CN102766696B - Micro ribonucleic acid (RNA) 572 kit and detection method for early predicting postoperative cognitive dysfunction - Google Patents
Micro ribonucleic acid (RNA) 572 kit and detection method for early predicting postoperative cognitive dysfunction Download PDFInfo
- Publication number
- CN102766696B CN102766696B CN201210289608.1A CN201210289608A CN102766696B CN 102766696 B CN102766696 B CN 102766696B CN 201210289608 A CN201210289608 A CN 201210289608A CN 102766696 B CN102766696 B CN 102766696B
- Authority
- CN
- China
- Prior art keywords
- cognitive dysfunction
- mir
- primer
- hsa
- postoperative cognitive
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The invention relates to the technical field of medical biological detection, in particular to a micro ribonucleic acid (RNA) 572 kit and a detection method for early predicting postoperative cognitive dysfunction. The inconvenience is brought for clinical early prediction and treatment caused by the fact that an effective method for predicting postoperative cognitive dysfunction does not exist currently. According to the kit and the detection method, by means of comparing human serum albumin-micro ribonucleic acid-572 (hsa-mir-572) contents in blood plasma of patients with normal preoperative cognitive function and patients with postoperative cognitive dysfunction, the result that the hsa-mir-572 content changing conditions can be used as early prediction means of the postoperative cognitive dysfunction is found out. A hsa-mir-572 detection kit for early predicting postoperative cognitive dysfunction is provided. The kit comprises a reverse transcription primer, upstream-downstream primers of a Real-time polymerase chain reaction (PCR), an amplification system and the like, based on a clinical trial, the detection accuracy can reach to about 85%, and thereby the kit can be used for early predicting postoperative cognitive dysfunction.
Description
Technical field
The present invention relates to technical field of biomedical detection, is a kind of MicroRNA-572 test kit and detection method of early prediction Postoperative Cognitive Dysfunction.
Background technology
Postoperative Cognitive Dysfunction (Post-operative Cognitive Dysfunction, POCD) be that one of postoperative common complication of gerontal patient is (referring to document Baranov, D., et al.Consensus statement:First International Workshop on Anesthetics and Alzheimer ' s disease.Anesth Analg, 2009, 108 (5): 1627-1630.Rohan D, Buggy DJ, Crowley S, Ling FK, Gallagher H, Regan C, Moriarty DC.Increased incidence of postoperative cognitive dysfunction 24 hr after minor surgery in the elderly.Can J Anaesth.2005, 52 (2): 137-142.).According to the international multicenter study of Postoperative Cognitive Dysfunction (ISPOCD); 60 years old patients with general anesthesias with up non-cardiac surgery; the incidence of postoperative 1 week POCD is that 25.8%(is referring to document Rohan D; Buggy DJ; Crowley S; Ling FK; Gallagher H; Regan C, Moriarty DC.Increased incidence of postoperative cognitive dysfunction 24 hr after minor surgery in the elderly.Can J Anaesth.2005; 52 (2): 137-142).According to nearest bibliographical information, gerontal patient's row non-cardiac surgery POCD incidence of postoperative 6 weeks is 54.3%, the incidence of postoperative 1 year still up to 46.1%(referring to document Monk, T.G., et al.Predictors of cognitive dysfunction after major noncardiac surgery.Anesthesiology, 2008,108 (1): 18-30).POCD the most often shows as psychiatric disorder, anxiety, personality and remembers impairedly, and permanent cognition dysfunction even occurs a few patients, develops into dementia.Postoperative Cognitive Dysfunction not only extends length of patient stay, increases medical expense, and increase patient's mortality ratio (Steinmetz, J., et al.Long-term consequences of postoperative cognitive dysfunction.Anesthesiology, 2009,110 (3): 548-555), for family and society bring white elephant.Due to the common the elder patients after operation of POCD, therefore infer with old cognitive disorder and may have similar mechanism, but the research of cognitive disorder does not break through so far.Up to now, biological indicator that can direct reaction POCD.Therefore the at present research of POCD is mainly for epidemiological study and the risk factor research of POCD, but its mechanism of less research and inquirement.Because the diagnosis of POCD at present mainly relies on clinical manifestation, and lack specificity lab index, therefore for clinical position brings a lot of inconvenience, increased mistaken diagnosis and failed to pinpoint a disease in diagnosis.Particularly for POCD, preoperative prediction more lacks corresponding index, therefore, from prevention and treatment angle, is badly in need of finding clearer and more definite POCD biological marker.
MicroRNA (miRNA) is the non-coding protein strand microRNA of class length approximately 21 ~ 25 bases, extensively be present in multicellular organism and virosome, mainly mate and be attached on specific said target mrna by nucleic acid array complementation, suppressing said target mrna translation process or degraded said target mrna, is a kind of molecule that plays negative regulation effect.More and more studies show that at present, miRNA wide participation organism various physiological processes, and correlative study report also shows that its expression and functional disorder may cause the multiple pathological phenomenons such as tumour generation, leukemia and virus infection.
Can serve as a kind of laboratory non-invasive detection means, more research at present concentrates on for early diagnosis of cancer aspect for miRNA.This emerging research field only starts to be applied on mensuration blood serum designated object.Existing experiment confirmation, miRNA is highly stable in blood plasma and serum, and their with contact-free RNases, still can be kept stable by effective protection under harsh and unforgiving environments condition.Therefore, their stability makes its actual value and the test value obtaining at patient coincide finely.
At present; early prediction function for miRNA mainly concentrates on tumour aspect; such as: the people such as Charles H.Lawrie confirm: diffusivity B cell lymphoma patient's serum hsa-mir-21 level is very high; the latter is with not recur survival rate closely related (referring to document Lawrie CH; Gal S; Dunlop HM, et al.Detection of elevated levels of tumourassociated microRNAs in serum of patients with diffuse large B-cell lymphoma.Br J Haematol 2008; 141:672-675).The reports of people on cell research magazine such as Chen X are analyzed the patients serum miRNAs level of lung cancer, colorectal carcinoma and diabetes; determine that these diseases have its specific serum miRNA phenotype (referring to document Chen X; Ba Y.Ma L, et al.Characterization of miRNAs in serum:a novel class of biomarkers for diagnosis of cancer and other diseases.Cell Res 2008; 18:997-1006).
So far there are no miRNA-572, as the report of POCD biological marker, also has no a kind of for detection of the hsa-mir-572 content in blood plasma or serum, comes the test kit of early prediction Postoperative Cognitive Dysfunction and the report of detection method thereof.
Summary of the invention
The object of the present invention is to provide a kind of MicroRNA 572 test kits of early prediction Postoperative Cognitive Dysfunction, and detection method.
The inventor participates in the relevant blood plasma miRNA of POCD in order to find, and utilizes miRNA chip technology to screen the miRNA relevant to POCD.Found that the expression of miRNA.572 has significant difference compared with before operation in patients.Separately have research prompting miRNA-134 with remember relevant (referring to document Gao J, Wang WY, Mao YW,
guan JS, Pan L, Mak G, Kim D, Su SC, Tsai LH.A novel pathway regulates memory and plasticity via SIRT1 and miR-134.Nature.2010,466 (7310): 1105-1109.).These researchs are pointed out us, and miRNA and cognitive disorder have certain relation, and prompting blood plasma miRNA may become the potential marker of early stage specificity.
POCD has relatively clear and definite disease time clinically, participates in the relevant blood plasma miRNA of POCD in order to find, and we utilize miRNA chip technology to screen the miRNA relevant to POCD.Found that compared with before operation in patients, in POCD patient's blood plasma, the expression of miRNA-572 obviously reduces.The inventor thinks that by inverse transcription polymerase chain reaction (PT-PCR) be basic technology, and it is feasible realizing early diagnosis POCD by the expression of blood plasma miRNA-572 in detection POCD patient.
A first aspect of the present invention, provides the application of MicroRNA 572 in the test kit of preparing early prediction Postoperative Cognitive Dysfunction.
A second aspect of the present invention, a kind of hsa-mir-572 detection kit of early prediction Postoperative Cognitive Dysfunction is provided, it is the variation by detecting the hsa-mir-572 molecule content in blood plasma or serum, possibility or the process of monitoring or early prediction Postoperative Cognitive Dysfunction, to take measures as early as possible or pharmacological agent, prevent that Postoperative Cognitive Dysfunction from occurring or development, and then prevent from being transformed into dementia.
The present invention is by the content comparison to hsa-mir-572 in preoperative cognitive function normal patient blood plasma; The content comparison of hsa-mir-572 in postoperative cognition dysfunction does not occur person and Patients with Postoperative Cognitive Dysfunction blood plasma; Find: in Patients with Postoperative Cognitive Dysfunction blood plasma, hsa-mir-572 content is starkly lower than the normal patient of preoperative cognitive function, be less than about 5 times of left and right of the normal patient group of preoperative cognitive function, this result has shown the content situation of hsa-mir-52, can be used as the early prediction means of postoperative cognitive.
The invention provides a kind of hsa-mir-572 detection kit of early prediction Postoperative Cognitive Dysfunction, this test kit is made up of reverse transcription system, primer system and amplification system, primer system is wherein made up of the upstream and downstream primer of specific hsa-mir-572 reverse transcription primer and Real-time PCR, and hsa-mir-572 reverse transcription primer is:
GTCGTATCCAGTGCGAACTGTGGCGATCGGTACGGGCTACACTCGGCAATTGCACTGGATACGAC?TGGGCC（SEQ?ID?NO:1）；
Real-time PCR upstream primer is: GTCCGCTCGGCGGTGGCCCA(SEQ ID NO:2);
Real-time PCR downstream primer is: AGTGCGAACTGTGGCGAT(SEQ ID NO:3).
The primer of test kit of the present invention is to check according to known information biology (the referring to http://microrna.sanger.ac.uk/sequences/) that the ripe body sequence of hsa-mir-572 designs, and comprises that the upstream and downstream primer of its specific reverse transcription primer, Real-time PCR is all by Primer 5 primer-design softwares designs.The ripe body sequence of hsa-mir-572: GUCCGCUCGGCGGUGGCCCA(SEQ ID NO:4)
The reverse transcription system of mentioned reagent box is made up of ThermoScript II, reverse transcription system damping fluid and RNA enzyme inhibitors, and amplification system is by SYBR Premix Ex Taq
tMreagent composition.
Test kit of the present invention, specifically composed as follows:
A) hsa-mir-572 reverse transcription primer (SEQ ID NO:1), 1 pipe, concentration: 10 μ M, 100 μ l/ pipes;
B) Real-time PCR upstream primer (SEQ ID NO:2), 1 pipe, concentration: 10 μ M, 100 μ l/ pipes;
Real-time PCR downstream primer (SEQ ID NO:3), 1 pipe, concentration: 10 μ M, 100 μ l/ pipes;
C) Trizol reagent(total RNA extraction reagent), 1 pipe, 2000 μ l/ pipes;
D) chloroform, 1 pipe, 500 μ l/ pipes;
E) dehydrated alcohol, 1 pipe, 7ml/ pipe;
F) DEPC H2O(is through the pure water of coke acid second diester processing), 1 pipe, 1000 μ l/ pipes
G) dd H2O(distilled water), 1 pipe, 2000 μ l/ pipes.
Use test kit monitoring of the present invention or early prediction Postoperative Cognitive Dysfunction, first, by some known preoperative cognitive function normal patient marshallings, with test kit of the present invention hsa-mir-572 content in normal, the Postoperative Cognitive Dysfunction blood plasma of cognitive function normal patient before detection technique, postoperative cognitive respectively, with this normal data in contrast.Detect hsa-mir-572 content in unknown patients serum by identical method again; contrast above-mentioned normal data; can tentatively determine whether this patient is preoperative cognitive function normal patient, postoperative cognitive normal patient, Patients with Postoperative Cognitive Dysfunction, further check and make a definite diagnosis to do.
A third aspect of the present invention, provides the detection method of the hsa-mir-572 detection kit of above-mentioned early prediction Postoperative Cognitive Dysfunction, and concrete steps are as follows:
Serum or blood plasma are got in blood drawing routinely, process serum or blood plasma with total RNA extraction reagent, and add chloroform and get upper strata water after centrifugal, and little RNA in enrichment serum or blood plasma; By the record of reverse transcription system inversion, hsa-mir-572 becomes cDNA; Carry out Real-time pcr amplification with amplification system, measure hsa-mir-572 content.
Accompanying drawing explanation
Fig. 1: the content detection of hsa-mir-572 in cognitive function normal patient perioperatively blood plasma;
Fig. 2: in Patients with Postoperative Cognitive Dysfunction perioperatively blood plasma, the differential expression of hsa-mir-572 detects;
Embodiment
Now in conjunction with the embodiments and accompanying drawing, the invention will be further described, but enforcement of the present invention is not limited in this.
Embodiment 1: prepare test kit of the present invention (for a people)
Test kit of the present invention is composed as follows:
1. reverse transcription primer 1 is managed, 100 μ l/ pipe concentration: 10 μ M reverse transcription primers are:
GTCGTATCCAGTGCGAACTGTGGCGATCGGTACGGGCTACACTCGGCAATTGCACTGGATACGAC?TGGGCC
Each 1 pipe of upstream and downstream primer of 2.Real-time PCR, 100 μ l/ pipe concentration: 10 μ M;
Upstream primer is: GTCCGCTCGGCGGTGGCCCA
Downstream primer is: AGTGCGAACTGTGGCGAT
3.Trizol reagent 1 manages 2000 μ l/ pipes
4. chloroform 1 is managed 500 μ l/ pipes
5. dehydrated alcohol 1 is managed 7ml/ pipe
6.DEPC H2O 1 manages 1000 μ l/ pipes
7.dd H
2o 1 manages 2000 μ l/ pipes.
The present invention checks in the ripe body sequence GUCCGCUCGGCGGUGGCCCA of hsa-mir-572 according to known information biology, the upstream and downstream primer of its specific reverse transcription primer, Real-time PCR all, by Primer 5 primer-design software designs, is responsible for primer by invitrogen company of the U.S. synthetic.
The primer sequence of design is as follows:
(1) reverse transcription primer:
GTCGTATCCAGTGCGAACTGTGGCGATCGGTACGGGCTACACTCGGCAATTGCACTGGATACGAC?TGGGCC（SEQ?ID?NO:1）
(2) the upstream and downstream primer of Real-time PCR:
Upstream primer: GTCCGCTCGGCGGTGGCCCA(SEQ ID NO:2)
Downstream primer: AGTGCGAACTGTGGCGAT(SEQ ID NO:3)
Preparation comprises the test kit of following moiety: total RNA extraction reagent, chloroform, dehydrated alcohol, specificity hsa-mir-572 reverse transcription primer (100 μ l/ pipe concentration: 10 μ M), specific hsa-mir-572 upstream primer (100 μ l/ pipe concentration: 10 μ M), downstream primer (100 μ l/ pipe concentration: 10 μ M), DEPCH
2o(1000 μ l/ pipe), dd H
2o(2000 μ l/ pipe)
DEPC H
2the configuration of O: with the DEPC(diethylpyrocarbonate of buying), purity >99%, density is 1.12g/ml, configuration DEPC H
2o.In 100mlMiliQ pure water, add 0.1mlDEPC, be placed in the dry volumetric flask of baking of 100ml and leave standstill autoclaving after 4 hours, make the DEPC H of thousandth concentration
2o, after testing containing RNase, DNase and proteinase.Be used for dissolving synthetic reverse transcription primer, and diluting water during as reverse transcription.
Dd H
2the configuration of O: MiliQ pure water, after autoclaving, is configured to the dd H that Real-time PCR uses
2o.
Specificity hsa-mir-572 reverse transcription primer: by Primer 5 primer-design software designs, be responsible for primer synthetic by invitrogen company of the U.S., purity is PAGE level, the primer DEPC H after synthesizing
2o dissolves, and final concentration is 10 μ M.
Specific hsa-mir-572 upstream primer: by Primer 5 primer-design software designs, be responsible for primer synthetic by invitrogen company of the U.S., purity is PAGE level, the primer dd H after synthesizing
2o dissolves, and final concentration is 10 μ M.
Embodiment 2: the detection of test kit of the present invention
One, gathering plasma sample and sample prepares:
Because blood plasma has advantages of the convenience of drawing materials, non-invasive, continuous detecting, therefore from blood plasma, detecting Postoperative Cognitive Dysfunction biomarker can reach a new high lapsing to of Postoperative Cognitive Dysfunction of prediction, thereby reaches the early object of prevention, early treatment.
Plasma sample gathers in portion of Shanghai Changhai Hospital inpatient department: 16 routine preoperative cognitive function normal patient row orthopaedics knees, hip replacement, 10 routine postoperative cognitives are normal, 6 routine Patients with Postoperative Cognitive Dysfunctions.According to American Psychiatric Association's diagnosis and statistics guide (Diagnostic and Statistical Manual, DSM-IV) definition, without the cognitive disorder (ICD:International Classification ofDiseases296.5) of other aspects narration.There is Neuropsychic diseases history; Without hypertension, diabetes, tumour, the blood medical history controlled; There are prolonged application psychoactive drug or alcohol history; The heart, lung, liver, renal insufficiency; There is cognitive disorder medical history or the preoperative MMSE abnormal patient that marks to be excluded.All patients all may affect the disease of serum level without blood, kidney, tumour etc.After being admitted to hospital, all get rid of cancer through B ultrasonic or CT examination.Sample collection: the peripheral blood of collecting about patient 4ml is put into the anticoagulant tube containing 360 μ l EDTA, leaves standstill approximately 1 hour.
Two, gather the processing of plasma sample and extract little RNA wherein:
(1) plasma sample processing: 4 ℃ of the peripheral blood sample of collection are centrifugal twice, and first the centrifugal 10min of 1600g, gets supernatant, adds in new centrifuge tube, the more centrifugal 10min of 12000g, gets supernatant, adds in new centrifuge tube.Add Trizol reagent (purchase of Invitrogen company), make Trizol reagent: blood plasma=1:0.8 left and right.
(2) little RNA extracts: the sample that added Trizol reagent rocks and mixes, and places 15min on ice, 1000g, and 4 ℃ of centrifugal 10min, get supernatant, put into respectively the 2ml EP pipe of processing through DEPC.Every pipe adds 200 μ l chloroforms, rocks and mixes, and places 10min left and right on ice, and 12000g, 4 ℃ of centrifugal 15min, get upper strata water.In the mirVana miRNA Isolation Kit that step is below bought according to Applied Biosystems company, extracting the step of little RNA carries out.Use Eppendorf uv-spectrophotometric instrument to measure the A260 value of RNA and the ratio (1.8-2.2) of A260/A280, to assess its concentration and quality.The sample that meets detection by quantitative requirement carries out next step reaction.
Three, the real-time quantitative of miRNA
1. reverse transcription becomes the cDNA of hsa-mir-572
Getting pregnant solution 50ng is template, carries out reverse transcription with the specificity hsa-mir-572 reverse transcription primer designing.According to 5 × Prime Scrip
tMbuffer (for Real Time) 4 μ l, Prime S cript
tMrT Enzyme Mix 0.5 μ l(PrimeScript
tMrT reagent Kit) little RNA50ng, the DEPC H2O(of (TaKaRa company), hsa-mir-122 reverse transcription primer 0.5 μ l, enrichment supplement H2O and make cumulative volume reach 20 μ l) to carry out reverse transcription.Tip head, all autoclavings after DEPC water treatment of EP pipe that above step is used.
The quantitative miRNA of 2.Real-time PCR
Adopt the SYBR Premix Ex Taq of TaKaRa company
tMreagent and Applied Biosystems company of the U.S.: Step Plus One real-time PCR, carries out PCR reaction according to following system:
The suitable annealing temperature of having established hsa-mir-572 primer through preliminary experiment, finally determine following condition:
This experiment employing standard reverse transcription product coubling dilution Criterion curve, every 20 μ l systems are added respectively standard reverse transcription product 2,1,0.5,0.25,0.125 μ l, every kind of concentration is set up 3 parallel multiple pipes.
According to above-mentioned Real-time PCR condition, the reverse transcription product of the each sample to preparation in early stage detects.Every batch of PCR all set up typical curve as batch between reference, and establishing criteria curve is set up CT value threshold value.Every sample standard deviation does 3 parallel multiple pipes, gets its mean value analysis, and each PCR measures and comprises feminine gender (water) contrast.For preventing polluting, institute responds and all carries out at the clean experiment table in prefecture, and template interpolation and primer interpolation do not operate in same district.For preventing primer dimer and non-specific amplification, institute responds all in operation on ice.
The each sample hsa-mir-572 expression amount obtaining is converted to relative quantification value by typical curve, and target gene expression amount/housekeeping gene U6 expression amount carries out standard normalized.The final ratio that obtains compares and statistical study.By 2
-△ △ Ctmethod is calculated the hsa-mir-572 central relative expression quantity of Cognitive Dysfunction Patients blood plasma after surgery, in Patients with Postoperative Cognitive Dysfunction peripheral blood, the expression mean level (ML) of hsa-mir-572 is than the low several times of preoperative expression level, and the hsa-mir-572 amount in preoperative peripheral blood is considered as 1.
Embodiment 3: hsa-mir-572 content detection in the middle of cognitive function normal patient peripheral blood blood plasma
There is bibliographical information; in the peripheral blood of Healthy People; miRNA content is very stable; from sex; between men and women, differ very little (referring to document: Chen X; Ba Y.Ma L, et al.Characterization of miRNAs in serum:a novel class of biomarkers for diagnosis of cancer and other diseases.Cell Res 2008; 18:997-1006).Before comparing the content of miRNA in patient's peripheral blood blood plasma, according to the identical method of embodiment 2,3, first the amount of hsa-mir-572 in cognitive function normal patient blood plasma is done to a comparison, totally 10 routine (see figure 1)s.Real-time PCR result, in cognitive function normal patient peripheral blood, after operation, miRNA-572 content is front basic identical with operation.
Embodiment 4: Patients with Postoperative Cognitive Dysfunction is compared hsa-mir-572 content detection in blood plasma
According to the identical method of embodiment 2,3, hsa-mir-572 in hsa-mir-572 and preoperative blood plasma in the 6 routine Patients with Postoperative Cognitive Dysfunction blood plasma that gather is made comparisons, and result is that the content of hsa-mir-572 in Patients with Postoperative Cognitive Dysfunction blood plasma is lower than 0.5 times of left and right in preoperative blood plasma.Adopt t check, result P<0.05, thinks that the content of hsa-mir-572 in the postoperative blood plasma of Patients with Postoperative Cognitive Dysfunction is lower than preoperative.(see figure 2)
More than show and described ultimate principle of the present invention, principal character and advantage of the present invention.The technician of the industry should understand; the present invention is not restricted to the described embodiments; that in above-described embodiment and specification sheets, describes just illustrates principle of the present invention; the present invention also has various changes and modifications without departing from the spirit and scope of the present invention, and these changes and improvements all fall in the claimed scope of the invention.The claimed scope of the present invention is defined by appending claims and equivalent thereof.
Claims (3)
1.MicroRNA572 the application in the test kit of preparing early prediction Postoperative Cognitive Dysfunction.
2. the application of MicroRNA572 according to claim 1 in the test kit of preparing early prediction Postoperative Cognitive Dysfunction, it is characterized in that this test kit is made up of reverse transcription system, primer system and amplification system, primer system is wherein made up of the upstream and downstream primer of specific hsa-mir-572 reverse transcription primer and Real-time PCR
Hsa-mir-572 reverse transcription primer sequence as shown in SEQ ID NO:1,
Real-time PCR upstream primer sequence as shown in SEQ ID NO:2,
Real-time PCR downstream primer sequence is as shown in SEQ ID NO:3;
Reverse transcription system is wherein made up of ThermoScript II, reverse transcription system damping fluid and RNA enzyme inhibitors;
Amplification system is wherein by SYBR Premix Ex Taq
tMreagent composition.
3. the application of MicroRNA572 according to claim 1 in the test kit of preparing early prediction Postoperative Cognitive Dysfunction, is characterized in that this test kit is specifically composed as follows:
A) the hsa-mir-572 reverse transcription primer of sequence as shown in SEQ ID NO:1,1 pipe, concentration: 10 μ M, 100 μ l/ pipes;
B) Real-time PCR upstream primer is as shown in SEQ ID NO:2, and 1 manages, concentration: 10 μ M, 100 μ l/ pipes;
Real-time PCR downstream primer is as shown in SEQ ID NO:3, and 1 manages, concentration: 10 μ M, 100 μ l/ pipes;
C) Trizol reagent, 1 pipe, 2000 μ l/ pipes;
D) chloroform, 1 pipe, 500 μ l/ pipes;
E) dehydrated alcohol, 1 pipe, 7ml/ pipe;
F) through the pure water of coke diethyl phthalate processing, 1 manages, 1000 μ l/ pipes;
G) distilled water, 1 pipe, 2000 μ l/ pipes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210289608.1A CN102766696B (en) | 2012-08-15 | 2012-08-15 | Micro ribonucleic acid (RNA) 572 kit and detection method for early predicting postoperative cognitive dysfunction |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210289608.1A CN102766696B (en) | 2012-08-15 | 2012-08-15 | Micro ribonucleic acid (RNA) 572 kit and detection method for early predicting postoperative cognitive dysfunction |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102766696A CN102766696A (en) | 2012-11-07 |
| CN102766696B true CN102766696B (en) | 2014-05-28 |
Family
ID=47094262
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210289608.1A Expired - Fee Related CN102766696B (en) | 2012-08-15 | 2012-08-15 | Micro ribonucleic acid (RNA) 572 kit and detection method for early predicting postoperative cognitive dysfunction |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102766696B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105803082A (en) * | 2016-04-26 | 2016-07-27 | 中国人民解放军第二军医大学 | miR-572 serving as marker for differential diagnosis of postoperation restenosis of lower extremity atherosclerotic occlusive disease and reagent kit thereof |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP5737935B2 (en) * | 2008-03-27 | 2015-06-17 | 雅彦 黒田 | Markers and examination methods for breast cancer determination |
| US20090280167A1 (en) * | 2008-05-07 | 2009-11-12 | Abraxis Bioscience, Llc | Enhancement of drug therapy by mirna |
| CN101555520A (en) * | 2009-05-19 | 2009-10-14 | 中国人民解放军第二军医大学 | Has-mir-122 kit for early prediction of hepatocirrhosis developed from chronic hepatitis B and detection method thereof |
| US20120108650A1 (en) * | 2010-10-29 | 2012-05-03 | Emory University | Micro rna markers and methods related thereto |
-
2012
- 2012-08-15 CN CN201210289608.1A patent/CN102766696B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN102766696A (en) | 2012-11-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2406402B1 (en) | Method to assess human allograft status from microrna expression levels | |
| CN102776185B (en) | Liver cancer diagnostic marker composed of blood plasma microRNA (micro ribonucleic acid) and new method for diagnosing liver cancer | |
| US11136628B2 (en) | Biomarkers useful for detection of types, grades and stages of human breast cancer | |
| JP7390285B2 (en) | Novel biomarker for detecting senescent cells | |
| CN104152452B (en) | A kind of blood miRNA marker relevant to hepatocarcinoma and application thereof | |
| CN102876676B (en) | Blood serum/blood plasma micro ribonucleic acid (miRNA) marker relevant with pancreatic cancer and application thereof | |
| CN108841962A (en) | A kind of non-small cell lung cancer detection kit and its application | |
| CN103805696A (en) | Micro RNA (Ribonucleic Acid) molecular marker for diagnosing rheumatoid arthritis and detection kit thereof | |
| EP2596136B1 (en) | Marker consisting of plasma microrna and new method for diagnosis of hepatocellular carcinoma | |
| CN106434982A (en) | Relevant molecular markers for cerebral ischemic stroke and application of molecular markers | |
| TW201231671A (en) | Method and kit for in vitro diagnosis of atherosclerosis | |
| CN106884052A (en) | A kind of curative effect of pulmonary tuberculosis kits for evaluation based on serum miRNA composition and application thereof | |
| CN101555520A (en) | Has-mir-122 kit for early prediction of hepatocirrhosis developed from chronic hepatitis B and detection method thereof | |
| CN102766696B (en) | Micro ribonucleic acid (RNA) 572 kit and detection method for early predicting postoperative cognitive dysfunction | |
| Huang et al. | Plasma exosomal MiRNAs expression profile in mesial temporal lobe epilepsy with hippocampal sclerosis: case-control study and analysis of potential functions | |
| CN106282387A (en) | Gastric cancer detection primer probe and test kit thereof | |
| CN107619869A (en) | Diagnosis of glioma and prognostic marker circ16:85633914 | 85634132 and application | |
| CN107029238B (en) | Applications of the LINC01094 in diagnosis and treatment cerebral arterial thrombosis | |
| JP6616983B2 (en) | How to test for mild cognitive impairment | |
| TW202025176A (en) | Health risk assessment method | |
| US10131956B2 (en) | Marker used for detection of colon cancer, and application thereof | |
| KR102602134B1 (en) | Method of providing information for diagnosing metastasis of cervical cancer | |
| CN112921090B (en) | Application of extracellular vesicle circRNAs as gastric cancer diagnosis marker | |
| CN106554991A (en) | Can be used for the blood miR-134 detection kits of coronary artery calcification diagnosis | |
| JP7299765B2 (en) | MicroRNA measurement method and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140528 Termination date: 20160815 |