5 μ l, and other composition is with reference to the operation instruction of reversed transcriptive enzyme in the system, and reaction system is 10 μ l.Reaction conditions is following: 65 ℃, and 5min; Ice bath 10min; 16 ℃, 30min; 42 ℃, 30min; 85 ℃, 5min.With rt synthetic cDNA is template, uses quantitative PCR detection kit
Premix Ex Taq
TM(Takara, article No. DRR420A) detects miR-29 three hypotype miR-29a, miR-29b and miR-29c expression in each group respectively, and reaction system is 20 μ l, reaction conditions reference reagent box specification sheets.Data are added up, and Student ' s t-test analyzes the significance of difference.
The result show miR-29a only in the lung tissue of rats after chrystile exposed 3 months expression amount significantly reduce, expression amount changes not remarkable in all the other each groups.MiR-29b expression amount in 3 months spun glass of exposure and standard substance group, refractory ceramic fibre and standard substance group thereof significantly raises; And expression amount is compared with the saline water group significantly downward modulation is all taken place in exposing each group of 6 months, with modulation factor of amplitude modulation maximum under rock wool and the standard substance group thereof.MiR-29c expression amount in exposing 3 months spun glass and standard substance group thereof, refractory ceramic fibre group significantly raises, and expression amount significantly reduces in the chrystile exposed group; In each treatment group of 6 months of exposure, to compare with the saline water group, the expression amount of miR-29c all decreases, and except that spun glass and standard substance group thereof, all the other each groups all have significant difference (Fig. 5).
Claims (1)
1. the primer of pulmonary lesion due to RT-PCR method diagnosis chrystile and the man-made mineral fiber is primer sets A, primer sets B or primer sets C, and every group of primer comprises reverse transcriptase primer and pcr amplification primer; It is characterized in that:
Primer sets A:
Reverse transcriptase primer: GTCGTATCCAGTGCAGGGTCCGAGGT
ATTCGCACTGGATACGACTAACCG；
The upstream primer of pcr amplification primer: GCGGCGGTAGCACCATCTGAAAT;
Primer sets B:
Reverse transcriptase primer: GTCGTATCCAGTGCAGGGTCCGAGG
TATTCGCACTGGATACGACAACACT；
The upstream primer of pcr amplification primer: GCGGCGGTAGCACCATTTGAAATC;
Primer sets C:
Reverse transcriptase primer: GTCGTATCCAGTGCAGGGTCCGAGG
TATTCGCACTGGATACGACTAACCG；
The upstream primer of pcr amplification primer: GCGGCGGTAGCACCATTTGAAAT;
The downstream primer of all primer sets pcr amplifications is: GTGCAGGGTCCGAGGT.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012103284256A CN102827938A (en) | 2012-09-07 | 2012-09-07 | Primer for diagnosing lung lesions caused by chrysotile and man-made mineral fiber by using RT-PCR method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012103284256A CN102827938A (en) | 2012-09-07 | 2012-09-07 | Primer for diagnosing lung lesions caused by chrysotile and man-made mineral fiber by using RT-PCR method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102827938A true CN102827938A (en) | 2012-12-19 |
Family
ID=47331245
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012103284256A Pending CN102827938A (en) | 2012-09-07 | 2012-09-07 | Primer for diagnosing lung lesions caused by chrysotile and man-made mineral fiber by using RT-PCR method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102827938A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112941185A (en) * | 2021-03-26 | 2021-06-11 | 杭州医学院 | Application of miR-29a as marker in preparation of malignant mesothelioma detection kit |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101809169A (en) * | 2007-07-31 | 2010-08-18 | 俄亥俄州立大学研究基金会 | Methods for reverting methylation by targeting DNMT3A and DNMT3B |
| CN101883576A (en) * | 2007-07-31 | 2010-11-10 | 得克萨斯系统大学董事会 | Micro-rna family of that modulates fibrosis and uses thereof |
-
2012
- 2012-09-07 CN CN2012103284256A patent/CN102827938A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101809169A (en) * | 2007-07-31 | 2010-08-18 | 俄亥俄州立大学研究基金会 | Methods for reverting methylation by targeting DNMT3A and DNMT3B |
| CN101883576A (en) * | 2007-07-31 | 2010-11-10 | 得克萨斯系统大学董事会 | Micro-rna family of that modulates fibrosis and uses thereof |
Non-Patent Citations (6)
| Title |
|---|
| LEAH CUSHING,ET AL: "miR-29 Is a Major Regulator of Genes Associated with Pulmonary Fibrosis", 《AMERICAN JOURNAL OF RESPIRATORY CELL AND MOLECULAR BIOLOGY》, vol. 45, 31 December 2011 (2011-12-31), pages 287 - 294, XP055267289, DOI: doi:10.1165/rcmb.2010-0323OC * |
| MULLER FABBRI,ET AL: "MicroRNA-29 family reverts aberrant methylation in lung cancer by targeting DNA methyltransferases 3A and 3B", 《PNAS》, vol. 104, no. 40, 2 October 2007 (2007-10-02), pages 15805 - 15810, XP002591425, DOI: doi:10.1073/PNAS.0707628104 * |
| RAYLEEN V BOWMAN,ET AL: "Epigenomic targets for the treatment of respiratory disease", 《EXPERT OPINION ON THERAPEUTIC TARGETS》, vol. 13, no. 6, 30 June 2009 (2009-06-30), pages 625 - 640 * |
| 张幸等: "人造矿物纤维的体外细胞毒性研究", 《浙江预防医学》, vol. 12, no. 3, 31 March 2000 (2000-03-31) * |
| 朱丹霞等: "实时定量PCR检测白血病相关miRNA方法的建立", 《中国实验血液学杂志》, vol. 18, no. 3, 31 December 2010 (2010-12-31), pages 757 - 761 * |
| 鞠莉等: "石棉相关疾病生物标志物的研究进展", 《中国职业医学》, vol. 35, no. 5, 1 March 2001 (2001-03-01), pages 427 - 428 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112941185A (en) * | 2021-03-26 | 2021-06-11 | 杭州医学院 | Application of miR-29a as marker in preparation of malignant mesothelioma detection kit |
| CN112941185B (en) * | 2021-03-26 | 2023-06-23 | 杭州医学院 | Application of miR-29a as marker in preparation of malignant mesothelioma detection kit |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Teng et al. | Plant-derived exosomal microRNAs inhibit lung inflammation induced by exosomes SARS-CoV-2 Nsp12 | |
| Woo et al. | Clinical spectrum of Exophiala infections and a novel Exophiala species, Exophiala hongkongensis | |
| WO2015085905A1 (en) | Non-coding rna of salmonella and identification and use thereof | |
| CN107447033A (en) | A kind of diagnosis of colorectal carcinoma biomarker and its application | |
| CN101831500B (en) | Small RNA (Ribonucleic Acid) quantitative detecting method and reagent kit | |
| CN108883088A (en) | Using the Epithelial and stromal of chromone derivative conversion inhibitory activity as fibrosis prevention and the new application for the treatment of pharmaceutical composition | |
| CN102732520A (en) | Preparation method for serum miRNAs specific to active pulmonary tuberculosis | |
| CN102250942B (en) | dsRNA carrier for interfering Bx-cpl-2 gene expression and application thereof in control and research on bursaphelenchus xylophilus | |
| CN108004322A (en) | A kind of applications of lncRNA in adenocarcinoma of lung is diagnosed and/or treated | |
| CN102286509A (en) | DsRNA vector capable of interfering expression of Bx-cpl-1 gene and use thereof in prevention and control of and study on bursaphelenchus xylophilus | |
| CN102827938A (en) | Primer for diagnosing lung lesions caused by chrysotile and man-made mineral fiber by using RT-PCR method | |
| CN104450706A (en) | Method for inducing blood lymphocyte of litopenaeus vannamei to generate UPR (unfolded protein response) by means of RNA interference technology | |
| CN102634605B (en) | Method for detecting egg drop syndrome viruses and kit for method | |
| CN105624325B (en) | The diagnosis and treatment marker of adenocarcinoma of lung | |
| CN109620958A (en) | Application of the let-7c/let-7d in Asherman's syndrom and/or the diagnosis of slim inner membrance and treatment | |
| CN108103202A (en) | 7 kind serum excretion body miRNAs relevant with liver cancer diagnosis and treatment and its application | |
| Liu et al. | Investigation of pathogenic mechanism of covert mortality Nodavirus infection in Penaeus vannamei | |
| Erami et al. | A case of COVID-19-associated rhino-orbito-cerebral mucormycosis caused by Apophysomyces variabilis with a review of the literature | |
| WO2015085903A1 (en) | Non-coded rna of in-vivo infected microorganisms, parasitic microorganisms, symbiotic microorganisms and identification and application thereof | |
| Liu et al. | Orbiliaceous fungi from Tibet, China | |
| CN107625780B (en) | Non-small cell lung cancer diagnosis marker microRNA-1253 and application thereof in medicine and diagnosis kit | |
| CN102451474B (en) | Antitumor effect, implementation method and usage of miRNA (micro-ribonucleic acid) | |
| CN105803068A (en) | Molecular marker for diagnosis and treatment of lung adenocarcinoma | |
| CN102037929A (en) | Method for constructing animal infection model of streptococcus suis type 2 | |
| CN109988766A (en) | The preparation and its application of LncRNA-COX2 siRNA |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20121219 |