CN102746387A - DNA (Deoxyribose Nucleic Acid) vaccine of HCV (Hepatitis C Virus) and preparation method thereof - Google Patents
DNA (Deoxyribose Nucleic Acid) vaccine of HCV (Hepatitis C Virus) and preparation method thereof Download PDFInfo
- Publication number
- CN102746387A CN102746387A CN2012102582525A CN201210258252A CN102746387A CN 102746387 A CN102746387 A CN 102746387A CN 2012102582525 A CN2012102582525 A CN 2012102582525A CN 201210258252 A CN201210258252 A CN 201210258252A CN 102746387 A CN102746387 A CN 102746387A
- Authority
- CN
- China
- Prior art keywords
- cell
- gene
- virus
- hcv
- nucleic acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention discloses a DNA (Deoxyribose Nucleic Acid) vaccine of an HCV (Hepatitis C Virus) and a preparation method thereof. The vaccine has CTL (Cytotoxic Lymphocyte) cell immunity and the capability of neutralizing virus infection. The preparation method comprises the following steps of: constructing a recombinant plasmid containing an E1E2 wild-type gene; and mutating a corresponding glycosylation mutant (E1-N209SS is mutated into E1-D209SS, and E2-N430AS is mutated into E2-D430AS) on site-directed mutated PCR (Polymerase Chain Reaction) mutated E1E2; and coupling a CpG sequence by adopting a PCR method, wherein a mutant is named CpG-N2N8. After a mouse is immunized with the DNA vaccine, an antiserum for neutralizing HCVcc (cell cultured Hepatitis C Virus) can be obtained. The method is easy and convenient, and is low in cost; and the DNA vaccine can be used for expressing virus genes, can be used for inducing body fluid immune response of a CTL cell immunizing and neutralizing antibody and which is stronger than wild E1E2, and has a remarkable economic benefit.
Description
Technical field
The invention belongs to molecular biology and infection immunity field, (hepatitis C Virus, dna vaccination HCV) the invention still further relates to the preparation method of this vaccine to be specifically related to a kind of hepatitis C virus.
Background technology
China is one of the high infection rate of HCV country, and it is one of principal element that causes chronic hepatitis, liver cancer, liver cirrhosis that HCV infects, and has a strong impact on human health.Still there are not efficacious therapy and preventative HCV vaccine at present.
The final control of HCV will be depended on vaccine prevention.Attack in the human body cell with immunity opposing HCV at the phagocytic process of keeping out virus, specificity neutrality antibody and cellular immunization have played important effect.HCV coating (envelope) gp (E1 and E2) can lure that body produces neutralizing antibody, the invasion of blocking virus into.Coating E2 albumen is the main target antigen of inducing neutralizing antibody, though the proteic variability of E2 is higher, in E2, has identified a series of conservative neutralizing antibody epi-positions in recent years, and this has brought new hope for the HCV developing vaccines.Dna vaccination has been widely used in hepatitis B virus, in the prevention and treatment of rabies virus and human acquisition immunodeficiency virus.Its ultimate principle is that the gene segment with coding for antigens directly directly imports in the host through methods such as intramuscular injection or particle guns; After absorbing in the DNA body; The antigen protein that is produced when the post transcriptional modificaiton of antigen protein and three-dimensional conformation and natural infection is just the same; Antigenicity is good, gives birth to (source) property proteantigen in these and presents through the mhc class i approach, induces to produce cytotoxicity lymph reaction (CTL) responsiveness CD8+T cell; After soluble antigen albumen is discharged into the extracellular; By full-time antigen presenting cell (APC) picked-up, present activation CD4+T cell then through MHC II classpath; And produce the B cell activation of antibody subsequently, so dna immunization can be induced the immunoreation of body comprehensively.
3011 amino acid whose long opening code-reading frames of HCV virosome genes encoding.In virus replication, aminoterminal has three albumen (C, E1, E2/NS1), and carboxyl terminal has four albumen (NS2, NS3, NS4, NS5) (Pwalotsky JM, Gastroenterology, 2002,122 (6): 1554-1568).HCV E district envelope glycoprotein is the major antigen district that induces neutralizing antibody, so the antigen of HCV E district and coding thereof is emphasis (Fournillier, et al.J.Virol, 2001 of HCV vaccine research; 75:12088).The envelope protein El of HCV and E2 bring into play keying action in virus identification, adhesion, intrusion host cell process.E1E2 contains T, B cell epitope, can induce protective immunological reaction, is protective antigen.
Glycosylation is the important modification processing link behind the protein translation, can correctly fold by the inducible protein space conformation, increases proteic enzyme wetting ability, stability, and can regulate proteic antigenicity.Contain a plurality of conservative N-glycosylation sites on E1 and the E2, promptly the N-glycosylation site all is conservative existence in the different genotype of HCV.Wherein E1 has 5 N-glycosylation sites, and E2 is last to have 11 (Goffard, A et al., J.Virol, 2005,79:8400-8409; Slater-Handshy et al, Virology, 2004,319 (1): 36-48).
Although the function of E1E2 is more clearly with effect, yet the immune protective of E1E2 is still lower.In addition, the proteic molecular weight size of the E1 of the genes encoding of HCV and E2 is respectively: 31KD and 70KD, and its prokaryotic expression protein can not form proteinic glycosylation, and expresses difficulty, and the lower and purification difficult of the output of eukaryotic expression.Thereby the application of E1E2 in actual immunoprotection be restricted, and is unfavorable for promoting.
Summary of the invention
First purpose of the present invention is to above-mentioned deficiency, and a kind of E1E2 two mutants with stronger immune protective is provided.
Second purpose of the present invention is to provide the dna vaccination that can produce the said mutation body.
The 3rd purpose of the present invention is to provide the preparation method of above-mentioned dna vaccination.
Be to realize above-mentioned purpose, the present invention at first provides a kind of HCV envelope glycoprotein E1E2 two mutants, and it is E1 albumen and the proteic fusion rotein of E2, and proteic the 2nd glycosylation site of E1 sport D by N, and proteic the 8th glycosylation site of E2 sports D by N.That is, this two mutants is the proteic N-glycosylation site sudden change of E1E2, and amino acid is that aspartic acid obtains by original asparagine mutation, and concrete said sudden change is that the proteic E1-N209SS of E1E2 sports E1-D209SS, and E2-N430AS sports E2-D430AS.The aminoacid sequence of said two mutants is shown in SEQ ID No.1.This two mutants can induce the generation specific cellular immunity stronger (CTL) and neutrality antibody than wild-type HCVE1E2 (neutralizing antibody, NAb).
Further the present invention provides the gene of said HCV envelope glycoprotein E1E2 two mutants.For promoting to make up the mobilizing function of the dna vaccination that obtains, preferably this gene order is carried out CpG and modify, CpG sequence in the connection, preferable CpG sequence is GACGTT.The nucleotide sequence of preferable said gene is shown in SEQ ID No.2.
Nucleic acid vaccine of the present invention (dna vaccination) promptly comprises said gene, and it is implemented on the expression vector, and virus vector for example, preferred said carrier are pVAX-1 (the U.S. FDA approval is used for the carrier of the dna vaccination of human body).
(for example the eukaryon expression plasmid pcDNA3-E1E2 with the E1E2 of HCV virogene type 1a is a template at HCV wild-type E1E2 gene; E1E2 gene order (the Chen F that PCR obtains; Et al., Antimicrobial agents and Chemotherapy, 2010; P3355-3364)) two ends are introduced CpG sequence and restriction enzyme site BamHI+EcoRI respectively; This fragment is building up on the plasmid vector, uses the rite-directed mutagenesis PCR method that the l-asparagine codon mutation that E1E2 goes up corresponding glycosylation site is the aspartic acid codon, this plasmid vector of BamHI+EcoRI double digestion and expression vector (for example pVAX-1) again; Connect, the correct recombinant vectors that connects of screening promptly gets.
The E1E2 glycosylation mutant of the HCV of the N-glycosylation site sudden change that the present invention makes up can produce stronger immunogenicity; Can produce by stronger cellular immunization and the neutrality antibody of induction ratio wild-type; Thereby can remove virus effectively, external can be effectively in and virus infection.Dna vaccination of the present invention is an immunogen with eukaryon expression plasmid DNA, and direct and CpG adjuvant combined immunization has overcome the difficulty of glycosylated protein on protokaryon and eukaryotic expression, and neutralization virus effectively further infects.
Description of drawings
What Fig. 1 showed is to adopt serum lactic dehydrogenase release experiment (LDH experiment) to detect the active result of mouse cell toxicity T cell (CTL) specific killing.CpG strengthened mouse specific C D8+T killing activity be CTL, wherein CpG-N2N8 induces the CTL activity of generation the highest, compares * p＜0.05 with WT – E1E2 group.The ratio of target cell is imitated in the E:T representative.
What Fig. 2 showed is the viral RNA expression that quantitative RT-PCR detects virus infection Huh7.5.1 cell.The neutralising capacity that the JFH (2a) of the serum of CpG-N2N8 immune mouse inhibition as a result HCVcc infects the Huh7.5.1 cell is the strongest.Compare * p < 0.05 with contrast with the WT group.
What Fig. 3 showed is the viral protein expression situation that immunoblotting (Western Blot) detects virus infection Huh7.5.1 cell.Compare with wild-type HCVE1E2 group, the serum that obtains behind the CpG-N2N8 immune mouse infects HCVcc has more significantly neutralizing effect.(A) WB detect in the serum with the expression of the NS3 that suppresses HCV (the different mutants immune mouse antiserum(antisera) according to the dilution proportion of 1:200, C represents CpG); (B) WB detects in the serum expression with the E2 that suppresses HCV.
What Fig. 4 showed is the inhibition situation that immunity back mice serum infects HCVpp.The serum that obtains behind the CpG-N2N8 immune mouse as a result all can effectively suppress 7 genotypic HCVpp and infect the Huh7.5.1 cell, compares * p＜0.05 with the WT-E1E2 group.
Table 1 show for after each organizes two mutants immune mouse, the antibody horizontal of mouse, and serology change over condition.
Embodiment
Following examples are used to further specify the present invention, but should not be construed as limitation of the present invention.If do not specialize the conventional means that used technique means is well known to those skilled in the art among the embodiment.
One, makes up the eukaryon recombinant plasmid that contains E1E2 wild-type and two mutants
Carrier is pVAX-1; PcDNA3.1-E1E2 plasmid vector (Chen F; Et al., Antimicrobial agents and Chemotherapy, 2010; P3355-3364) contain the full-length gene order (gene order number for AY958062) of the E1E2 of complete 1a type HCV, cut by the BamHI+EcoRI enzyme and insert pVAX-1 (Invitrogen) carrier.。Use the rite-directed mutagenesis PCR method that the asparagine mutation that E1E2 goes up corresponding glycosylation site is aspartic acid again.BamHI+EcoRI double digestion pVAX-1 and E1E2 and glycosylation mutant fragment connect, and obtain the recombinant plasmid flat pVAX-CpG-N2N8 of called after respectively, CpG-N8, CpG-N13, CpG-N2N4, CpG-N2N8, CpG-N2N14.Required primer is following in the structure:
E1E2-P1:
5’-CGGGATCCGCCACCATGGGTTCCTCTTTTTCTAT
E1E2-P2:
5’-CGGAATTCTACGCCTCCGCTTGGGATA
E1E2-P3:
5’-CAATACTCGAGTCAGGGCAATCAT
E1E2-P4:
5’-TGATTGCCCTGACTCGAGTATTGT
E1E2-P5:
5’-GTAGATAGAGCAGTCGCAGTCTTGCGT
E1E2-P6:
5’-ACGCAAGACTGCGACTGCTCTATCTAC
E1E2-P7:
5’-TGTCGAGGCTCGCATCACAGTTCAAGGC
E1E2-P8:
5’-GCCTTGAACTGTGATGCGAGCCTC
E1E2-P9:
ATCCAGATGAGTCCATCCAGGTGCAACCG
E1E2-P10:
CACCTGGATGGACTCATCTGGATTT
E1E2-P11:
5’-CAAGGTGTTGTCGCCCACTCCTCC
E1E2-P12:
5’-GAGGAGTGGGCGACAACACCTTG
E1E2-P13:
5’-CGGGATCCGACGTTATGGGTTCCTCTTTTTCTATCT
E1E2-P14:
5’-AATGAATTCGACGTTCTACGCCTCCGCTTGGGATAT
Wherein, E1E2-P1 and E1E2-P2 are used for making up the plasmid of E1E2 total length, E1E2-P3 and the E1E2-P4 primer N2 site that is used for suddenling change, E1E2-P5 and the E1E2-P6 N4 site that is used for suddenling change; E1E2-P7 and the E1E2-P8 N8 site that is used for suddenling change; E1E2-P9 and the E1E2-P10 N13 site that is used for suddenling change, E1E2-P11 and the E1E2-P12 N14 site that is used for suddenling change, E1E2-P13 and E1E2-P14 are used for introducing the CpG sequence.
Be example with sudden change N2 site below, reaction system is following:
Obtaining of upper reaches product: the obtaining of downstream product:
Template plasmid pcDNA3.1/E1E2:1 μ l template plasmid pcDNA3.1/E1E2:1 μ l
10mm?dNTP:2μl 10mm?dNTP:2μl
E1E2-P1:1μl E1E2-P4:1μl
E1E2-P3:1μl E1E2-P2:1μl
10×pfu?buffer:5μl 10×pfu?buffer:5μl
Pfu enzyme: 1 μ l Pfu enzyme: 1 μ l
ddH
2O:39μl ddH
2O:39μl
Obtaining of total length PCR product:
Template: upper reaches product 2 μ l+ downstream product 2 μ l
10mm?dNTP:2μl
E1E2-P1:1μl
E1E2-P2:1μl
10×pfu?buffer:5μl
Pfu enzyme: 2 μ l
ddH
2O:35μl
Reaction conditions is following:
Two, dna vaccination immune mouse antiserum(antisera) antibody titer relatively
Adopt the extraction DNA test kit of OMEGA Biotek company, with the E1E2 wild plasmid and the extraction of glycosylation mutant plasmid of reorganization, purifying; After removing intracellular toxin; Amount and 500U IL-2 (immunological adjuvant) with 20 μ g import different plasmids respectively in the mouse leg muscle through the gene introducing apparatus, and be weekly; Immunity is three times altogether; E2 albumen booster immunization is once got mice serum in the time of last immune back 10 days, and enzyme-linked immunosorbent assay detects to the proteic antibody titer of E2 (seeing table 1).
Mouse total IgG antibody titer after the immunity of table 1. DNA
Three, the active monitoring of CD8+T CTL specific killing
After mouse after the immunity was put to death, the lymphocyte separation medium separating Morr. cell carried out cell counting, adjustment cell concn to 1 * 10
7Individual/ml, and the action effect cell (Effect cells, E).(mouse colonic cell is for ATCC number: CRL-2638) (Target cells, T) (6572-6580), the adjustment cell concn is 1 * 10 to the CT26 cell of stable transfection wild-type E1E2 fusion gene for Liu M, et al.Vaccine 2007 for target cell
5Individual/ml.Setting effect target cell cell proportion (E:T) is 100:1; 50:1; 25:1; 10:1; 5:1 is according to CytoTox
the Non-Radioactive Cytotoxicity Assay test kit (article No.: G1780) detect CD8+T CTL specific killing activity through serum lactic dehydrogenase release experiment (LDH experiment) of Promega company.
1. immune mouse spleen preparation (effector cell):
1) spleen is taken out in the aseptic abdominal cavity of cutting off of mouse, places the capsule that serum-free RPMI1640 nutrient solution is housed, and steel mesh grinds to form cell suspension, through 200 order nylon net filters.
2) filtrating 2000rpm is centrifugal 10 minutes, and room temperature is abandoned supernatant.
3) deposition adds the Tris-NH of pH7.2
4Cl7ml, capillary pipet piping and druming mixing, 37 ℃, water-bath 15 minutes is to abolish red corpuscle.2000rpm, centrifugal 10min, with aseptic PBS washing once.
4) cell precipitation suspends with the RPMI1640 substratum of 10%FBS, and the constant volume counting is transferred cell concn to 1 * 10
7/ ml, subsequent use.
2. the preparation (target cell) of the CT26 cell of stably express E1E2
The CT26 cell that will in culturing bottle, grow to 90% fusion washs once with PBS, and with 0.25%Trypsin-EDTA digestion, it is 1 * 10 that cell concn is adjusted in constant volume counting back
5Individual/ml is subsequent use.
3.LDH experiment detects mouse cell toxicity T cell (CTL) killing activity.
1) with the effector cell according to 1 * 10
7Individual/ml, 5 * 10
6Individual/ml, 2.5 * 10
6Individual/ml, 1 * 10
6Individual/ml, 0.5 * 10
6The concentration of individual/ml joins in 96 orifice plates, 100 μ l/well.
2) target cell is the CT26 cell of stably express E1E2, and concentration is 1 * 10
5Individual/ml, 100 μ l/well.
3) target cell nature release aperture is set simultaneously, the maximum release aperture of target cell, effector cell's nature release aperture etc.
4) with the centrifugal 4min of 96 well culture plate 240g, imitate target cell with mixing, cultivated 4 hours for 37 ℃.
5) add 10 μ l lysates (10 * lysis buffer) in target cell, this is maximum LDH release group; Add 10 μ l lysates (10 * lysis buffer) in the RPMI-1640 nutrient solution, this is the volume correction group, continues to cultivate 45 minutes.
6) the centrifugal 4min of 250g, 50 μ l supernatants are drawn in the enzyme plate respective aperture in every hole.
7) diluent that thaws, return to room temperature after, add in the substrate bottle, behind the mixing, every hole adds 50 μ l dilution substrate, hatches min for 37 ℃, every hole adds 50 μ l stop buffers, reads plate in 1 hour.
8) specific killing efficient is calculated by following formula:
The spontaneous release of the maximum release-target cell of specific killing rate (%)=(the spontaneous release of the spontaneous release-target cell of experimental group release-experimental group)/target cell) * 100%
The result is as shown in Figure 1, and CpG has strengthened the specific killing activity of the CTL of mouse, and wherein CpG-N2N8 induces the CTL activity of generation the highest, compares * p＜0.05 with WT – E1E2 group.
Four, the detection of neutrality antibody (suppressing to detect the viral RNA content behind the virus infection)
The Huh7.5.1 cell is according to 1 * 10
5The ratio branch of cells/well is gone in 12 orifice plates, overnight cultures.Cultivation acquisition infectious virus HCVcc in the Huh7.5.1 cell (Chen F, et al., Antimicrobial agents and Chemotherapy, 2010, p3355-3364).With the antiserum(antisera) of every group of mouse according to 1:50,1:200,1:800 is after the dilution proportion of 1:3200, with 1 * 10
7The HCVcc of copy 37 ℃ hatch 1 hour altogether after, infect the Huh7.5.1 cell, act on 6 hours with the Huh7.5.1 cell and is changed to normal perfect medium, total RNA of harvested cell total protein and extraction cell respectively after 72 hours.Real-Time PCR detects every group of antiserum(antisera), and (company is spun by Japanese Japan, rt test kit article No.: FSQ-101S to the influence of virus infected cell; Real-Time PCR test kit article No.: QPK-212) difference harvested cell total protein and the total RNA that extracts cell.
1.TRIzol method is extracted cell total rna.
1) collect the Huh7.5.1 cell that HCVcc infected 72 hours, wash twice with PBS after, every hole adds 500 μ lTRIzol reagent again.
2) treat the abundant cracking of cell after, cell pyrolysis liquid changed in the EP pipe and in every pipe add 300 μ l chloroforms, fully put upside down behind the mixing and leave standstill 10min, 4 ℃ of centrifugal 10min of following 12000r/min under the room temperature.
3) supernatant is changed in the new EP pipe, add 500 μ l isopropanol precipitating RNA, 4 ℃ of centrifugal 10min of following 12000r/min.
4) deposition is with 600 μ l75% spirituous solution (0.1%DEPC-H
2The O preparation) washing is 2 times, the centrifugal supernatant that goes, and gained RNA is with 20 μ l DEPC-H
2The O dissolving, the concentration of measure R NA.
2. reverse transcription PCR obtains to touch plate cDNA first chain.
According to rt test kit (TOYOBO), concrete steps are following:
1) the total RNA with 1 μ g is a template, and Random Primer is a random primer, and reaction system is following:
2) 65 ℃, 5min, taking-up immediately places on ice.
3) reaction solution preparation: add following reaction solution in the above-mentioned reaction solution 12 μ l/ pipe
4) experimentize according to following temperature condition:
30℃，10min→42℃，30min→99℃，5min→4℃，5min。
3.Real?Time?PCR
1) reaction system is following:
Wherein, P1 primer: 5 '-CGGGAGAGCCATAGTGGTCTGCG-3 ' (130-152nt);
The P2 primer: 5 '-CTCGCAAGCACCCTATCAGGCAGTA-3 ' (287-311nt)
ROX reference dyestuff: in order to the fluorescent signal error that produces between correction hole and the hole.
2) reaction conditions is following:
With the antiserum(antisera) of every group of mouse according to 1:50,1:200,1:800 is after the dilution proportion of 1:3200, with 1 * 10
7The HCVcc of copy 37 ℃ hatch 1 hour altogether after, infect the Huh7.5.1 cell, act on 6 hours with the Huh7.5.1 cell and is changed to normal perfect medium, total RNA of harvested cell extraction cell after 72 hours.Real Time PCR detects the influence of every group of antiserum(antisera) to virus infected cell.Carry out quantitative RT-PCR (Real-Time PCR), the result is as shown in Figure 2, and the neutralising capacity that the serum of CpG-N2N8 immune mouse suppresses JFH (2a) HCVcc infection Huh7.5.1 cell is the strongest.Compare * p < 0.05 with contrast with the WT group.
Five, the detection of neutrality antibody (immunoblotting promptly suppresses to detect the viral protein content behind the virus infection)
With the antiserum(antisera) of every group of mouse according to 1:50,1:200,1:800 is after the dilution proportion of 1:3200, with 1 * 10
7The copy HCVcc 37 ℃ hatch 1 hour altogether after; Infect the Huh7.5.1 cell; Act on 6 hours the Huh7.5.1 cell is changed to normal perfect medium; Harvested cell extracts the total protein of cell after 72 hours, and quantitatively, carries out the expression that the SDS-PAGE and the immune marking (western blot) detect viral protein E2 and NS3.The result is as shown in Figure 3, compares with wild-type HCVE1E2 group, and the serum that obtains behind the CpG-N2N8 immune mouse infects HCVcc has more significantly neutralizing effect.
Six, the detection of neutrality antibody (immunofluorescence technique)
HCV7 genotypic pseudovirus of packing (Chen F, et al., Antimicrobial agents and Chemotherapy, 2010, p3355-3364), verify sero-fast and neutralizing effect.1.5x10
6(ATCC CRL-11268) is inoculated into overnight cultures in 6 orifice plates to cells/well 293T cell, and the 293T cell is eukaryon expression plasmid pcDNA3.1-E1E2 (the Chen F of a transfection HCV7 genotypic E1E2 respectively; Et al., Antimicrobial agents and Chemotherapy, 2010; P3355-3364); Packaging plasmid pLP1, pLp2, pLenti-6-luciferase (Invitrogen company).After the transfection 48 hours, collect the cells and supernatant of the pseudovirus (HCVpp) that contains 7 genotypic E1E2, the fluorescence intensity in the detection supernatant is to confirm the titre of pseudovirus.After the pseudovirus supernatant is filtered with 0.45-μ m filter, hatch 1h altogether for 37 ℃ with the antiserum(antisera) (1:80 dilution) of immune mouse again, infect Huh7.5.1 again, detect cell fluorescence intensity after 72 hours.Fluorescence intensity is more little, and the viral postoperative infection property of representative neutralization is more little, and sero-fast neutralising capacity is strong more.The result is as shown in Figure 4, and the serum that obtains behind the CpG-N2N8 immune mouse all can effectively suppress 7 genotypic HCVpp and infect the Huh7.5.1 cell, compares with the WT-E1E2 group to have remarkable meaning, * p＜0.05.
Claims (9)
1.HCV envelope glycoprotein E1E2 two mutants, it is E1 albumen and the proteic fusion rotein of E2, and proteic the 2nd glycosylation site of E1 sport D by N, and proteic the 8th glycosylation site of E2 sports D by N.
2. two mutants according to claim 1 is characterized in that, the aminoacid sequence of said two mutants is shown in SEQ ID No.1.
3. the gene of coding claim 1 or 2 said HCV envelope glycoprotein E1E2 two mutants.
4. gene according to claim 3 is characterized in that this gene also is connected with the CpG sequence.
5. gene according to claim 4 is characterized in that, the nucleotide sequence of said gene is shown in SEQ ID No.2.
6. nucleic acid vaccine, it comprises each described gene of claim 3 ~ 5.
7. nucleic acid vaccine according to claim 6 is characterized in that, and is said gene constructed on expression vector.
8. nucleic acid vaccine according to claim 7 is characterized in that, said expression vector is pVAX-1.
9. method for preparing claim 7 or 8 said nucleic acid vaccines, this method comprises the steps:
Introduce CpG sequence and restriction enzyme site at HCV wild-type E1E2 gene two ends
BamHI+
EcoRI is building up to this fragment on the plasmid vector, uses the rite-directed mutagenesis PCR method that the l-asparagine codon mutation that E1E2 goes up corresponding glycosylation site is the aspartic acid codon again,
BamHI+
EcoThis plasmid vector of RI double digestion and expression vector connect, and the correct recombinant vectors that connects of screening promptly gets.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210258252.5A CN102746387B (en) | 2012-07-24 | 2012-07-24 | DNA (Deoxyribose Nucleic Acid) vaccine of HCV (Hepatitis C Virus) and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210258252.5A CN102746387B (en) | 2012-07-24 | 2012-07-24 | DNA (Deoxyribose Nucleic Acid) vaccine of HCV (Hepatitis C Virus) and preparation method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102746387A true CN102746387A (en) | 2012-10-24 |
| CN102746387B CN102746387B (en) | 2014-08-13 |
Family
ID=47026922
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210258252.5A Active CN102746387B (en) | 2012-07-24 | 2012-07-24 | DNA (Deoxyribose Nucleic Acid) vaccine of HCV (Hepatitis C Virus) and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102746387B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103435690A (en) * | 2013-09-13 | 2013-12-11 | 武汉大学 | DNA (deoxyribonucleic acid) vaccine of HCV (hepatitis C virus) and preparation method thereof |
| CN103540685A (en) * | 2013-09-11 | 2014-01-29 | 浙江大学 | Kit for fluorescent quantitative polymerase chain reaction (PCR) detection of cytomegalovirus gH genetic typing and application thereof |
| CN103642792A (en) * | 2013-12-25 | 2014-03-19 | 武汉大学 | Preparation and application of neutralizing monoclonal antibody of anti-hepatitis C virus |
| CN105254756B (en) * | 2015-11-27 | 2018-09-07 | 武汉大学 | A kind of monoclonal antibody and application for hepatitis C virus envelope protein E 2 |
| CN114748614A (en) * | 2021-12-27 | 2022-07-15 | 上海药明生物医药有限公司 | Method for immunizing animals by using needleless injector |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1943789A (en) * | 2006-10-26 | 2007-04-11 | 武汉大学 | The DNA vaccine of an anti-infection of hepatitis C virus |
-
2012
- 2012-07-24 CN CN201210258252.5A patent/CN102746387B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1943789A (en) * | 2006-10-26 | 2007-04-11 | 武汉大学 | The DNA vaccine of an anti-infection of hepatitis C virus |
Non-Patent Citations (2)
| Title |
|---|
| DIMITRI LAVILLETTE, ET AL.: "Characterization of Host-Range and Cell Entry Properties of the Major Genotypes and Subtypes of Hepatitis C Virus", 《HEPATOLOGY》, vol. 41, no. 2, 28 February 2005 (2005-02-28), pages 265 - 274 * |
| JUN LIU, ET AL.: "Specifically Binding of L-ficolin to N-glycans of HCV Envelope Glycoproteins E1 and E2 Leads to Complement Activation", 《CELLULAR & MOLECULAR IMMUNOLOGY》, vol. 6, no. 4, 31 August 2009 (2009-08-31), pages 235 - 244, XP055202266, DOI: doi:10.1038/cmi.2009.32 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103540685A (en) * | 2013-09-11 | 2014-01-29 | 浙江大学 | Kit for fluorescent quantitative polymerase chain reaction (PCR) detection of cytomegalovirus gH genetic typing and application thereof |
| CN103540685B (en) * | 2013-09-11 | 2015-08-26 | 浙江大学 | Fluorescence quantitative PCR detection cytomegalovirus gH genotyping kit and application |
| CN103435690A (en) * | 2013-09-13 | 2013-12-11 | 武汉大学 | DNA (deoxyribonucleic acid) vaccine of HCV (hepatitis C virus) and preparation method thereof |
| CN103435690B (en) * | 2013-09-13 | 2016-02-10 | 武汉大学 | DNA vaccination of a kind of hepatitis C virus and preparation method thereof |
| CN103642792A (en) * | 2013-12-25 | 2014-03-19 | 武汉大学 | Preparation and application of neutralizing monoclonal antibody of anti-hepatitis C virus |
| CN103642792B (en) * | 2013-12-25 | 2016-03-30 | 武汉大学 | A kind of preparation of neutralizing monoclonal antibody of anti-hepatitis C virus and application thereof |
| CN105254756B (en) * | 2015-11-27 | 2018-09-07 | 武汉大学 | A kind of monoclonal antibody and application for hepatitis C virus envelope protein E 2 |
| CN114748614A (en) * | 2021-12-27 | 2022-07-15 | 上海药明生物医药有限公司 | Method for immunizing animals by using needleless injector |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102746387B (en) | 2014-08-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102746387B (en) | DNA (Deoxyribose Nucleic Acid) vaccine of HCV (Hepatitis C Virus) and preparation method thereof | |
| Gómez et al. | Transient expression of VP2 in Nicotiana benthamiana and its use as a plant-based vaccine against infectious bursal disease virus | |
| CN110845604B (en) | African swine fever preventing and/or treating neutralizing antibody, preparation method and application thereof | |
| CN107899008B (en) | Sick three subunit vaccines of a kind of pig epidemic diarrhea, transmissible gastroenteritis of swine, pig fourth type coronavirus | |
| CN106520710B (en) | Preparation and application of recombinant Newcastle disease virus live vector vaccine expressing duck tembusu virus prm and E proteins | |
| CN108728490A (en) | A kind of carp herpesviral II types DNA vaccination and its construction method and application based on baculovirus vector | |
| CN111304253B (en) | African swine fever virus vaccine, preparation method and application thereof | |
| CN102676461A (en) | Method for producing virus-like particles by utilizing drosophila cells and application | |
| CN113293148B (en) | Construction of H gene replaced chimeric measles attenuated strain | |
| US11952401B2 (en) | Recombinant foot-and-mouth disease virus with reduced immunosuppression activity, and preparation method and use thereof | |
| CN109321534A (en) | A kind of recombination VIII type newcastle disease virus low virulent strain | |
| CN112175086A (en) | Monoclonal antibody of anti-porcine epidemic diarrhea virus nsp13 protein and application | |
| JP2002517200A (en) | Nucleic acid vaccine for prevention of flavivirus infection | |
| CN102321639A (en) | Preparation method of virus-like particles (VLPs) of Chikungunya virus (CHIKV) and its application | |
| US20220370594A1 (en) | Whole avian-origin reverse genetic system and its use in producing h7n9 subtype avian influenza vaccine | |
| CN108779473A (en) | It is used to prepare the purposes of the method and the particle of the virion with ring dinucleotides for treating cancer | |
| CN110124025A (en) | A kind of bird flu and 4 type bigeminy genetic engineering subunit vaccine of aviadenovirus and preparation method thereof | |
| CN102337248B (en) | Recombinant baby hamster kidney (BHK) cell line capable of expressing encephalitis B virus PrM/M-E protein and application thereof | |
| Li et al. | Development and characterization of Rift Valley fever virus-like particles | |
| CN107557347A (en) | New virus sample particle, its preparation method and the application of enterovirns type 71 | |
| CN113827714B (en) | H7N9 subtype avian influenza virus-like particle vaccine preparation, preparation and application | |
| CN103435690B (en) | DNA vaccination of a kind of hepatitis C virus and preparation method thereof | |
| CN109022456B (en) | Preparation method of virus vaccine for expressing plasmodium ovale AMA1 protein | |
| CN102363751A (en) | Dengue virus (DENV)-like particle as well as preparation method and application thereof | |
| CN102793918B (en) | Duck flavivirus subunit vaccine, as well as a preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |