CN102786596A

CN102786596A - Single-chain antibody KGH-R1-ScFv for resisting p21Ras protein and application thereof

Info

Publication number: CN102786596A
Application number: CN2012103218945A
Authority: CN
Inventors: 杨举伦; 胡奇婵; 陈玥; 王丽; 丁峰
Original assignee: Individual
Current assignee: Individual
Priority date: 2012-09-04
Filing date: 2012-09-04
Publication date: 2012-11-21

Abstract

The invention provides a single-chain antibody KGH-R1-ScFv for resisting p21Ras protein and application of the single-chain antibody KGH-R1-ScFv, belonging to the field of medical biology, and particularly relates to a recombination human adenovirus vector Ad-hrGFP-ScFv with a single-chain antibody coding gene KGH-R1-ScFv. The single-chain antibody provided by the invention can specifically recognise and perform antagonism to p21Ras proteins with different sources, different tissues and different cell strains in a broad-spectrum way, and also can inhibit the proliferation capacity and invasion capacity of human tumor cell of p21Ras protein with high expression in vitro, reduce the ratio of cells in cell division period, and inhibit the growth of transplantation tumor of human tumor cell of p21Ras protein with high expression in mice.

Description

Proteic single-chain antibody KGH-R1-ScFv of a kind of anti-p21Ras and application thereof

Technical field

The invention belongs to the Medical Biology field, relate in particular to proteic single-chain antibody KGH-R1-ScFv of a kind of anti-p21Ras and application thereof.

Background technology

Tumour, especially malignant tumour, serious harm human life and health.Carry out the study on prevention of malignant tumour, for the generation of prophylaxis of tumours, reduce the tumour incidence, reduce mortality ratio, guiding clinical treatment etc., all be of great practical significance.

The Ras gene is a kind of important proto-oncogene, participates in the generation and the development of kinds of tumors.Its expression product Ras albumen is participated in proliferation of cells, growth, differentiation, apoptosis as important molecular switch.Research shows, the ras transgenation with (or) to cross the generation of expressing with tumour very close with the development relation for Ras albumen, in the pathological process of kinds of tumors, plays important effect.Therefore, people have carried out comparatively deep research to the signal transduction pathway of Ras gene, Ras albumen and participation thereof.

The Ras gene is one of proto-oncogene of finding the earliest, is found in Harvery murine sarcoma virus and Kirsten murine sarcoma virus the earliest.The Ras gene is conservative relatively in evolution, extensively is present in the various eukaryotes.Mammiferous Ras gene family has three members, i.e. H-ras, and K-ras, N-ras, in human chromosome, they are positioned 11p14.1 respectively, and 12p12.1/12q24.2 is on the 1p13.2 karyomit(e).The Ras gene has similar structure, forms by four exons, is distributed on the DNA of the about 30kb of total length, and the molecular weight that coding is made up of 188-189 amino acid is the protein of 21KD, so be called p21Ras albumen.

P21Ras albumen is that the GTP/GDP of film mating type is conjugated protein, is positioned the cytolemma inboard.P21Ras albumen has more weak GTP enzymic activity, with GTP and GDP very strong affinity is arranged.Under the normal circumstances, p21Ras combines not active with GDP.When extracellular growth and differentiation factor was transmitted to the inboard p21Ras albumen of after birth to signal, what can strengthen p21Ras albumen and GTP combined actively, makes p21Ras albumen become state of activation, the signalling system opening.Because the existence of GTP enzymic activity, p21Ras albumen can make GTP be hydrolyzed into GDP, p21Ras albumen becomes inactivated state, and signalling system is closed.After p21Ras albumen and GDP combine, can activate guanylic acid and discharge albumen (GNRP), GNRP makes p21Ras albumen discharge GDP and combines GTP.Therefore, can abstemiously regulate of the opening and closing of p21Ras albumen, accomplish the adjusting of pair cell factor signal conductive process signalling system through the mutual conversion of GTP and GDP.

After being activated, the Ras proto-oncogene becomes the oncogene that carcinogenic activity is arranged.The mode of Ras gene activation has 3 kinds: point mutation, gene great expression, gene insert and transposition.After the Ras gene was activated, the proteic configuration of its expression product Ras also changed, and weakened with the binding ability of GDP, and did not need the stimulation of extraneous growth signals to get final product activation after GTP combines; Simultaneously Ras albumen intrinsic GTP enzymic activity reduces, cause that Ras albumen combines, regulates with GTP/GDP unusually, the Ras albumen of active state activates the downstream signal path constantly, causes cell can not breed with controlling, cancerate, while apoptosis minimizing.

Along with the development of Protocols in Molecular Biology and genetic engineering technique, the biological procedures that tumour forms is further illustrated, and the new biotherapy pattern of oncotherapy is applied to clinical gradually and has shown good curative effect.Tumor biotherapy is divided into immunotherapy of tumors and therapy of tumor again.Gene therapy is meant foreign gene imported target cell, with correct or compensation because of genetic flaw, the disease that causes unusually, reach therapeutic purpose.Along with the development of cell signalling and antibody engineering technology, the intrabody technology also has been born.Intrabody is meant at cell inner expression and is located in subcellular compartment (like karyon, endochylema or some organoid), with specific target molecule effect processing, secretion or the function of blocking-up target molecule (disturb or) thus bring into play one type of new engineered antibody of its biological function.

Be used for the complete antibody of tumor biotherapy because molecular weight is bigger, its vascular permeability is weak, diffuse into ability in the tumour, long half time, immunogenicity are strong, and limited its targeted delivery and tumour antagonism effect.The characteristics of intrabody cell inner expression provide a kind of effective this type of antagonism p21Ras albumen to be positioned the inboard proteic method of cytolemma.Prepare a kind of intrabody, can in tumour cell, express anti-p21Ras protein product, p21Ras protein signal transduction pathway in the blocking-up tumour cell, restriction growth of tumor and diffusion are expected to reach the purpose of all kinds of tumours that treatment Ras albumen causes.

Summary of the invention

The invention provides the proteic single-chain antibody coding gene sequence of a kind of anti-p21Ras, and the application of this sequence.

The proteic single-chain antibody KGH-R1-ScFv of a kind of anti-p21Ras of the present invention is characterized in that this antibody coding gene order is shown in SEQ ID NO1.

SEQ?ID?NO1：

>KGH-R1-ScFv?(DNA)

GCGGCCCAGCCGGCCATGGCCCAGGTGAAGCTGCAGGAGTCTGGGGAAGGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTGACTATTACATGTATTGGGTTCGCCAGACTCCGGAAAAGAGGCTGGAGTGGGTCGCAATCATTAGTGATGGTGGTAGTTACACCTACTATCCAGACAGTGTGAAGGGGCGATTCACCATCTCCAGAGACAATACCAAGAAAAACCTGTACCTGCAAATGAGCAGTCTGAGGTCTGAGGACACAGCCATGTATTACTGTGCAAGAGATCCCCATTACTCCGGTAGTAGCCGCCTGTTTGTTAACTGGGGCCAAGGCACCACGGTCACCGTCTCCTCAGGTGGAGGCGGTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGATCGGACATCGAGCTCACTCAGTCTCCAGCTTCCTTAGCTGTATCTCTGGGGCAGAGGGCCACCATCTCATACAGGGCCAGCAAAAGTGTCAGTACATCTGGCTATAGTTATATGCACTGGAACCAACAGAAACCAGGACAGCCACCCAGACTCCTCATCTATCTTGTATCCAACCTAGAATCTGGGGTCCCTGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACCCTCAACATCCATCCTGTGGAGGAGGAGGATGCTGCAACCTATTACTGTCAGCACATTAGAGAGCTTACACGTTCGGAGGGGGGACCAAGCTGGCAAATCAAACGGGCGGCCGCAGGTGCGCCGGTGCCGTATCCGGATCCGCTGGAACCGCGTGCCGCATAG

>KGH-R1-ScFv?(Amino?acid)

AAQPAMAQVKLQESGEGLVKPGGSLKLSCAASGFTFSDYYMYWVRQTPEKRLEWVAIISDGGSYTYYPDSVKGRFTISRDNTKKNLYLQMSSLRSEDTAMYYCARDPHYSGSSRLFVNWGQGTTVTVSSGGGGSGGGGSGGGGSDIELTQSPASLAVSLGQRATISYRASKSVSTSGYSYMHWNQQKPGQPPRLLIYLVSNLESGVPARFSGSGSGTDFTLNIHPVEEEDAATYYCQHIRELTRSEGGPSWQIKRAAAGAPVPYPDPLEPRAA-

Described single-chain antibody gene is inserted into pMD19-T (D102A; Obtain from Takara company) carrier and transformed into escherichia coli DH5 α; The bacillus coli DH 5 alpha KGH-R1-ScFv (Escherichia coli DH5 α KGH-R1-ScFv) that obtains; Be preserved in Chinese typical culture collection center (address be Chinese Wuhan Wuhan University), preserving number CCTCC NO:M2011322 on September 18th, 2011.

Described single-chain antibody gene obtains recombinant human adenovirus carrier Ad-hrGFP-ScFv after inserting adenovirus hominis Ad5 and transfection HEK293 cell; Be preserved in Chinese typical culture collection center (address be Chinese Wuhan Wuhan University), preserving number CCTCC NO:V201219 on May 3rd, 2012.

In order to realize goal of the invention, the present invention adopts following technical scheme:

1, the amplification of light, the variable region of heavy chain of single-chain antibody encoding sox:

(be preserved in Chinese typical culture collection center on September 23rd, 2011 with the proteic hybridoma cell strain KGH-R1 of anti-p21Ras; The address is Chinese Wuhan Wuhan University; Preserving number CCTCC NO:C201197) cDNA is a template; Use the special antibody gene amplimer of mouse increase respectively light, the variable region of heavy chain of antibody coding gene, and through overlapping extension PCR use that flexible oligonucleotide will increase gently, the variable region of heavy chain fragment connects into complete single-chain antibody encoding sox.

2, the structure of recombinant phage plasmid library:

Method through PCR is introduced restriction enzyme site to the single-chain antibody encoding sox that amplification obtains; Cut enzyme mode even through enzyme again the single-chain antibody encoding sox is connected into the phage vector pCANTAB-5E (obtaining from Pharmacia company) that has same restriction enzyme site, obtain the recombinant phage plasmid library thereby make up.

3, the structure of phage single-chain antibody display libraries:

With recombinant phage plasmid library transformed into escherichia coli TG1 (obtaining), obtain the initial library of single-chain antibody from Lucigen company.Add helper phage M13KO7 (27-1524 obtains from GE healthcare company), collect the nutrient solution supernatant, obtain the phage single-chain antibody display libraries.

4, the separation of positive bacteriophage:

Through the method for indirect ELISA, be antigen coated Tissue Culture Plate with p21Ras albumen, being antibody with the phage single-chain antibody display libraries combines the antigen of coated cell culture plate.Add e. coli tg1 and pair discharge, add helper phage M13KO7, cultivate the back and separate supernatant, obtain the positive bacteriophage of enrichment screening with antigen bonded phage.Repeat enrichment screening process 2 times, obtain positive bacteriophage.Positive bacteriophage behind the transformed into escherichia coli TG1, checks order to the extraction plasmid again, obtains inserting fragment sequence, i.e. single-chain antibody KGH-R1-ScFv coding gene sequence.

5, the solubility expression of single-chain antibody:

The positive colony of transformed into escherichia coli TG1 adds N,O-Diacetylmuramidase thalline is carried out cracking after IPTG (obtaining from Sigma company) induces, and the gained supernatant is the single-chain antibody of solubility expression.

6, the detection of single-chain antibody antigen binding characteristic:

Collecting the different tumor cell line of 19 strains, is respectively human stomach cancer cell line BGC-853, MKN28, human hepatoma cell strain QGY-7703, SMMC-7721, HepG2; Human breast cancer cell strain MDA-MB-231, MDA-MB-435, MCT-7; Human leukemia cell line THP-1, K562, MT4 CD4+, Daud I, C8166 CD4+, HL60, human cervical carcinoma cell strain HeLa, people's larynx squamous cell carcinoma strain Hep-2; Human oophoroma cell line SKOV3; People's colorectal cancer cell strain HCT116, human bladder cancer cell's strain T-24 (19 strain cell strains are all from typical case's culture collection council of Chinese Academy of Sciences cell bank) carries out film-making by routine immunization group program; With the single-chain antibody of solubility expression is one anti-; HRP/Anti-E-tag (ab3415-250, from GE healthcare company obtain) is two anti-, identifies the antigen binding characteristic of single-chain antibody.

7, the structure of recombinant adenovirus plasmid:

Method through PCR is introduced restriction enzyme site to the single-chain antibody encoding sox of identifying, cuts enzyme mode even through enzyme again and the single-chain antibody encoding sox of identifying is connected into the shuttle plasmid pShuttle-IRES-hrGFP-1 (obtaining from Stratagene company) that has same restriction enzyme site.Recombinant shuttle plasmid is after Pme I (obtaining from Takara company) linearization for enzyme restriction, dephosphorylation are handled, and electricity transforms BJ5183-AD-1 (obtaining from Stratagene company) cell.Homologous recombination takes place in the skeleton plasmid pAdEasy-1 that has existed in linear recombinant shuttle plasmid and the BJ5183-AD-1 cell (D102A obtains from Takara company), produces recombinant adenovirus plasmid.

8, the preparation of recombinant adenovirus:

Recombinant adenovirus plasmid is carried out Pac I enzyme cut, reclaim the endonuclease bamhi that enzyme is cut about 30 Kb size of generation.With the endonuclease bamhi mixing transfection reagent Lipofectamine that reclaims ^TM2000, transfection HEK293 cell (from typical case's culture collection council of Chinese Academy of Sciences cell bank).In the HEK293 cell of transfection success back with packing out ripe adenovirus, thereby obtain recombinant human adenovirus carrier Ad-hrGFP-ScFv.

9, the location of intrabody:

Behind recombinant adenovirus infected person breast cancer cell MDA-MB-231 (from typical case's culture collection council of Chinese Academy of Sciences cell bank) cell, in cell, produce single-chain antibody.Detect it in intracellular location through merging at the terminal FLAG label of single-chain antibody.

10, external inhibition test:

Infect the proteic human breast cancer cell MDA-MB-231 of high expression level p21Ras, human liver cancer cell BEL-7402, human colon cancer cell SW480, Proliferation of Human Ovarian Cell OVCAR3 with recombinant adenovirus; And the proteic Proliferation of Human Ovarian Cell SKOV3 of the low p21Ras of expression (above all from typical case's culture collection council of Chinese Academy of Sciences cell bank): (1) adds the MTT pair cell and cultivates; Through measuring the OD490 absorbance value; Draw the cell viability curve, antibody is to the influence of tumor cell activity in the analysis of cells; (2) tumour cell is prepared into single cell suspension, after certain cell density inoculation, in containing the RPMI RPMI-1640 of 20% NBCS, cultivates 2-3 week.After the Giemsa stain dyeing, counting cells clone number under the inverted microscope, antibody is to the influence of tumor cell proliferation ability in the analysis of cells; (3) tumour cell that infects is inoculated in the Transwell microporous membrane upper surface that matrigel Matrigel encapsulates with certain cell density, cultivate 48 h after, wipe microporous membrane upper surface cell with cotton swab, use fixedly microporous membrane lower surface cell of 95% ethanol.Behind the haematoxylin dyeing, inverted microscope is counting microporous membrane lower surface cell number down, and antibody is to the influence of tumor cell invasion ability in the analysis of cells; (4) 75% ethanol of adding precooling, 4 ℃ of fixed cells spend the night.Add PI dye liquor pair cell and dye, use flow cytometer collecting cell PI fluorescent signal, the influence that antibody distributes to tumour cell cycle in the analysis of cells.

11, inhibition test in the body:

With tumour cell BEL-7402, SW480, SKOV3 (from typical case's culture collection council of Chinese Academy of Sciences cell bank) injection inoculation SPF level female Balb/c nude mice in 4 age in week, nude mice carries out multiple spot adenovirus injection in the knurl after becoming knurl.Injection in per 3 days 1 time is injected 7 times altogether.The injection back is observed nude mice, and knurl body volume is calculated in the long and short footpath of weighing nude mice body weight every other day, and measurement nude mice knurl body, draws tumor growth curve.Antibody is to the restraining effect of tumor growth in the analysis of cells.

Description of drawings

Fig. 1 is light, the variable region of heavy chain of pcr amplification antibody coding gene;

M:Marker, stripe size is followed successively by 600 bp, 500 bp, 400 bp, 300 bp, 200 bp, 100 bp; 1-2: variable region of heavy chain; 3-4: variable region of light chain.

The single-chain antibody gene electrophoresis that Fig. 2 is formed by connecting for light, variable region of heavy chain, M:DL2000.

Fig. 3 expresses the recombinant phage clone of anti-p21Ras albumen single-chain antibody for the ELISA screening;

H-ras, K-ras, N-ras albumen are respectively as antigen coated enzyme plate, and every hole encapsulates 0.5 μ g.The phage supernatant (100 μ l) of 1:200 dilution is anti-as one, and the HRP/Anti-M13 Monoclonal Ccojugate (100 μ l) of 1:2000 dilution is anti-as two, 100 μ l TMB colour developing.It is one anti-that positive control uses the anti-p21Ras protein monoclonal antibody supernatant (100 μ l) of 1:2000 dilution, and sheep anti-mouse igg (1:2000 dilution, 100 μ l) is two anti-; Blank uses PBS solution; Negative control uses helper phage M13KO7 supernatant.Read every hole OD450 value in the ELIASA.

Fig. 4 is the influence figure of intrabody to tumor cell activity.

Fig. 5 is the influence figure of intrabody to the tumor cell proliferation ability.

Fig. 6 is the influence figure of intrabody to the tumor cell invasion ability.

Fig. 7 is the influence figure of intrabody to the tumour cell cycle distribution.

Embodiment

Embodiment 1: proteic single-chain antibody KGH-R1-ScFv of a kind of anti-p21Ras and application thereof, the technical scheme of its acquisition is following:

1, total RNA extraction of anti-p21Ras hybridoma cell strain and cDNA are synthetic

1.1 total RNA extracts

The hybridoma that collection is cultured to logarithmic phase (is preserved in Chinese typical culture collection center on September 23rd, 2011; Preserving number CCTCC NO:C201197); Use Trizol (obtaining),, extract the total RNA of hybridoma according to the reagent operation instruction from Mrcgene company.1.0% agarose gel electrophoresis detects total RNA integrity.NanoDrop 2000 (obtaining) spectrophotometric determination total rna concentration from Thermo company.

1.2 cDNA is synthetic

Use RevertAid ^TMH Minus First Strand cDNA Synthesis Kit (obtaining from Fermentas company) according to the test kit operation instruction, carries out reverse transcription to total RNA that extracts in 1.1.

2,Hybridoma antibody coding gene is light, the variable region of heavy chain amplification

2.1 antibody coding gene variable region of light chain amplification

Using the special Light Primer Mix in mouse source (27-1583-01 obtains from GE healthcare company), is template with synthetic cDNA in 1.2, pcr amplification antibody coding gene variable region of light chain, operation reference reagent operation instruction.Products therefrom carries out 1.5% agarose gel electrophoresis, detects the electrophoretic band size.

2.2 antibody coding gene variable region of heavy chain amplification

With 2.1, use Heavy Primers 1,2 (27-1586-01 obtains from GE healthcare company), pcr amplification antibody coding gene variable region of heavy chain.

2.3 connecting, light, variable region of heavy chain makes up the ScFv gene fragment

Use DNA purifying and recovering test kit (DP214-02 obtains from Tiangen company),, PCR product in 2.1 and 2.2 is carried out purifying and recovering according to the test kit operation instruction.Utilize overlapping extension PCR principle, use Linker-Primer Mix (27-1588-01 obtains from GE healthcare company), according to the reagent operation instruction, light, the heavy chain variable region gene fragment that reclaim purifying are connected into the ScFv gene, structure is V _H-Linker-V _L

3,Recombinant phage single-chain antibody display libraries makes up

3.1 ScFv gene restriction enzyme site is introduced

Use RS Primer Mix (27-1589-01 obtains from GE healthcare company),, gained ScFv gene in 2.3 is carried out pcr amplification, introduce restriction enzyme site according to the reagent operation instruction.5 ' end restriction enzyme site is Sfi I, and 3 ' end restriction enzyme site is Not I.

3.2 the ScFv gene connects phage expression vector pCANTAB-5E

Sfi I and Not I (obtaining from Fermentas company) order enzyme is cut gained ScFv gene and phage expression vector pCANTAB-5E (obtaining from Pharmacia company) 3.1.Enzyme is cut product and is carried out 1.0% agarose gel electrophoresis, detects enzyme and cuts effect, and cut glue purification and reclaim (DP214-02 obtains from Tiangen company) ScFv gene fragment and expression vector pCANTAB-5E after enzyme is cut.According to the ratio of gene fragment, use carrier and the ScFv gene fragment of T4 DNA Ligase (obtaining) after ligase enzyme is cut from Fermentas company than carrier 3:1.

3.3 the initial library construction of single-chain antibody

With gained recombinant vectors transformed into escherichia coli TG1 in 3.2 (obtaining) from Lucigen company; Conversion condition is with reference to E.coli Competent Cells DH5 α (D9057A; Obtain from Takara company) working instructions; Cultivating controlled temperature is 30 ℃, converted product coating SOB dull and stereotyped (SOB-AG contains 100 μ g/ml Ampicillin and 2% Glucose).After 30 ℃ of overnight cultures, collect the dull and stereotyped bacterium colony of going up in 2 * YT nutrient solution (2 * YT-AG contains 100 μ g/ml Ampicillin and 2% Glucose).Adding glycerine to final concentration is 25%, and packing is stored in-80 ℃.Gained is the initial library of single-chain antibody.

3.4 recombinant phage single-chain antibody display libraries makes up

Get the initial library of gained in 3.3, in 2 * YT-AG nutrient solution, be cultured to logarithmic phase.The reference reagent operation instruction adds an amount of helper phage M13KO7 (27-1524 obtains from GE healthcare company), cultivates 1 h altogether for 30 ℃.Resuspended 2 * YT nutrient solution (2 * YT-AK contains 100 μ g/ml Ampicillin and 50 μ g/ml Kanamycin), the 30 ℃ of overnight cultures of being deposited in centrifugal back.Supernatant is collected in centrifugal back, adds the PEG8000 (obtaining from Meker company) of 1/5 volume.Centrifugal back is with the resuspended deposition of an amount of PBS, and adding glycerine to final concentration is 25%, and packing is stored in-80 ℃.Gained is the phage single-chain antibody display libraries.

4,The enrichment screening of positive bacteriophage

With the lower section detailed step with reference to Recombinant Phage Antibody System (RPAS, from GE Healthcare company obtain) specification sheets.

4.1 positive bacteriophage enrichment

The resuspended phage single-chain antibody storehouse of gained PBS in 3.4 is joined in the cell bottle that 10 μ g/ml p21Ras albumen encapsulate, cultivate 2 h for 37 ℃.Use PBS solution (PBS-T contains 0.05% Tween-20) wash bottle 3 times, continue with PBS solution wash bottle 3 times again.Gained is the positive bacteriophage of enrichment.

4.2 phage discharges

In the cell bottle of 4.1 enrichment positive bacteriophages, add the e. coli tg1 that is in logarithmic phase in right amount, cultivate 1 h for 30 ℃.Resuspended 2 * YT-AG the nutrient solution that is deposited in centrifugal back, shop 2 * YT-AG is dull and stereotyped.After 30 ℃ of overnight cultures, collect the dull and stereotyped bacterium colony of going up, be cultured to logarithmic phase in 2 * YT-AG nutrient solution.Add an amount of helper phage M13KO7, cultivate 1 h altogether for 30 ℃.Resuspended 2 * YT-AK the nutrient solution that is deposited in centrifugal back, 30 ℃ of overnight cultures.Supernatant is collected in centrifugal back, adds the PEG8000 of 1/5 volume.Centrifugal back is with the resuspended deposition of an amount of PBS, and after recentrifuge, supernatant were crossed 0.45 μ m aperture filter membrane, adding glycerine to final concentration was 25%, is stored in-80 ℃.This is the positive bacteriophage through first round enrichment screening.

4.3 purification enrichment

Repeat above-mentioned enrichment screening process 4.1 and 4.2,2 times, the gained phage is used for further analysis.

4.4 mono-clonal separates

The e. coli tg1 that in 4.3 gained phages, adds logarithmic phase is cultivated 1 h for 30 ℃.Resuspended 2 * YT-AG the nutrient solution that is deposited in centrifugal back, shop 2 * YT-AG is dull and stereotyped.After 30 ℃ of overnight cultures, choose in 48 orifice plates that every hole contains 400 μ l, 2 * YT-AG nutrient solution separating good mono-clonal on the flat board.Every hole is got 40 μ l and is joined in the 48 new well culture plates, adds helper phage M13KO7 (5 * 10 ¹⁰Pfu/ml) 400 μ l.Cultivate 2 h for 30 ℃, become muddy to liquid.Flat board is centrifugal, carefully absorb supernatant.Every hole adds 400 μ l, 2 * YT-AK nutrient solution, 30 ℃ of overnight cultures.Flat board is centrifugal, and the gained supernatant is mono-clonal phagocytosis body fluid.

5, the positive monoclonal phage identifies

5.1 indirect elisa method is identified positive recombinant clone

Gained phage supernatant in 4.4 is joined in the 96 hole enzyme plates that every hole 0.5 μ g p21Ras albumen encapsulates.Behind 37 ℃ of reaction 1 h, PBS-T solution is washed plate 3 times.Add two anti-HRP/Anti-M13 Monoclonal Ccojugate (27-9421-01 obtains from GE healthcare company), 100 μ l (1:2000 dilution), 37 ℃ of reaction 0.5 h.PBS-T solution is washed plate 3 times, redistillation washing plate 2 times.Add 100 μ l TMB, develop the color in the dark place.Obvious painted hole is the positive monoclonal phage.

5.2 bacterium liquid PCR method is identified positive recombinant clone

With the 5.1 positive bacteriophage supernatants of being identified is template, is primers designed with pCANTAB-5E carrier external source insertion fragment upstream and downstream S1, S6 primer, the phage vector external source is inserted fragment carry out pcr amplification, identifies and inserts clip size.The PCR product carries out 1.0% agarose gel electrophoresis.Wherein, the S1 primer sequence is: 5'-CAACGTCAAAAAATTATTAT TCGC-3', the S6 sequence is: 5'-GTAAATGAATTTTCTGTATGAGG-3'.

5.3 external source is inserted sequencing fragment

Use DNA purifying and recovering test kit,, PCR product in 5.2 is carried out purifying and recovering according to the test kit operation instruction.Reclaim product and connect pMD19-T carrier (D102A obtains from Takara company), the positive colony of screening send the order-checking of the big genome company (BGI) of China, and relating operation is according to the reagent operation instruction.Be the coding gene sequence of purpose single-chain antibody KGH-R1-ScFv after the gained sequencing sequence removal carrier sequence.With order-checking clone transformed into escherichia coli DH5 α, the DH5 α KGH-R1-ScFv of acquisition was preserved in Chinese typical culture collection center, preserving number CCTCC NO:M2011322 on September 22nd, 2011.

6,The solubility expression of single-chain antibody and evaluation

6.1 the solubility expression of single-chain antibody

Behind 5.1 evaluation positive bacteriophages, in 4.4, draw corresponding mono-clonal nutrient solution and carry out enlarged culturing.30 ℃ are cultured to OD600=0.8, centrifugal.The careful supernatant of removing adds freshly prepared 2 * YT nutrient solution (2 * YT-AI contains 100 μ g/ml Ampicillin and 1mM IPTG), induces the single-chain antibody of solubility to express 30 ℃ of overnight cultures.Remove supernatant after centrifugal, with the PBS bacterial sediment that suspends, adding N,O-Diacetylmuramidase (obtaining from Sigma company), to make its final concentration be 1U/ μ l.Digest behind 10 min centrifugally, the gained supernatant is the single-chain antibody of solubility expression.

6.2 the single-chain antibody relative molecular weight is identified

Single-chain antibody to 6.1 resulting solubility expressions carries out SDS-PAGE, identifies the relative molecular weight of single-chain antibody.6.1 gained supernatants are splined on 1 * SDS solution, the 25mA electrophoresis.Under the room temperature, place on the shaking table, Virahol is fixed 15 min, coomassie brilliant blue staining 2 h, and the decolouring of 10% acetate is spent the night.Back reference protein molecular weight standard (Marker) analysis list chain antibody relative molecular weight size has developed the color.

6.3 the antigen binding characteristic of single-chain antibody

Collect the tumor cell line of logarithmic phase; Totally 19 strains comprise: human stomach cancer cell line BGC-853, MKN28, human hepatoma cell strain QGY-7703, SMMC-7721, HepG2; Human breast cancer cell strain MDA-MB-231, MDA-MB-435, MCT-7; Human leukemia cell line THP-1, K562, MT4 CD4+, Daud I, C8166 CD4+, HL60, human cervical carcinoma cell strain HeLa, people's larynx squamous cell carcinoma strain Hep-2; Human oophoroma cell line SKOV3; People's colorectal cancer cell strain HCT116, human bladder cancer cell's strain T-24 (respectively available from typical case's culture collection council of Chinese Academy of Sciences Shanghai cell bank/Kunming cell bank, or Yunnan Province's natural drug key lab).

Collect above-mentioned cell strain in centrifuge tube, supernatant is removed in centrifugal back, precipitates with the saline water washed cell.Recentrifuge is with 95% ethanol re-suspended cell.Recentrifuge adds 95% ethanol, fixed cell 3 h after removing supernatant again.The careful tumour cell piece that takes out, by routine paraffin wax section program dewater, transparent, waxdip, embedding, section, dewaxing, aquation, and antigen high pressure reparation.Immunocytochemistry is carried out in the tumour cell section for preparing to be detected; With the single-chain antibody of 6.1 resulting solubility expressions is one anti-; HRP/Anti-E-tag (ab3415-250; Obtain from GE healthcare company) be two anti-, Streptomycin sulphate avidin-px (SP) is identified the antigen binding characteristic of single-chain antibody to the substrate-function colour developing.

The result shows that the immunity that the single-chain antibody of solubility expression and other tumor cell lines except that leukemia cell line are in various degree is positive, explains that the single-chain antibody of preparation has the immunological competence of the tumor cell line of wide spectrum.

7,The structure of recombinant adenovirus

7.1 the structure of recombinant shuttle plasmid

With the 5.3 pMD19-T vector plasmids that are connected with the single-chain antibody encoding sox identified is template, with the terminal positive anti-primer (5'-GA that has Bgl II and Xho I restriction enzyme site respectively AGATCTTCATGGCCCAGGTGAA-3' and 5'-CC CTCGAGGGCGGCGGGCAAACTAA-3') carry out pcr amplification.The PCR product that amplification obtains carries out 1.5% agarose gel electrophoresis, uses DNA purifying and recovering test kit to reclaim the purpose band of purifying 750 bp size length.Use Bgl II and Xho I restriction enzyme the PCR product and the shuttle plasmid pShuttle-IRES-hrGFP-1 (obtaining) of double digestion recovery respectively from Stratagene company; Whether 1.0% agarose gel electrophoresis detection enzyme is cut complete, cuts glue purification and reclaims through the PCR of double digestion product and shuttle plasmid.Use T4 DNA Ligase to connect PCR product and shuttle plasmid after reclaiming, connect product transformed into escherichia coli DH5 α competent cell, converted product shop LB-kantlex is dull and stereotyped, 37 ℃ of overnight cultures.The finely disseminated conversion bacterium colony of picking carries out PCR with the carrier primer pShuttle-F (5'-CTCACGGGGATTTCCAAGTC-3') of shuttle plasmid and pShuttle-R (5'-ATGCAGTCGTCGAGGAATTG-3') to bacterium colony and identifies.Use TIANprep Mini plasmid extraction kit (DP103-02 obtains from Tiangen company) to identifying that through PCR the male bacterium colony extracts plasmid, use Bgl II and Xho I that the plasmid that extracts is done further enzyme and cut evaluation.Enzyme is cut evaluation male plasmid check order, to guarantee to insert the fragments sequence integrity.

7.2 the structure of recombinant adenovirus plasmid

7.1 recombinant shuttle plasmids identified are carried out Pme I enzyme cut, make its linearizing.After linearizing recombinant shuttle plasmid reclaims purifying, it is carried out CIAP (obtaining from Fermentas company) handle, make its dephosphorylation.The linear recombinant shuttle plasmid electricity that dephosphorylation is handled transforms BJ5183-AD-1 (obtaining from Stratagene company) competent cell, and transformed bacteria liquid coating LB-kantlex is dull and stereotyped, 37 ℃ of overnight cultures.Homologous recombination takes place in the skeleton plasmid pAdEasy-1 that exists in linear recombinant shuttle plasmid and the BJ5183-AD-1 cell; The generation recombinant adenovirus plasmid uses Pac I that recombinant adenovirus plasmid is carried out enzyme and cuts; Enzyme is cut product and is carried out agarose gel electrophoresis, and the evaluation enzyme is cut the clip size of generation.After linear recombinant shuttle plasmid and the skeleton plasmid pAdEasy-1 homologous recombination, can produce the Pac I endonuclease bamhi of about 30 kb size.

7.3 recombinant adenovirus preparation

Reference reagent operation instruction, the Pac I enzyme that mixes 7.2 process of preparing are cut the fragment of about 30 kb size of generation in Lipofectamine ^TM2000 (the obtaining), transfection reagent is hatched with HEK293 cell (from typical case's culture collection council of Chinese Academy of Sciences cell bank) jointly from Invitrogen company.24 h observe cells transfected under the inverted fluorescence microscope after the transfection, like visible obviously green fluorescence, the transfection success are described then.In the HEK293 cell, pack out ripe adenovirus.The recombinant human adenovirus carrier Ad-hrGFP-ScFv that obtains is preserved in Chinese typical culture collection center, preserving number CCTCC NO:V201219 on June 13rd, 2012.

7.4 adenovirus purifying

After the transfection 10-14 days, swelling appears in most HEK293 cells, become justify, when coming off, assembling agglomerating cytopathic effect, collecting cell.Cell suspension is carried out centrifugal, PBS solution washing, suspension cell.With cell multigelation in-80 ℃ of methyl alcohol/37 ℃ water-baths, 4 times, freeze at every turn, melt each about 5 min.Supernatant is collected in centrifugal back, and packing is stored in-80 ℃.Gained is adenovirus stoste.Adenovirus stoste is further purified through cesium chloride density gradient centrifugation.This method gained adenovirus satisfies the requirement of further experiment.

8,The location of intrabody

7.4 prepared adenovirus are pressed infection multiplicity MOI=100 infected person breast cancer cell MDA-MB-231 (typical case's culture collection council of Chinese Academy of Sciences cell bank); Behind the recombinant adenovirus cells infected; The gene that its plasmid carries is at cell inner expression; Can be through the existence of green fluorescence signal detection adenovirus in the cell, through merge the detection of the terminal FLAG label of single-chain antibody know insertion external source single-chain antibody encoding sox expression and in intracellular location.The MDA-MB-231 cell fixation that method through cell climbing sheet makes logarithmic phase is on slide glass; Behind the adenovirus infection cell 36h; Cell on the slide glass is carried out immunoreation; Add anti-Anti-FLAG (R) M2 Antibody (2368, obtain), two anti-Rhodamine-Conjugated Goat Anti-Rabbit IgG (ZF-0316 from Cell Signaling Technology company; Biomarket company obtains), immunoreation finishes the back and under laser confocal microscope FV1000, observes hrGFP and Rhodamine institute's fluorescence excitation and both confocal fluorescents respectively in intracellular location.

9,Intrabody is to the inhibition research of cancer cells

9.1 the detection of cell viability

With the 7.4 prepared proteic human breast cancer cell MDA-MB-231 of adenovirus infection high expression level p21Ras, human liver cancer cell BEL-7402, human colon cancer cell SW480, Proliferation of Human Ovarian Cell OVCAR3, and the low proteic Proliferation of Human Ovarian Cell SKOV3 of p21Ras that expresses.Simultaneously, set up empty carrier virus group and blank group.Behind adenovirus infection cell 24 h, 36 h, 48 h, 72 h, 96 h, add MTT.After cultivating 4 h, abandon MTT, add DMSO, low-speed oscillation 10 min.Measure the OD490 absorbance value of each sample, each sample is established 3 repetitions.With the infection time is transverse axis; The OD490 absorbance value is the longitudinal axis; Draw the cell viability curve, the intrabody of expressing after the analysis tumour cell infection adenovirus is to the influence of its vigor, and relatively high expression level and the proteic tumor cell line of low expression p21Ras are to the susceptibility of this intrabody.

9.2 the detection of ability of cell proliferation

Experimental cell well-grown, degree of converging reach at 80% o'clock, and it is carried out adenovirus infection, set up the contrast of empty carrier virus group simultaneously.Experimental cell comprises MDA-MB-231 cell, BEL-7402 cell, SW480 cell, OVCAR3 cell, SKOV3 cell (from typical case's culture collection council of Chinese Academy of Sciences cell bank).Use the tryptic digestion attached cell after infecting 24h; Process single cell suspension with the RPMI 1640 that contains 20% NBCS (obtaining) (obtaining) nutrient solution suspension cell from Hyclone company from Gibco company; Density with 250,500,750 cells is inoculated in 6 orifice plates respectively; Each sample is established 3 repetitions, cultivates 2-3 week.After the Giemsa stain dyeing, counting cells clone (single clone's cell count is greater than 50) number calculates cloning efficiency under the inverted microscope BX41.The intrabody of expressing after the analysis comparison of tumor cell infection adenovirus is to the influence of its multiplication capacity.

Cell count * 100% of cloning efficiency (%)=clone's number/inoculation.

9.3 the detection of cell invasion ability

Press the reagent operation instruction, use matrigel Matrigel (from BD Matrigel ^TMCompany obtains) coated cell cell Transwell microporous membrane.With 9.2, MDA-MB-231 cell, BEL-7402 cell, SW480 cell, OVCAR3 cell, SKOV3 cell (all from typical case's culture collection council of Chinese Academy of Sciences cell bank) are carried out adenovirus infection.Use trypsin digestion and cell after infecting 24 h, process single cell suspension with the RPMI RPMI-1640 suspension cell that contains 2% NBCS, with 3 * 10 ⁴The density of individual cell is inoculated in the Transwell microporous membrane upper surface that matrigel Matrigel encapsulates.In 24 orifice bores of nested Transwell microporous membrane, add the RPMI RPMI-1640 that contains 20% NBCS, cultivate 48 h.After wiping microporous membrane upper surface cell gently with cotton swab, use fixedly microporous membrane lower surface cell of 95% ethanol.Behind the haematoxylin dyeing, inverted microscope is counting microporous membrane lower surface cell number down.The intrabody of expressing after the analysis comparison of tumor cell infection adenovirus is to the influence of its invasive ability.

9.4 the detection of cell cycle

Detect dna content in the cell through flow cytometry iodate third ingot (PI, from Beckman company obtain) staining, divide into the G0/G1 phase mutually, S phase, G2/M phase, the percentage of phase when calculating each during with cell cycle of different cells.With 9.2, MDA-MB-231 cell, BEL-7402 cell, SW480 cell, OVCAR3 cell, SKOV3 (all from typical case's culture collection council of Chinese Academy of Sciences cell bank) cell are carried out adenovirus infection.Use trypsin digestion and cell after infecting 48h, blow and beat into single cell suspension.Each experimental group gets 1 * 10 ⁶Individual cell, the PBS solution washing cell of use precooling 2 times.Add 75% ethanol of precooling, 4 ℃ of fixed cells spend the night.Reuse the PBS solution washing cell 2 times of precooling.Add PI dye liquor pair cell and dye 30 min.Use flow cytometer through flow cytometry collecting cell PI fluorescent signal, wherein excitation wavelength is 488 nm, and wavelength of transmitted light is 620 nm, and each sample collection is more than 10000 fluorescent signals.Use MultiCycle DNA software analysis cell fluorescence intensity, cell cycle distribution, and calculate the cell proliferation index.The intrabody of expressing after the analysis comparison of tumor cell infection adenovirus is to the influence of its cell cycle distribution.

(Proliferation?Index,?PI)=(S+G2/M)/(G0/G1+S+G2/M)?×100%。

10,Intrabody is to the inhibition research of tumor growth

10.1 the foundation of nude mice tumor model

Experimental cell BEL-7402, SW480, SKOV3 well-grown, degree of converging reach at 80% o'clock, use tryptic digestion, collecting cell, behind the PBS solution washing cell cell density are adjusted to 10 ⁷Individual cell/200 μ l is as the single injection consumption.The injection cell for preparing is inoculated in SPF level 4 female Balb/c nude mice in age in week, 10 of every kind of tumor cell inoculations, nude mice is used for the inhibition research of intrabody to tumor growth after becoming knurl.

10.2 intrabody is to the inhibition research of tumor growth

The nude mice injection inoculation divides into groups to it after becoming knurl, 5 every group.When knurl body diameter reaches 0.5 cm, it is carried out multiple spot adenovirus injection in the knurl, set up the contrast of empty carrier virus group simultaneously.Injection volume is 3 * 10 ⁸Pfu/ only injected 1 time, and injected altogether 7 times in per 3 days.The injection back is observed nude mice, and knurl body volume is calculated in the long and short footpath of weighing nude mice body weight every other day, and measurement nude mice knurl body, draws tumor growth curve.The intrabody of expressing after the analysis comparison of tumor injection adenovirus is to the inhibition of its growth.

Knurl body volume=1/2 * major diameter * minor axis ²

SEQUENCE?LISTING

< 110>Yang Julun

< 120>the proteic single-chain antibody KGH-R1-ScFv of a kind of anti-p21Ras

<160> 1

<170> PatentIn?version?3.3

<210> 1

<211> 822

<212> DNA

<213> KGH-R1-ScFv?(DNA)

<400> 1

gcggcccagc?cggccatggc?ccaggtgaag?ctgcaggagt?ctggggaagg?cttagtgaag 60

cctggagggt?ccctgaaact?ctcctgtgca?gcctctggat?tcactttcag?tgactattac 120

atgtattggg?ttcgccagac?tccggaaaag?aggctggagt?gggtcgcaat?cattagtgat 180

ggtggtagtt?acacctacta?tccagacagt?gtgaaggggc?gattcaccat?ctccagagac 240

aataccaaga?aaaacctgta?cctgcaaatg?agcagtctga?ggtctgagga?cacagccatg 300

tattactgtg?caagagatcc?ccattactcc?ggtagtagcc?gcctgtttgt?taactggggc 360

caaggcacca?cggtcaccgt?ctcctcaggt?ggaggcggtt?caggcggagg?tggctctggc 420

ggtggcggat?cggacatcga?gctcactcag?tctccagctt?ccttagctgt?atctctgggg 480

cagagggcca?ccatctcata?cagggccagc?aaaagtgtca?gtacatctgg?ctatagttat 540

atgcactgga?accaacagaa?accaggacag?ccacccagac?tcctcatcta?tcttgtatcc 600

aacctagaat?ctggggtccc?tgccaggttc?agtggcagtg?ggtctgggac?agacttcacc 660

ctcaacatcc?atcctgtgga?ggaggaggat?gctgcaacct?attactgtca?gcacattaga 720

gagcttacac?gttcggaggg?gggaccaagc?tggcaaatca?aacgggcggc?cgcaggtgcg 780

ccggtgccgt?atccggatcc?gctggaaccg?cgtgccgcat?ag 822

< 110>Yang Julun

< 120>the proteic single-chain antibody KGH-R1-ScFv of a kind of anti-p21Ras

<160> 1

<170> PatentIn?version?3.3

<210> 2

<211> 273

<212> DNA

<213> KGH-R1-ScFv?(Amino?acid)

<400> 1

aaqpamaqvk?lqesgeglvk?pggslklsca?asgftfsdyy?mywvrqtpek?rlewvaiisd 60

ggsytyypds?vkgrftisrd?ntkknlylqm?sslrsedtam?yycardphys?gssrlfvnwg 120

qgttvtvssg?gggsggggsg?gggsdieltq?spaslavslg?qratisyras?ksvstsgysy 180

mhwnqqkpgq?pprlliylvs?nlesgvparf?sgsgsgtdft?lnihpveeed?aatyycqhir 240

eltrseggps?wqikraaaga?pvpypdplep?raa 273

Claims

1. the proteic single-chain antibody KGH-R1-ScFv of anti-p21Ras is characterized in that this antibody coding gene order is shown in SEQ ID NO1.

2. the proteic single-chain antibody KGH-R1-ScFv of a kind of anti-p21Ras as claimed in claim 1; It is characterized in that described single-chain antibody gene is inserted into pMD19-T (D102A; Obtain from Takara company) carrier and transformed into escherichia coli DH5 α; The bacillus coli DH 5 alpha KGH-R1-ScFv that obtains is preserved in Chinese typical culture collection center, preserving number CCTCC NO:M2011322 on September 22nd, 2011.

3. the proteic single-chain antibody KGH-R1-ScFv of a kind of anti-p21Ras as claimed in claim 1; It is characterized in that obtaining recombinant human adenovirus carrier Ad-hrGFP-ScFv behind the described single-chain antibody gene transfection HEK293 cell; Be preserved in Chinese typical culture collection center, preserving number CCTCC NO:V201219 on June 13rd, 2012.