CN106282387A - Gastric cancer detection primer probe and test kit thereof - Google Patents
Gastric cancer detection primer probe and test kit thereof Download PDFInfo
- Publication number
- CN106282387A CN106282387A CN201610903791.8A CN201610903791A CN106282387A CN 106282387 A CN106282387 A CN 106282387A CN 201610903791 A CN201610903791 A CN 201610903791A CN 106282387 A CN106282387 A CN 106282387A
- Authority
- CN
- China
- Prior art keywords
- probe
- mir
- hsa
- primer
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Abstract
The present invention relates to a kind of gastric cancer detection primer probe and test kit thereof, test kit includes for preparing the digital pcr premixed liquid of digital pcr reactant liquor, droplets stable agent and miRNAs primed probe mixed liquor, and for carrying out the stem ring reverse transcriptase primer mixed liquor of RNA reverse transcription；MiRNAs primed probe mixed liquor includes for detecting hsa mir 20a, hsa mir 17 and hsa miR 106b and the forward primer of hsa mir 16 and probe, and for detecting hsa mir 20a, hsa mir 17, the general downstream primer of hsa miR 106b and hsa mir 16；Stem ring reverse transcriptase primer mixed liquor includes the stem ring reverse transcriptase primer being respectively used to reverse transcription hsa mir 20a, hsa mir 17 and hsa miR 106b and hsa mir 16；Hsa mir 20a, hsa mir 17 and hsa miR 106b are marks, and hsa mir 16 is internal reference.The gastric cancer detection kit of the present invention can detect the expression of the miRNA as early gastric caacer diagnosis marker quick, convenient, exactly.
Description
Technical field
The present invention relates to a kind of primed probe group detecting gastric cancer miRNA expression and detection product, belong to biological skill
Art field.
Background technology
MicroRNA is the non-coding microRNA of a class endogenous, high conservative, single stranded RNA precursor molecule process
Being formed, length is generally 18～23bp, is first transcribed into original miRNA during synthesis under the effect of RNA polymerase II, then by
The Drosha cleavage of RNA Ⅲ family forms miRNA precursor, then the Dicer enzyme processing through RNA Ⅲ family
Ultimately form the miRNA of maturation.
There is a large amount of miRNAs in human body, the miRNA of these maturations can be combined with RNA induction silencing complex, and with
Be combined with 3 ' the end noncoding regions of its target gene mRNA, the translation process after regulatory transcription, thus regulate and control corresponding target protein
Express, constitute a series of RNA regulated and control network, play an important role in tumor.Some miRNA in tumor on
Adjusting, play similar oncogene effect, some miRNA lowers in tumor, plays the effect of antioncogene, occurs the function of cell relatively
Big impact.A kind of miRNA can regulate and control multiple target gene, and one can also be regulated and controled mark gene, pass through by multiple miRNAs
Regulation target gene protein is expressed and is affected the processes such as the increment of cell, differentiation, apoptosis, invasion and attack, multiple studies have shown that miRNA is at lung
The Several Kinds of Malignancies such as cancer, breast carcinoma, cancer of pancreas, ovarian cancer are expressed imbalance.Developed owing to miRNA participates in tumor
Journey, the most progressively launches with the research of miRNA expression prediction chemotherapy and radiation curative effect.
Gastric cancer is gastric epithelial and the malignant tumor of glandular epithelium generation, is one of modal malignant tumor of the mankind, its
Sickness rate occupies the 4th, the world, and mortality rate remains high, and is positioned at malignant tumor second.China belongs to the state of the High Risk For Gastric Cancer
Family, is malignant tumor prevention and the emphasis controlled.The early diagnosis of gastric cancer is still the difficult problem captured the most completely at present, many without special
The opposite sex symptom, the patient of about 2/3rds when making a definite diagnosis already at middle and advanced stage or occurred transfer, gastric cancer progressive stage
Mean survival time only have 6-9 month.The peripheral blood diagnosis index of high specific, sensitivity and stability is examined for gastric cancer
Disconnected, disease progression and prognosis play very important effect.Numerous studies show that the miRNA in circulation can be as many tumor diseases
Sick diagnosis index.The mark that one specificity and sensitivity have both should be able to contribute to early discovery gastric cancer, assesses gastric cancer
Progress and transfer case, Follow-up After and assessment curative effect of medication.In view of miRNA stable in serum/plasma can express and demonstrate,prove
In bright all kinds of tumor there is notable difference, a kind of new, in early days, noinvasive or the height of Wicresoft in serum miRNA and Normal group
The early gastric cancer biomarker of sensitivity and high specific, for the prevention of gastric cancer, state of illness monitoring, early diagnosis and therapy,
Thus improving prognosis, this is respectively provided with important meaning to reduction gastric cancer incidence rate and mortality rate.
Circulation miRNA detection method is close with miRNA detection method in tissue.Different experiments room uses detection method at present
Mainly have: Northern Blot method, high-flux sequence method, miRNA chip and fluorescence real-time quantitative PCR (qRT-PCR) method.Survey
Sequence technical result is the most reliable, is conducive to finding new miRNA, but sequence measurement price is higher.Although miRNA chip price
Relatively low, but its repeatability and accuracy are poor, are served only for known disease and are correlated with miRNAs primary dcreening operation.Northern Blot side
Method is numerous and diverse and sensitivity is relatively low, is not suitable for the high throughput testing of clinical sample.
Summary of the invention
The technical problem to be solved in the present invention is to provide one and can detect as early gastric caacer quick, convenient, exactly
The gastric cancer detection primer probe of the expression of the miRNA of diagnosis marker and test kit thereof.
The present invention solves that a kind of technical scheme that above-mentioned technical problem proposes is: a kind of gastric cancer detection primer probe, bag
Include the stem ring reverse transcriptase primer a for reverse transcription hsa-mir-20a, for the stem ring reverse transcriptase primer of reverse transcription hsa-mir-17
B, for the stem ring reverse transcriptase primer c of reverse transcription hsa-miR-106b, the stem ring reverse transcription for reverse transcription hsa-mir-16 draws
Thing d, for detecting the forward primer a and probe a of hsa-mir-20a, for detecting forward primer b and the probe of hsa-mir-17
B, for detecting the forward primer c and probe c of hsa-miR-106b, for detecting forward primer d and the probe of hsa-mir-16
D, and for detecting the general downstream primer of hsa-mir-20a, hsa-mir-17, hsa-miR-106b and hsa-mir-16；
Described hsa-mir-20a, hsa-mir-17 and hsa-miR-106b are marks, and described hsa-mir-16 is interior
Ginseng；
The nucleotide sequence of described forward primer a as shown in SEQ ID No.1, the nucleotide sequence such as SEQ of described probe a
Shown in ID No.6；
The nucleotide sequence of described forward primer b as shown in SEQ ID No.2, the nucleotide sequence such as SEQ of described probe b
Shown in ID No.7；
The nucleotide sequence of described forward primer c as shown in SEQ ID No.3, the nucleotide sequence such as SEQ of described probe c
Shown in ID No.8；
The nucleotide sequence of described forward primer d as shown in SEQ ID No.4, the nucleotide sequence such as SEQ of described probe d
Shown in ID No.9；
The nucleotide sequence of described general downstream primer is as shown in SEQ ID No.5；
The nucleotide sequence of described stem ring reverse transcriptase primer a as shown in SEQ ID No.10, described stem ring reverse transcriptase primer b
Nucleotide sequence as shown in SEQ ID No.11, the nucleotide sequence such as SEQ ID No.12 of described stem ring reverse transcriptase primer c
Shown in, the nucleotide sequence of described stem ring reverse transcriptase primer d is as shown in SEQ ID No.13；
5 ' the ends of described probe a and probe b are provided with a kind of fluorescent reporter group, and the 5 ' ends of described probe c and probe d are provided with
Another kind of fluorescent reporter group, the 3 ' ends of described probe a, probe b, probe c and probe d are provided with quenching fluorescence group；
The described each forward primer final concentration of 0.1 μM/L in reaction system～1.5 μMs/L, described general downstream primer
Final concentration of 2 μMs/L in reaction system～4 μMs/L；
The described probe a final concentration of 0.1 μM/L in reaction system～0.17 μM/L, described probe b is in reaction system
In final concentration of 0.18 μM/L～final concentration of 0.1 μM/L in reaction system of 0.5 μM/L, described probe c～0.15 μM/
Final concentration of 0.16 μM/L in reaction system of L, described probe d～0.5 μM/L.
The above-mentioned probe a final concentration of 0.16 μM/L in reaction system, described probe b final concentration in reaction system
Being 0.2 μM/L, the described probe c final concentration of 0.15 μM/L in reaction system, described probe d are dense for the end in reaction system
Degree is 0.17 μM/L.
The above-mentioned each forward primer final concentration of 0.8 μM/L in reaction system, described general downstream primer is at reactant
Final concentration of 3 μMs/L in system.
Above-mentioned each stem ring reverse transcriptase primer final concentration in reverse transcription system is 50nM/L.
5 ' the fluorescent reporter group held of above-mentioned probe a and probe b are FAM, and it is glimmering that the 5 ' of described probe c and probe d are held
Light reporter group is HEX, VIC, TET or Cy3, and described quenching fluorescence group is BHQ1 or MGB.
The present invention solves that a kind of technical scheme that above-mentioned technical problem proposes is: a kind of stomach using above-mentioned primed probe
Cancer detection product.
The present invention solves that a kind of technical scheme that above-mentioned technical problem proposes is: a kind of gastric cancer detection kit, including
For preparing the digital pcr premixed liquid of digital pcr reactant liquor, droplets stable agent and miRNAs primed probe mixed liquor, Yi Jiyong
In the stem ring reverse transcriptase primer mixed liquor carrying out RNA reverse transcription；
Described miRNAs primed probe mixed liquor includes forward primer a and probe a for detecting hsa-mir-20a,
For detecting the forward primer b and probe b of hsa-mir-17, for detecting the forward primer c and probe c of hsa-miR-106b,
For detecting the forward primer d and probe d of hsa-mir-16, and it is used for detecting hsa-mir-20a, hsa-mir-17, hsa-
The general downstream primer of miR-106b and hsa-mir-16；
Described stem ring reverse transcriptase primer mixed liquor includes the stem ring reverse transcriptase primer a for reverse transcription hsa-mir-20a,
For the stem ring reverse transcriptase primer b of reverse transcription hsa-mir-17, for the stem ring reverse transcriptase primer of reverse transcription hsa-miR-106b
C, for the stem ring reverse transcriptase primer d of reverse transcription hsa-mir-16；
Described hsa-mir-20a, hsa-mir-17 and hsa-miR-106b are marks, and described hsa-mir-16 is interior
Ginseng；
The nucleotide sequence of described forward primer a as shown in SEQ ID No.1, the nucleotide sequence such as SEQ of described probe a
Shown in ID No.6；
The nucleotide sequence of described forward primer b as shown in SEQ ID No.2, the nucleotide sequence such as SEQ of described probe b
Shown in ID No.7；
The nucleotide sequence of described forward primer c as shown in SEQ ID No.3, the nucleotide sequence such as SEQ of described probe c
Shown in ID No.8；
The nucleotide sequence of described forward primer d as shown in SEQ ID No.4, the nucleotide sequence such as SEQ of described probe d
Shown in ID No.9；
The nucleotide sequence of described general downstream primer is as shown in SEQ ID No.5；
The nucleotide sequence of described stem ring reverse transcriptase primer a as shown in SEQ ID No.10, described stem ring reverse transcriptase primer b
Nucleotide sequence as shown in SEQ ID No.11, the nucleotide sequence such as SEQ ID No.12 of described stem ring reverse transcriptase primer c
Shown in, the nucleotide sequence of described stem ring reverse transcriptase primer d is as shown in SEQ ID No.13；
5 ' the ends of described probe a and probe b are provided with a kind of fluorescent reporter group, and the 5 ' ends of described probe c and probe d are provided with
Another kind of fluorescent reporter group, the 3 ' ends of described probe a, probe b, probe c and probe d are provided with quenching fluorescence group；
The described each forward primer final concentration of 0.1 μM/L in reaction system～1.5 μMs/L, described general downstream primer
Final concentration of 2 μMs/L in reaction system～4 μMs/L；
The described probe a final concentration of 0.1 μM/L in reaction system～0.17 μM/L, described probe b is in reaction system
In final concentration of 0.18 μM/L～final concentration of 0.1 μM/L in reaction system of 0.5 μM/L, described probe c～0.15 μM/
Final concentration of 0.16 μM/L in reaction system of L, described probe d～0.5 μM/L.
The above-mentioned probe a final concentration of 0.16 μM/L in reaction system, described probe b final concentration in reaction system
Being 0.2 μM/L, the described probe c final concentration of 0.15 μM/L in reaction system, described probe d are dense for the end in reaction system
Degree is 0.17 μM/L；The described each forward primer final concentration of 0.8 μM/L in reaction system, described general downstream primer is instead
Answer the final concentration of 3 μMs/L in system；Described each stem ring reverse transcriptase primer final concentration in reverse transcription system is 50nM/L；Institute
5 ' the fluorescent reporter group held stating probe a and probe b are FAM, the 5 ' fluorescent reporter group held of described probe c and probe d
Being HEX, VIC, TET or Cy3, described quenching fluorescence group is BHQ1 or MGB.
Above-mentioned digital pcr premixed liquid includes archaeal dna polymerase, ultra-pure water, dNTPs mixed liquor, reference fluorescent ROX and buffering
Liquid；Described droplets stable agent includes mineral oil.
During the reaction of above-mentioned gastric cancer detection kit, reaction system includes digital pcr premixed liquid 10 volume, miRNAs primer
Probe mixed liquor 2 volume, droplets stable agent 2 volume, cDNA template 1 volume, sterilizing ultra-pure water 5 volume.
The present invention has a positive effect:
(1) the gastric cancer detection kit of the present invention uses multiple probe digital pcr technology, based on Taqman probe principle,
Primed probe is optimized design, uses different fluorescein-labeled probes respectively for multiple miRNA, carry during detection
The drop of different fluorescence will be identified accordingly, is counted respectively.Ensureing that fluorescence signal intensity is directly proportional to concentration and probe concentration
On the premise of, adjust the concentration of fluorescein and adjust the proportioning of two kinds of fluorescein mixing, 4 can be detected the most simultaneously
The expression of miRNA.The present invention solves in sample the problem that miRNA content is low, sample size is few, has preferably group interior stable
Property, it is possible to it is preferably applied to the Non-invasive detection of disease.4 miRNA of the gastric cancer detection kit of the present invention combine as gastric cancer early
The accuracy rate of diagnosis of phase diagnosis marker is 97%, can become the effective means of early gastric caacer diagnosis.
(2) the gastric cancer detection kit of the present invention with general quantitatively compared with, positive control need not be set, it is not required that sets
Putting standard substance, general detection technique is qualitative detection, and the technology of the present invention can reach absolute quantitation truly, inspection
Measure as little as 1 copy number template amount, overcome the shortcoming that qPCR does not have accurate quantification.MiRNA in serum is entered by the present invention
Row detection by quantitative, the threshold value (CT value) not relying on amplification curve carries out quantitatively, reaching absolute quantitation not against standard curve
Purpose, has good accuracy and repeatability, is not affected by amplification efficiency.
(3) sample solution is used microdropletization to process by the gastric cancer detection kit of the present invention, reduces ambient interferences, according to glimmering
Light type, fluorescence microdroplet number, as a result, it is possible to directly interpretation copy number, operation simplification, reduce testing cost, former detection skill
The sensitivity of art method is typically between 1%～50%, and the sensitivity of the experimental technique of the present invention can reach 0.1%, inspection
The absolute magnitude of test sample miRNA in this and ratio.
Accompanying drawing explanation
Fig. 1 is the result figure detected Plasma of Patient With Gastric Cancer sample with the test kit of the present invention.
Detailed description of the invention
Below by embodiment, the present invention is specifically described, it is necessary to it is pointed out here that be that following example are only used
In being further described the present invention, it is impossible to be interpreted as limiting the scope of the invention, person skilled in art can
The present invention made some nonessential improvement and adjustment according to the invention described above content.In following embodiment, if not specially
Showing, reagent used is analytical pure, and agents useful for same all can obtain from commercial channel.The experiment of unreceipted actual conditions in literary composition
Method, " the molecular cloning reality that the Science Press generally write according to normal condition such as J. Pehanorm Brooker etc. publishes for 2002
Test guide " condition described in a book, or according to the condition proposed by manufacturer.Unless otherwise defined, the institute used in literary composition
There is the same meaning that specialty is familiar with one skilled in the art with scientific words.Additionally, any similar to described content or
Impartial method and material all can be applicable in the present invention.
One, the composition of test kit.
The gastric cancer detection kit of the present embodiment, including digital pcr premixed liquid, droplets stable agent, miRNAs primed probe
Mixed liquor and stem ring reverse transcriptase primer mixed liquor.The each composition of test kit is as shown in table 1.
Table 1 Kit components table
| Kit components | Subpackage | Reagent Company |
| Digital pcr premixed liquid | 1 pipe | Life technologies |
| Droplets stable agent | 1 pipe | Raindance technologies |
| MiRNAs primed probe mixed liquor | 1 pipe | Hundred power lattice |
| Stem ring reverse transcriptase primer mixed liquor | 1 pipe | Hundred power lattice |
Being described as follows of each component of test kit in above-mentioned table 1:
1) main component of digital pcr premixed liquid includes archaeal dna polymerase, ultra-pure water, dNTPs mixed liquor, reference fluorescent
ROX, buffer etc. (are provided by Life technologies company, article No.: 1508099).
2) main component of droplets stable agent is mineral oil, (is provided by Raindance technologies company, goods
Number: 30-00826), Main Function is that reaction system is formed Water-In-Oil droplet by microdroplet processing procedure.
3) in miRNAs primed probe mixed liquor, the miRNA of detection is hsa-mir-20a, hsa-mir-17, hsa-respectively
MiR-106b and internal reference hsa-mir-16.MiRNAs primed probe mixed liquor include hsa-mir-20a, hsa-mir-17,
The respective forward primer of hsa-miR-106b, hsa-mir-16, hsa-mir-20a, hsa-mir-17, hsa-miR-106b,
The respective probe of hsa-mir-16, and hsa-mir-20a, hsa-mir-17, hsa-miR-106b, hsa-mir-16 share
General downstream primer.
Hsa-mir-20a, hsa-mir-17 and hsa-miR-106b are marks, and hsa-mir-16 is internal reference.
The internal reference that the present invention selects is the expression in Colon and rectum adenocarcinoma, adenoma and normal healthy controls group through sample checking
There was no significant difference, and expression also there was no significant difference in the difference patient by stages of gastric cancer.
4) stem ring reverse transcriptase primer mixed liquor includes hsa-mir-20a, hsa-mir-17, hsa-miR-106b and hsa-
Mir-16 respective stem ring reverse transcriptase primer.
All primers and probe in the present invention are all based on the miRNA sequence information miRBase data base, such as table 2
Shown in.
Table 2 miRNA information table
| Gene | Accession | Sequence(5’——3’) |
| hsa-mir-20a | MIMAT0000075 | uaaagugcuuauagugcagguag |
| hsa-mir-17 | MIMAT0000070 | caaagugcuuacagugcagguag |
| hsa-miR-106b | MIMAT0000680 | uaaagugcugacagugcagau |
| hsa-mir-16 | MIMAT0000069 | uagcagcacguaaauauuggcg |
Convenient for design primer, retrieval in data base to miRNA sequence in U replace to T, the knot after replacement
Fruit is as shown in table 3.
Sequence information table after the replacement of table 3 miRNA base
| Gene | Accession | Sequence(5’——3’) |
| hsa-mir-20a | MIMAT0000075 | taaagtgcttatagtgcaggtag |
| hsa-mir-17 | MIMAT0000070 | caaagtgcttacagtgcaggtag |
| hsa-miR-106b | MIMAT0000680 | taaagtgctgacagtgcagat |
| hsa-mir-16 | MIMAT0000069 | tagcagcacgtaaatattggcg |
General downstream primer is that the G/C content with reverse transcriptase primer as stencil design, dimer situation etc. reach optimal one
Duan Xulie.Forward primer is that the relevant parameter matched with general downstream primer reaches one section of optimal sequence.
Stem ring reverse transcriptase primer sequence is to add 4 to 6 bit base reverse complementary sequences after the 3 ' ends of miRNA to classical neck
The sequence that 3 ' ends of ring structure are formed, is mainly used in the miRNA reverse transcription after extracting RNA.Select miRNA based on stem ring primer
Quantitatively, stem is around-France has high specificity, and it is excellent that ambient interferences highly sensitive, miRNA precursor is little, the range of linearity is wide, efficiency is high etc.
Point.Stem ring reverse transcriptase primer is drawn sequence by the general stem ring of a section longer with miRNA complementary specificity sequence and a section and forms, logical
The nucleotides sequence drawing sequence with stem ring is classified as: gtcgtatccagtgcagggtccgaggtattcgcactggatacgac.
Forward primer in miRNAs primed probe mixed liquor, probe, general downstream primer, and stem ring reverse transcriptase primer
The nucleotide sequence of the stem ring reverse transcriptase primer in mixed liquor is as shown in table 4.
Table 4 primer and probe sequence table
Probe two ends mark fluorescent reporter group and fluorescent quenching group respectively.The fluorescence report base of 5 ' end labellings of probe
Group is FAM or VIC, and the quenching group of 3 ' end labellings of probe is BHQ1.Hsa-mir-20a and hsa-mir-17 in the present embodiment
Probe 5 ' end labellings be FAM, hsa-miR-106b and hsa-mir-16 probe 5 ' end labellings be VIC.
Probe primer dry powder is synthesized by hundred Li Ge Bioisystech Co., Ltd, and mother solution is added the dilution of sterilizing ultra-pure water by dry powder
Forming, primer and probe mixed liquor are added the dilution of sterilizing ultra-pure water by mother solution and form, including forward primer, probe, general under
Trip primer, owing to multiplex PCR may produce the inhibitory action between primer and the unstability of amplification efficiency, different primed probe
Concentration there are differences, and optimization experiment condition of the present invention makes primed probe concentration combined effect optimal, forward primer
Concentration is respectively 1 μM/L～15 μMs/L, and the concentration in end reaction system is 0.1 μM/L～1.5 μMs/L, it is preferable that upstream
Primer concentration in end reaction system is 0.8 μM/L；General downstream primer concentration is 20 μMs/L～40 μMs/L, finally
Concentration in reaction system is 2 μMs/L～4 μMs/L, it is preferable that general downstream primer concentration in end reaction system is 3 μ
M/L；Each probe concentration is 1 μM/L～5 μMs/L, and the concentration of end reaction system middle probe is 0.1 μM/L～0.5 μM/L,
Preferably, hsa-mir-20a probe concentration in end reaction system is that 0.16 μM/L, hsa-mir-17 probe is final anti-
Answer the concentration in system be 0.2 μM/L, hsa-miR-106b probe concentration in end reaction system be 0.15 μM/L, hsa-
Mir-16 probe concentration in end reaction system is 0.17 μM/L.Stem ring reverse transcriptase primer is dense for the end in reverse transcription system
Degree 50nM/L.
Two, the using method of test kit.
The concrete detecting step of the gastric cancer detection kit of the present embodiment is as follows:
1, RNA extracts
Patients with gastric cancer sample to be measured and normal healthy controls sample is gathered, the serum provided with Qiagen company of Germany with anticoagulant tube
Total RNA extraction reagent box (article No.: 51504), according to the RNA in test kit operating instruction extracting serum.Pass through Thermo-
Fisher company3.0 nucleic acid-protein fluorescent quantitation instrument, measure sample rna concentration and purity, and the RNA of extracting ultimately joins
In reverse transcription reaction system.
2, RNA reverse transcription
The Reverse Transcriptase kit (article No.: 18080085) using American I nvitrogen company to produce, says according to test kit
Bright book configuration reverse transcription system, takes RNA and the stem ring reverse transcriptase primer mixed liquor of extracting in step 1, carries out miRNA reverse transcription,
Obtaining cDNA template, the sterilizing ultra-pure water of the cDNA product after reverse transcription is diluted 50 times, the cDNA template after dilution is as number
The template of word PCR reaction, places 4 DEG C of refrigerators stand-by.
3, prepared by digital pcr reactant liquor
According to the PCR reaction system in table 5, take the digital pcr premixed liquid mixing of 20 μ l in test kit, the miRNAs of 4 μ l
Primed probe mixed liquor, adds the cDNA after the reverse transcription dilution of 2ul, the droplets stable agent of 4 μ l, adds sterilizing ultra-pure water and mend extremely
40 μ l, prepare digital pcr reactant liquor.
Table 5 PCR reaction system table
| Reacted constituent | Add concentration | Add volume |
| Digital pcr premixed liquid | 2× | 20ul |
| MiRNAs primed probe mixed liquor | --- | 4ul |
| Droplets stable agent | 10× | 4ul |
| CDNA template | --- | 2ul |
| ddH2O | --- | to 40ul |
4, prepared by PCR reaction microdroplet
Microdroplet generation plate is put in 8 passage drop generators, the drop generators produced with Raindance company
RainDrop Source carries out microdroplet process to sample, and digital pcr mixed liquor is fabricated to PCR micro-reaction drop, is formed
500～8,000,000 Water-In-Oil drops.The reaction system of this experiment forms up to a million picoliters level sizes by drop generator
Carry out PCR reaction after Water-In-Oil droplet again, each microdroplet can contain 1 or do not contain the template of genes of interest.
5, PCR amplification
The PCR amplification instrument using Bo company carries out PCR amplification to the microdroplet generated, the response procedures of amplification such as table 6 institute
Show.
Table 6 PCR response procedures table
Preferably, the condition of digital pcr amplification is: the condition in denaturation stage 95 DEG C, 10min；Circulation Isosorbide-5-Nitrae 0 circulation,
Condition is 95 DEG C of 15s, 60 DEG C of 45s；2 conditions that circulate are 98 DEG C of 10min；3 conditions that circulate are 12 DEG C of 30min.
6, microdroplet detection
After PCR reaction terminates, 8 unions are placed in microdroplet analyser, the microdroplet analyser produced with Raindance company
Each microdroplet is detected by RainDrop Sense one by one, and the microdroplet containing fluorescence signal is labeled as 1, is labeled as without fluorescence signal
0, then microdroplet is counted, software automatically analyzes, and is calculated the copy number (number of drops) of miRNA by Poisson distribution formula.
Poisson distribution formula is as follows:
7, experimental result judges
FAM channel detection result is the copy number of hsa-mir-20a and hsa-mir-17 respectively, VIC signalling channel
Testing result is hsa-miR-106b and the copy number of internal reference hsa-mir-16 respectively.
Sample to be tested miRNA expresses judgement:
(if sample to be tested mark miRNA copy number-sample to be tested internal reference miRNA copy number) > (normal healthy controls sample
MiRNA copy number-normal healthy controls sample internal reference miRNA copy number), then the miRNA up-regulated of sample to be tested.
(if sample to be tested mark miRNA copy number-sample to be tested internal reference miRNA copy number) < (normal healthy controls sample
MiRNA copy number-normal healthy controls sample internal reference miRNA copy number), then the miRNA down-regulated expression of sample to be tested.
Three, application examples
Use the plasma sample of the gastric cancer detection kit detection patients with gastric cancer of the present embodiment, by public with Raindance
Each microdroplet is detected by the microdroplet analyser RainDrop Sense of department one by one, counts microdroplet, and software automatically analyzes, by pool
Pine distribution formula calculates the absolute copy number of miRNA.The testing result figure obtained is as it is shown in figure 1, in hsa-mir-20a circle be
The number of drops of the fragment of hsa-mir-20a mesh, is the number of drops of the fragment of hsa-mir-17 mesh in hsa-mir-17 circle, hsa-
MiR-106b circle is the number of drops of the fragment of hsa-miR-106b mesh, hsa-mir-16 circle is the fragment of hsa-mir-16 mesh
Number of drops.Empty droplets circle is the number of drops not including above four purpose fragments, it can clearly be seen that miRNA
The regional boundary line of purpose fragment is clear, and the miRNA of the plasma sample that only can be counted patients with gastric cancer by primary first-order equation is copied
Number, then compare with normal healthy controls sample miRNA copy number, the miRNA expression of judgment sample accurately, contribute to gastric cancer and suffer from
The early diagnosis of person.
Obviously, above-described embodiment is only for clearly demonstrating example of the present invention, and not to the present invention
The restriction of embodiment.For those of ordinary skill in the field, can also be made it on the basis of the above description
The change of its multi-form or variation.Here without also cannot all of embodiment be given exhaustive.And these belong to this
What bright spirit was extended out obviously changes or changes among still in protection scope of the present invention.
SEQUENCE LISTING
<110>Shanghai Saian Biological Medical Technology Co., Ltd.
<120>gastric cancer detection primer probe and test kit thereof
<130>nothing
<160> 13
<170> PatentIn version 3.3
<210> 1
<211> 20
<212> DNA
<213>synthetic
<400> 1
agtgcttata gtgcaggtag 20
<210> 2
<211> 18
<212> DNA
<213>synthetic
<400> 2
aagtgcttac agtgcagg 18
<210> 3
<211> 19
<212> DNA
<213>synthetic
<400> 3
agtgctgaca gtgcagatg 19
<210> 4
<211> 19
<212> DNA
<213>synthetic
<400> 4
gcagcacgta aatattggc 19
<210> 5
<211> 18
<212> DNA
<213>synthetic
<400> 5
gtcgtatcca gtgcgaac 18
<210> 6
<211> 20
<212> DNA
<213>synthetic
<400> 6
cctcggaccc tgcactggat 20
<210> 7
<211> 22
<212> DNA
<213>synthetic
<400> 7
cagtgcaggt aggtcgtatc ca 22
<210> 8
<211> 22
<212> DNA
<213>synthetic
<400> 8
cactggatac gacatctgca ct 22
<210> 9
<211> 20
<212> DNA
<213>synthetic
<400> 9
tggcggtcgt atccagtgca 20
<210> 10
<211> 51
<212> DNA
<213>synthetic
<400> 10
gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgactacctg c 51
<210> 11
<211> 51
<212> DNA
<213>synthetic
<400> 11
gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgacctacct g 51
<210> 12
<211> 51
<212> DNA
<213>synthetic
<400> 12
gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgacatctgc a 51
<210> 13
<211> 50
<212> DNA
<213>synthetic
<400> 13
gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgaccgccaa 50
Claims (10)
1. a gastric cancer detection primer probe, it is characterised in that: include that the stem ring reverse transcription for reverse transcription hsa-mir-20a draws
Thing a, for the stem ring reverse transcriptase primer b of reverse transcription hsa-mir-17, for the stem ring reverse transcription of reverse transcription hsa-miR-106b
Primer c, for the stem ring reverse transcriptase primer d of reverse transcription hsa-mir-16, for detect hsa-mir-20a forward primer a and
Probe a, for detecting the forward primer b and probe b of hsa-mir-17, for detect hsa-miR-106b forward primer c and
Probe c, for detecting the forward primer d and probe d of hsa-mir-16, and is used for detecting hsa-mir-20a, hsa-mir-
17, the general downstream primer of hsa-miR-106b and hsa-mir-16；
Described hsa-mir-20a, hsa-mir-17 and hsa-miR-106b are marks, and described hsa-mir-16 is internal reference；
The nucleotide sequence of described forward primer a as shown in SEQ ID No.1, the nucleotide sequence such as SEQ ID of described probe a
Shown in No.6；
The nucleotide sequence of described forward primer b as shown in SEQ ID No.2, the nucleotide sequence such as SEQ ID of described probe b
Shown in No.7；
The nucleotide sequence of described forward primer c as shown in SEQ ID No.3, the nucleotide sequence such as SEQ ID of described probe c
Shown in No.8；
The nucleotide sequence of described forward primer d as shown in SEQ ID No.4, the nucleotide sequence such as SEQ ID of described probe d
Shown in No.9；
The nucleotide sequence of described general downstream primer is as shown in SEQ ID No.5；
The nucleotide sequence of described stem ring reverse transcriptase primer a as shown in SEQ ID No.10, the core of described stem ring reverse transcriptase primer b
Nucleotide sequence as shown in SEQ ID No.11, the nucleotide sequence of described stem ring reverse transcriptase primer c as shown in SEQ ID No.12,
The nucleotide sequence of described stem ring reverse transcriptase primer d is as shown in SEQ ID No.13；
5 ' the ends of described probe a and probe b are provided with a kind of fluorescent reporter group, and the 5 ' ends of described probe c and probe d are provided with another
Planting fluorescent reporter group, the 3 ' ends of described probe a, probe b, probe c and probe d are provided with quenching fluorescence group；
The described each forward primer final concentration of 0.1 μM/L in reaction system～1.5 μMs/L, described general downstream primer is instead
Answer the final concentration of 2 μMs/L in system～4 μMs/L；
The described probe a final concentration of 0.1 μM/L in reaction system～0.17 μM/L, described probe b is in reaction system
Final concentration of 0.1 μM/L in reaction system of final concentration of 0.18 μM/L～0.5 μM/L, described probe c～0.15 μM/L, institute
State the probe d final concentration of 0.16 μM/L in reaction system～0.5 μM/L.
Gastric cancer detection primer probe the most according to claim 1, it is characterised in that: described probe a is in reaction system
Final concentration of 0.16 μM/L, the described probe b final concentration of 0.2 μM/L in reaction system, described probe c is in reaction system
Final concentration of 0.17 μM/L in reaction system of final concentration of 0.15 μM/L, described probe d.
Gastric cancer detection primer probe the most according to claim 1, it is characterised in that: described each forward primer is in reaction system
In final concentration of 0.8 μM/L, the described general downstream primer final concentration of 3 μMs/L in reaction system.
Gastric cancer detection primer probe the most according to claim 1, it is characterised in that: described each stem ring reverse transcriptase primer is inverse
Transcribing the final concentration in system is 50nM/L.
Gastric cancer detection primer probe the most according to claim 1, it is characterised in that: the 5 ' of described probe a and probe b are held
Fluorescent reporter group is FAM, and the 5 ' fluorescent reporter group held of described probe c and probe d are HEX, VIC, TET or Cy3, institute
Stating quenching fluorescence group is BHQ1 or MGB.
6. the gastric cancer detection product using primed probe as claimed in claim 1.
7. a gastric cancer detection kit, it is characterised in that: include the digital pcr premixed liquid for preparing digital pcr reactant liquor,
Droplets stable agent and miRNAs primed probe mixed liquor, and for carrying out the stem ring reverse transcriptase primer mixed liquor of RNA reverse transcription；
Described miRNAs primed probe mixed liquor includes forward primer a and probe a for detecting hsa-mir-20a, is used for
The forward primer b and probe b of detection hsa-mir-17, for detecting the forward primer c and probe c of hsa-miR-106b, is used for
The forward primer d and probe d of detection hsa-mir-16, and be used for detecting hsa-mir-20a, hsa-mir-17, hsa-miR-
The general downstream primer of 106b and hsa-mir-16；
Described stem ring reverse transcriptase primer mixed liquor includes the stem ring reverse transcriptase primer a for reverse transcription hsa-mir-20a, is used for
The stem ring reverse transcriptase primer b of reverse transcription hsa-mir-17, for the stem ring reverse transcriptase primer c of reverse transcription hsa-miR-106b, uses
Stem ring reverse transcriptase primer d in reverse transcription hsa-mir-16；
Described hsa-mir-20a, hsa-mir-17 and hsa-miR-106b are marks, and described hsa-mir-16 is internal reference；
The nucleotide sequence of described forward primer a as shown in SEQ ID No.1, the nucleotide sequence such as SEQ ID of described probe a
Shown in No.6；
The nucleotide sequence of described forward primer b as shown in SEQ ID No.2, the nucleotide sequence such as SEQ ID of described probe b
Shown in No.7；
The nucleotide sequence of described forward primer c as shown in SEQ ID No.3, the nucleotide sequence such as SEQ ID of described probe c
Shown in No.8；
The nucleotide sequence of described forward primer d as shown in SEQ ID No.4, the nucleotide sequence such as SEQ ID of described probe d
Shown in No.9；
The nucleotide sequence of described general downstream primer is as shown in SEQ ID No.5；
The nucleotide sequence of described stem ring reverse transcriptase primer a as shown in SEQ ID No.10, the core of described stem ring reverse transcriptase primer b
Nucleotide sequence as shown in SEQ ID No.11, the nucleotide sequence of described stem ring reverse transcriptase primer c as shown in SEQ ID No.12,
The nucleotide sequence of described stem ring reverse transcriptase primer d is as shown in SEQ ID No.13；
5 ' the ends of described probe a and probe b are provided with a kind of fluorescent reporter group, and the 5 ' ends of described probe c and probe d are provided with another
Planting fluorescent reporter group, the 3 ' ends of described probe a, probe b, probe c and probe d are provided with quenching fluorescence group；
The described each forward primer final concentration of 0.1 μM/L in reaction system～1.5 μMs/L, described general downstream primer is instead
Answer the final concentration of 2 μMs/L in system～4 μMs/L；
The described probe a final concentration of 0.1 μM/L in reaction system～0.17 μM/L, described probe b is in reaction system
Final concentration of 0.1 μM/L in reaction system of final concentration of 0.18 μM/L～0.5 μM/L, described probe c～0.15 μM/L, institute
State the probe d final concentration of 0.16 μM/L in reaction system～0.5 μM/L.
Gastric cancer detection kit the most according to claim 7, it is characterised in that: described probe a end in reaction system
Concentration is 0.16 μM/L, and the described probe b final concentration of 0.2 μM/L in reaction system, described probe c is in reaction system
Final concentration of 0.15 μM/L, the described probe d final concentration of 0.17 μM/L in reaction system；Described each forward primer is in reaction
Final concentration of 0.8 μM/L in system, the described general downstream primer final concentration of 3 μMs/L in reaction system；Described each stem
Ring reverse transcriptase primer final concentration in reverse transcription system is 50nM/L；The fluorescence report base that the 5 ' of described probe a and probe b are held
Group is FAM, and the 5 ' fluorescent reporter group held of described probe c and probe d are HEX, VIC, TET or Cy3, described quenching fluorescence
Group is BHQ1 or MGB.
Gastric cancer detection kit the most according to claim 7, it is characterised in that: described digital pcr premixed liquid includes DNA
Polymerase, ultra-pure water, dNTPs mixed liquor, reference fluorescent ROX and buffer；Described droplets stable agent includes mineral oil.
Gastric cancer detection kit the most according to claim 7, it is characterised in that: during reaction, reaction system includes numeral
PCR premixed liquid 10 volume, miRNAs primed probe mixed liquor 2 volume, droplets stable agent 2 volume, cDNA template 1 volume, sterilizing
Ultra-pure water 5 volume.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610903791.8A CN106282387A (en) | 2016-10-17 | 2016-10-17 | Gastric cancer detection primer probe and test kit thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610903791.8A CN106282387A (en) | 2016-10-17 | 2016-10-17 | Gastric cancer detection primer probe and test kit thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106282387A true CN106282387A (en) | 2017-01-04 |
Family
ID=57718200
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610903791.8A Pending CN106282387A (en) | 2016-10-17 | 2016-10-17 | Gastric cancer detection primer probe and test kit thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106282387A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108977540A (en) * | 2018-07-24 | 2018-12-11 | 深圳瑞科生物科技有限公司 | A kind of cancer diagnosis reagent box and its application of combination monitoring RhoA signal path and microRNAs |
| CN111893112A (en) * | 2020-08-12 | 2020-11-06 | 上海尤里卡信息科技有限公司 | Gastric cancer tumor marker and application thereof |
| CN112695080A (en) * | 2020-12-27 | 2021-04-23 | 中山大学孙逸仙纪念医院 | miRNA-106b detection kit based on digital PCR platform |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101755208A (en) * | 2007-07-25 | 2010-06-23 | 路易斯维尔大学研究基金会公司 | Allochthon associated microRNA as diagnostic marker |
| CN105200157A (en) * | 2015-11-04 | 2015-12-30 | 中国人民解放军总医院 | Plasma miRNA (micro-ribonucleic acid) biologic marker assemblage for gastric cancer, application of assemblage and early diagnosis kit for gastric cancer |
-
2016
- 2016-10-17 CN CN201610903791.8A patent/CN106282387A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101755208A (en) * | 2007-07-25 | 2010-06-23 | 路易斯维尔大学研究基金会公司 | Allochthon associated microRNA as diagnostic marker |
| CN105200157A (en) * | 2015-11-04 | 2015-12-30 | 中国人民解放军总医院 | Plasma miRNA (micro-ribonucleic acid) biologic marker assemblage for gastric cancer, application of assemblage and early diagnosis kit for gastric cancer |
Non-Patent Citations (2)
| Title |
|---|
| 唐云云: "microRNA在胃癌中的生物学作用", 《中国肿瘤临床》 * |
| 汤佳音 等: "非编码RNA在胃癌诊治中的研究进展", 《肿瘤》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108977540A (en) * | 2018-07-24 | 2018-12-11 | 深圳瑞科生物科技有限公司 | A kind of cancer diagnosis reagent box and its application of combination monitoring RhoA signal path and microRNAs |
| CN111893112A (en) * | 2020-08-12 | 2020-11-06 | 上海尤里卡信息科技有限公司 | Gastric cancer tumor marker and application thereof |
| CN112695080A (en) * | 2020-12-27 | 2021-04-23 | 中山大学孙逸仙纪念医院 | miRNA-106b detection kit based on digital PCR platform |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Liu et al. | Analysis of miR-205 and miR-155 expression in the blood of breast cancer patients | |
| CN107365852B (en) | Application of lung cancer related microRNA molecular marker in serum exosome and detection kit thereof | |
| Cai et al. | Serum miR-195 is a diagnostic and prognostic marker for osteosarcoma | |
| Feber et al. | MicroRNA prognostic signature for nodal metastases and survival in esophageal adenocarcinoma | |
| Zheng et al. | Advances in circulating microRNAs as diagnostic and prognostic markers for ovarian cancer | |
| AU2018202963B2 (en) | Biomarkers useful for detection of types, grades and stages of human breast cancer | |
| CN104357443B (en) | A kind of detection of the long-chain non-coding RNA for bladder cancer examination and its application | |
| CN103923983B (en) | Detection and application of long-chain non-coding RNA of remarkable up regulation in esophageal squamous carcinoma | |
| CN105176983A (en) | Kit for detecting esophageal squamous carcinoma associated serum miRNAs genes | |
| CN106282387A (en) | Gastric cancer detection primer probe and test kit thereof | |
| CN106520929A (en) | Non-small cell lung cancer detection primer and probe and kit | |
| KR20210132033A (en) | Biomarker panel for cancer diagnosis and prognosis | |
| KR102096498B1 (en) | MicroRNA-4732-5p for diagnosing or predicting recurrence of colorectal cancer and use thereof | |
| CN106350596A (en) | Prognosis detection primer probe and kit thereof for colorectal cancer | |
| Gui et al. | A panel of eight autophagy-related long non-coding RNAs is a good predictive parameter for clear cell renal cell carcinoma | |
| CN109022583A (en) | Hsa_circ_0021977 is preparing the application on Diagnosis of Breast cancer product | |
| CN107299129B (en) | Application of circulating nucleic acid as breast cancer biomarker | |
| US20150247202A1 (en) | Microrna based method for diagnosis of colorectal tumors and of metastasis | |
| CN103952477A (en) | Detection and application of esophageal carcinoma-related long non-coding RNA | |
| CN104450702B (en) | A kind of Serum miRNA biomarker composition and application | |
| WO2023014297A2 (en) | Circulating microrna panel for the early detection of breast cancer and methods thereof | |
| CN105154560B (en) | PCR kit for fluorescence quantitative and detection method and purposes for oophoroma | |
| EP2906713A1 (en) | Micro-rna biomarkers for prostate cancer | |
| KR102096499B1 (en) | MicroRNA-3960 for diagnosing or predicting recurrence of colorectal cancer and use thereof | |
| CN108728439A (en) | The finger-print of tiny RNA composition and its application in Diagnosis of Bladder |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170104 |