CN102813773B - A kind of herbal mixture for the treatment of endometriosis and its preparation method and application - Google Patents
A kind of herbal mixture for the treatment of endometriosis and its preparation method and application Download PDFInfo
- Publication number
- CN102813773B CN102813773B CN201210310669.1A CN201210310669A CN102813773B CN 102813773 B CN102813773 B CN 102813773B CN 201210310669 A CN201210310669 A CN 201210310669A CN 102813773 B CN102813773 B CN 102813773B
- Authority
- CN
- China
- Prior art keywords
- parts
- endometriosis
- herbal mixture
- treatment
- preparation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Medicines Containing Plant Substances (AREA)
Abstract
The invention discloses a kind of herbal mixture for the treatment of endometriosis, it comprises the component of following parts by weight: Pollen Tyjphae 8 ~ 12 parts, Oletum Trogopterori 8 ~ 12 parts, Sanguis Draxonis 1 ~ 3 part, Radix Astragali 12 ~ 20 parts, Radix Dipsaci 8 ~ 12 parts, Myrrha (processed) 8 ~ 12 parts, Rhizoma Corydalis 8 ~ 12 parts, Fructus Toosendan 8 ~ 12 parts.The invention also discloses preparation method and the application of above-mentioned herbal mixture.Herbal mixture of the present invention has played Chinese medicine and to have cured the disease the advantage of Mutiple Targets, by the laboratory observation of ectopic endometrium development in Drug inhibition Endometriosis Model in Rats, find that Chinese medicine compound of the present invention can cell proliferation, angiogenesis and invasion and attack in suppression ectopic endometrium tissue, reduce the development of the aspect suppression endometriosis such as proinflammatory cytokines in peritoneal fluid.
Description
Technical field
The invention belongs to technical field of Chinese medicines, be specifically related to a kind of herbal mixture for the treatment of endometriosis and its preparation method and application.
Background technology
Endometriosis is the common gynecological disease that the activated endometrial tissue of tool appears at position beyond intra-uterine membranous layer.Endometriosis in optimum morphologic features, but has the ability of the plantation of similar malignant tumor, invasion and attack and metastasis on pathology.The plantation of ectopic endometrium and invasion and attack depend on sufficient angiogenesis and blood supply.The change of peritoneal immunity environment in uterus plays an important role in the developing of endometriosis.Between peritoneal fluid based intracellular cvtokine and and cell between interaction be that the plantation of ectopic endometrium and invasion and attack provide adapt circumstance.
Current laparoscopic surgery and gonadotropin releasing hormone analogues (GnRHa) are the prefered methods for the treatment of endometriosis.But operative treatment easily causes adhesion to cause postoperative bellyache and infertile, and the focus of not excising and the Pathophysiology mechanism of causing a disease of not correcting can cause recurrence; GnRHa medicine can cause Pituitary-ovary Axis hypofunction, causes similar menopausal syndrome and easily recurs in a short time after drug withdrawal.Chinese medicine endometriosis is better than Western medicine in alleviation clinical symptoms, regulating menstruation and assisting pregnancy etc., and toxic and side effects is little, can long-term taking.Therefore finding curative effect reliable Chinese medicine, being of great significance for avoiding taking merely the untoward reaction tool that this disease of western medicine occurs.
Summary of the invention
Technical problem to be solved by this invention is to provide the herbal mixture of the treatment endometriosis that a kind of efficiency is high, toxic and side effects is little.
The technical problem that the present invention also will solve is to provide the preparation method of above-mentioned herbal mixture.
The technical problem that the present invention finally will solve is to provide the application of above-mentioned herbal mixture in preparation treatment endometriosis medicine.
For solving the problems of the technologies described above, the technical solution used in the present invention is as follows:
A kind of herbal mixture for the treatment of endometriosis, it is characterized in that, it comprises the component of following parts by weight: Pollen Tyjphae 8 ~ 12 parts, Oletum Trogopterori 8 ~ 12 parts, Sanguis Draxonis 1 ~ 3 part, Radix Astragali 12 ~ 20 parts, Radix Dipsaci 8 ~ 12 parts, Myrrha (processed) 8 ~ 12 parts, Rhizoma Corydalis 8 ~ 12 parts, Fructus Toosendan 8 ~ 12 parts.
The herbal mixture of above-mentioned treatment endometriosis preferably includes the component of following parts by weight: Pollen Tyjphae 10 parts, Oletum Trogopterori 10 parts, Sanguis Draxonis 2 parts, Radix Astragali 15 parts, Radix Dipsaci 10 parts, Myrrha (processed) 10 parts, Rhizoma Corydalis 10 parts, Fructus Toosendan 10 parts.
The preparation method of the herbal mixture of above-mentioned treatment endometriosis, by the Pollen Tyjphae of formula ratio, Oletum Trogopterori, Radix Astragali, Radix Dipsaci, Myrrha (processed), Rhizoma Corydalis, Fructus Toosendan mixing, soak, decoct twice, each big fire is fried open rear little fire and decocts 1 ~ 2 hour, leach medicinal liquid, merge the medicinal liquid leached for twice and mix and concentrate, the Powdered Sanguis Draxonis of formula ratio directly adds the medicinal liquid after concentrating and get final product.
Wherein, the time of soaking is 30 minutes.
Wherein, the weight added water is 15 ~ 20 times of Pollen Tyjphae, Oletum Trogopterori, Radix Astragali, Radix Dipsaci, Myrrha (processed), Rhizoma Corydalis and Fructus Toosendan gross weight.
The application of herbal mixture in preparation treatment endometriosis medicine of above-mentioned treatment endometriosis.
Beneficial effect: herbal mixture of the present invention has played Chinese medicine and to have cured the disease the advantage of Mutiple Targets, by the laboratory observation of ectopic endometrium development in Drug inhibition Endometriosis Model in Rats, find that Chinese medicine compound of the present invention can cell proliferation, angiogenesis and invasion and attack in suppression ectopic endometrium tissue, reduce the development of the aspect suppression endometriosis such as proinflammatory cytokines in peritoneal fluid.
Accompanying drawing explanation
Fig. 1: the volume of endometriosis cyst before and after the treatment of embodiment 1 herbal mixture.
Fig. 2: embodiment 1 herbal mixture suppresses the immunohistochemical analysis photo of endometriotic tissues propagation.
Fig. 3: embodiment 1 herbal mixture suppresses ectopic endometrium medium vessels to generate.
Fig. 4: embodiment 1 herbal mixture suppresses ectopic endometrium invasion and attack.
Fig. 5: embodiment 1 herbal mixture reduces the level of TNF-α and IL-1 β in endometriosis peritoneal fluid.
Detailed description of the invention
According to following embodiment, the present invention may be better understood.But those skilled in the art will readily understand, the content described by embodiment only for illustration of the present invention, and should can not limit the present invention described in detail in claims yet.
Embodiment 1:
The herbal mixture of above-mentioned treatment endometriosis, comprises the component of following parts by weight: Pollen Tyjphae 10 parts, Oletum Trogopterori 10 parts, Sanguis Draxonis 2 parts, Radix Astragali 15 parts, Radix Dipsaci 10 parts, Myrrha (processed) 10 parts, Rhizoma Corydalis 10 parts, Fructus Toosendan 10 parts.
Preparation method, by the Pollen Tyjphae of formula ratio, Oletum Trogopterori, Radix Astragali, Radix Dipsaci, Myrrha (processed), Rhizoma Corydalis, Fructus Toosendan mixing, add the water soaking 30 minutes of 16 times of weight, decoct twice, each big fire is fried open rear little fire and decocts 1.5 hours, leach medicinal liquid, merge the medicinal liquid leached for twice and mix and concentrate, the Powdered Sanguis Draxonis of formula ratio directly adds the medicinal liquid after concentrating and get final product.
Embodiment 2:
The herbal mixture of above-mentioned treatment endometriosis, comprises the component of following parts by weight: Pollen Tyjphae 8 parts, Oletum Trogopterori 8 parts, Sanguis Draxonis 1 part, Radix Astragali 12 parts, Radix Dipsaci 8 parts, Myrrha (processed) 8 parts, Rhizoma Corydalis 8 parts, Fructus Toosendan 8 parts.
Preparation method, by the Pollen Tyjphae of formula ratio, Oletum Trogopterori, Radix Astragali, Radix Dipsaci, Myrrha (processed), Rhizoma Corydalis, Fructus Toosendan mixing, add the water soaking 30 minutes of 15 times of weight, decoct twice, each big fire is fried open rear little fire and decocts 1 hour, leach medicinal liquid, merge the medicinal liquid leached for twice and mix and concentrate, the Powdered Sanguis Draxonis of formula ratio directly adds the medicinal liquid after concentrating and get final product.
Embodiment 3:
The herbal mixture of above-mentioned treatment endometriosis, comprises the component of following parts by weight: Pollen Tyjphae 12 parts, Oletum Trogopterori 12 parts, Sanguis Draxonis 3 parts, Radix Astragali 20 parts, Radix Dipsaci 12 parts, Myrrha (processed) 12 parts, Rhizoma Corydalis 12 parts, Fructus Toosendan 12 parts.
Preparation method, by the Pollen Tyjphae of formula ratio, Oletum Trogopterori, Radix Astragali, Radix Dipsaci, Myrrha (processed), Rhizoma Corydalis, Fructus Toosendan mixing, add the water soaking 30 minutes of 20 times of weight, decoct twice, each big fire is fried open rear little fire and decocts 2 hours, leach medicinal liquid, merge the medicinal liquid leached for twice and mix and concentrate, the Powdered Sanguis Draxonis of formula ratio directly adds the medicinal liquid after concentrating and get final product.
Embodiment 4: herbal mixture of the present invention suppresses the development of endometriosis in Endometriosis Model in Rats.
1. the foundation of Endometriosis Model in Rats:
10% chloral hydrate solution carries out intraperitoneal injection of anesthesia (0.7mL/200g), and being lain on the back by rat is fixed on operating-table, cuts off ventral seta, routine disinfection.Take off median abdominal incision, upwards cut 3cm from superior margin of pubic symphysis 0.5cm place.Free left uterine, near-end is from left cornua uteri 1cm place's ligation, and far-end goes out ligation from ovary 1cm.The uterine cancer cell cut is put into the culture dish filling physiological saline solution, stringer is cut open, cuts one piece of endometrial tissue of 5cm × 5cm.On the right side of incision of abdominal wall, beat tunnel between abdominal muscle and subcutaneous fascia layer, endometrial tissue block is entirely inserted right side tunnel bottom, make lining endothelium be close to abdominal muscle, conventional pass abdomen.Sham operated rats does not implant endometrial tissue, the same model group of other steps.28 days afterwards second time cut open the belly, check the growing state of endometriosis stove, and by the cyst size that kind of calliper is formed.
2. grouping and dosage regimen:
Be divided at random by successful for modeling rat 3 groups (model control group, embodiment 1 herbal mixture low dose group, embodiment 1 herbal mixture high dose group), each group is by following administration:
(1) embodiment 1 herbal mixture low dose group: every day every, rat gave 8.57g/kg embodiment 1 herbal mixture;
(2) embodiment 1 herbal mixture high dose group: every day every, rat gave 17.14g/kg embodiment 1 herbal mixture;
(3) model control group: every day every, rat gave equal-volume distilled water.
(4) sham operated rats: every day every, rat gave equal-volume distilled water.
Each group of rat is administration by gavage administration, continuous 4 weeks.After treating 4 weeks, collect rat abdominal cavity liquid, ELISA method detects the concentration of VEGF, TNF-α and IL-1 β; With kind of calliper Rat Endometriosis cyst volumes (0.52 × major diameter × shortaxis minor axis
2); Endometriosis cyst (sham operated rats gets normal endometrium) is divided into two parts, portion is fixed with 10% neutral formalin solution, Immunohistochemical Method detects cell proliferation (PCNA antibody staining) and vessel density (CD31 antibody staining), another part is for extracting RNA, and quantitative real-time PCR detects the expression (β-Actin is internal reference) of MMP-9 and TIMP-1.
Primer: MMP-9forward:5 '-CCGCGTGTACGGGCTCGAAG-3 '
MMP-9reverse:5’-GCCTTTGCCCAGCGACCACA-3’
TIMP-1forward:5’-TGCCCCAACCCACCCACAGA-3’
TIMP-1reverse:5’-GCTGGGGTGTAGGCGAACCG-3’
β-Actinforward:5’-CACCCGCGAGTACAACCTTC-3’
β-Actinreverse:5’-CCCATACCCACCATCACACC-3’
3. experimental result
(1) embodiment 1 herbal mixture significantly reduces endometriosis cyst volumes.
Each group of rat before the treatment endometriosis cyst volumes does not have significant difference.Through treatment in 4 weeks, embodiment 1 herbal mixture significantly reduced endometriosis cyst volumes, sees Fig. 1.
(2) embodiment 1 herbal mixture significantly suppresses endometriotic tissues to be bred.
In model of endometriosis group, PCNA+ cell proportion is apparently higher than sham operated rats.In embodiment 1 herbal mixture treatment group, PCNA+ cell proportion is starkly lower than matched group.The results are shown in Figure 2.
(3) embodiment 1 herbal mixture significantly suppresses endometriosis angiogenesis.
Embodiment 1 herbal mixture obviously reduces the vessel density in endometriosis rat abdominal cavity liquid in VEGF level and ectopic endometrium tissue.The results are shown in Figure 3.
(4) embodiment 1 herbal mixture suppresses the invasion and attack of ectopic endometrium.
Embodiment 1 herbal mixture is obviously lowered MMP-9 in endometriosis cyst and is expressed, and raises the expression of its inhibitive factor TIMP-1, sees Fig. 4.
(5) embodiment 1 herbal mixture suppresses the level of inflammatory cytokine TNF-α and IL-1 β in endometriosis peritoneal fluid.
In model of endometriosis group peritoneal fluid, the level of TNF-α and IL-1 β is apparently higher than sham operated rats.Embodiment 1 herbal mixture significantly reduces the level of these two kinds of inflammatory cytokines, and in high dose embodiment 1 herbal mixture treatment group peritoneal fluid the level of TNF-α and IL-1 β and sham operated rats close, see Fig. 5.
SEQUENCELISTING
<110> Jiangsu Prov. Research Inst. Traditional Chinese Medical
<120> herbal mixture for the treatment of endometriosis and its preparation method and application
<130>SG120928001
<160>6
<170>PatentInversion3.3
<210>1
<211>20
<212>DNA
<213>Artificial
<220>
<223>MMP-9forward
<400>1
ccgcgtgtacgggctcgaag20
<210>2
<211>20
<212>DNA
<213>Artificial
<220>
<223>MMP-9reverse
<400>2
gcctttgcccagcgaccaca20
<210>3
<211>20
<212>DNA
<213>Artificial
<220>
<223>TIMP-1forward
<400>3
tgccccaacccacccacaga20
<210>4
<211>20
<212>DNA
<213>Artificial
<220>
<223>TIMP-1reverse
<400>4
gctggggtgtaggcgaaccg20
<210>5
<211>20
<212>DNA
<213>Artificial
<220>
<223>β-Actinforward
<400>5
cacccgcgagtacaaccttc20
<210>6
<211>20
<212>DNA
<213>Artificial
<220>
<223>β-Actinreverse
<400>6
cccatacccaccatcacacc20
Claims (6)
1. treat the herbal mixture of endometriosis for one kind, it is characterized in that, it is made up of the component of following parts by weight: Pollen Tyjphae 8 ~ 12 parts, Oletum Trogopterori 8 ~ 12 parts, Sanguis Draxonis 1 ~ 3 part, Radix Astragali 12 ~ 20 parts, Radix Dipsaci 8 ~ 12 parts, Myrrha (processed) 8 ~ 12 parts, Rhizoma Corydalis 8 ~ 12 parts, Fructus Toosendan 8 ~ 12 parts.
2. the herbal mixture for the treatment of endometriosis according to claim 1, it is characterized in that, it is made up of the component of following parts by weight: Pollen Tyjphae 10 parts, Oletum Trogopterori 10 parts, Sanguis Draxonis 2 parts, Radix Astragali 15 parts, Radix Dipsaci 10 parts, Myrrha (processed) 10 parts, Rhizoma Corydalis 10 parts, Fructus Toosendan 10 parts.
3. the preparation method of the herbal mixture for the treatment of endometriosis according to claim 1, it is characterized in that, by the Pollen Tyjphae of formula ratio, Oletum Trogopterori, Radix Astragali, Radix Dipsaci, Myrrha (processed), Rhizoma Corydalis, Fructus Toosendan mixing, soak, decoct twice, each big fire is fried open rear little fire and decocts 1 ~ 2 hour, leaches medicinal liquid, merge the medicinal liquid leached for twice mix and concentrate, the Powdered Sanguis Draxonis of formula ratio directly adds the medicinal liquid after concentrating and get final product.
4. the preparation method of the herbal mixture for the treatment of endometriosis according to claim 3, is characterized in that, the time of soaking is 30 minutes.
5. the preparation method of the herbal mixture for the treatment of endometriosis according to claim 3, is characterized in that, the weight added water is 15 ~ 20 times of Pollen Tyjphae, Oletum Trogopterori, Radix Astragali, Radix Dipsaci, Myrrha (processed), Rhizoma Corydalis and Fructus Toosendan gross weight.
6. the application of herbal mixture in preparation treatment endometriosis medicine for the treatment of endometriosis according to claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210310669.1A CN102813773B (en) | 2012-09-28 | 2012-09-28 | A kind of herbal mixture for the treatment of endometriosis and its preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210310669.1A CN102813773B (en) | 2012-09-28 | 2012-09-28 | A kind of herbal mixture for the treatment of endometriosis and its preparation method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102813773A CN102813773A (en) | 2012-12-12 |
| CN102813773B true CN102813773B (en) | 2016-01-20 |
Family
ID=47298455
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210310669.1A Active CN102813773B (en) | 2012-09-28 | 2012-09-28 | A kind of herbal mixture for the treatment of endometriosis and its preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102813773B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103110921B (en) * | 2013-02-20 | 2014-11-19 | 沈红 | Externally-applied TCM (traditional Chinese medicine) preparation for treating endometriosis |
| CN104906296A (en) * | 2015-06-11 | 2015-09-16 | 广西中医药大学 | Traditional Chinese medicine preparation for treating endometriosis and preparation method of traditional Chinese medicine preparation |
| CN105944033B (en) * | 2016-06-27 | 2020-05-01 | 江苏省中医药研究院 | Traditional Chinese medicine composition containing radix curcumae |
| CN109078143B (en) * | 2018-10-25 | 2020-12-15 | 上海中医药大学附属岳阳中西医结合医院 | Traditional Chinese medicine composition for treating endometriosis and application thereof |
-
2012
- 2012-09-28 CN CN201210310669.1A patent/CN102813773B/en active Active
Non-Patent Citations (2)
| Title |
|---|
| 《子宫内膜异位症中医治疗概况》;卢翠云 等;《江西中医药》;20010630;第32卷(第3期);第58页左栏第2段—右栏第4段 * |
| 《活血化瘀法治疗子宫内膜异位症的临床观察》;王艳丽 等;《中国实用医药杂志》;20070531;第2卷(第14期);第76页右栏第1段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102813773A (en) | 2012-12-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102813773B (en) | A kind of herbal mixture for the treatment of endometriosis and its preparation method and application | |
| RU2582226C1 (en) | Method for treatment and prevention of recurrent intrauterine adhesions | |
| Park et al. | Successful vaginal birth after prior cesarean section in a patient with pyoderma gangrenosum | |
| CN102908579B (en) | Traditional Chinese medicine preparation for treating gynecological diseases, liver diseases and prostatitis and preparation method of traditional Chinese medicine preparation | |
| CN103585573B (en) | Oral medicine for treating hysteromyoma | |
| CN101879303B (en) | Blood-nourishing and uterus-nourishing Chinese medical pill | |
| CN103330721B (en) | Holothurian flower extract for treatment of female POF and its preparation method | |
| CN103932184B (en) | A kind of Chinese medicine composition | |
| CN112675289B (en) | Application of short peptide Asp-His-Tyr in preparing medicine for treating endometriosis | |
| WO2003022260A1 (en) | Use of methotrexate and l-arginine for the preparation of a medicament for treatment of uterine myoma | |
| CN100464753C (en) | foscarnet sodium composition | |
| CN104013928A (en) | Drug for treating hysteromyoma and endometriosis and preparation method thereof | |
| CN113244368B (en) | Application of polypeptide in preparing medicine for treating endometriosis | |
| CN1899363B (en) | Chinese medicine composition for increasing immunity and its preparing method | |
| CN108310363A (en) | Applications of the CRM197 in the drug for preparing treatment polycystic ovary syndrome | |
| CN102988401B (en) | Application of adenosine triphosphate or medicinal salt of adenosine triphosphatein in preparation of medicine for treating endometriosis | |
| WO2018233509A1 (en) | Abortion drug | |
| CN104042672B (en) | A kind of Chinese medicine compound prescription vaginal washing fluid and its preparation method and application | |
| CN112587523B (en) | Application of ketorolac in preparation of medicine for preventing or treating postoperative recurrence of endometriosis | |
| CN108853007B (en) | A kind of gel preparation and application thereof for treating functional uterine bleeding | |
| CN101219207A (en) | Application of recombined human vascellum esoderma inhibin in medicine preparation | |
| CN102671108B (en) | Applications for traditional Chinese medicine pharmaceutical composition | |
| CN105833220A (en) | Traditional Chinese medicine composition for assistant treatment of gynecologic malignant tumors | |
| CN106420878A (en) | Chinese and Western medicine composition for treating rectal cancer as well as preparation method and application thereof | |
| CN102671107A (en) | Traditional Chinese medicine pharmaceutical composition |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |