CN102732561A - Recombinant adenovirus carrier with deletion of IVa2 gene function and preparation method thereof - Google Patents

Abstract

The invention provides a recombinant adenovirus carrier with a deletion of an IVa2 gene function and a preparation method thereof. According to the invention, a novel adenovirus carrier system is established, wherein the system can reserve a graphitic level of an adenovirus gene group but block capability of generating a progeny virus; a strategy is adopted, wherein according to the strategy, a E1 gene function is reserved but the IVa2 gene function is deleted; and the novel adenovirus carrier is obtained by gene operation means, wherein the novel adenovirus carrier can express the E1 gene but can not express the IVa2 gene. According to the invention, a method for preparing the novel adenovirus carrier and a purpose thereof are further described.

Description

A kind of recombinant adenoviral vector and preparation method of IVa2 gene function disappearance

Technical field the invention belongs to biological technical field.Be specifically related to a kind of novel recombinant adenovirus vector of IVa2 gene function disappearance.It is reproducible and do not produce the characteristics of progeny virus that described recombinant adenoviral vector has viral genome.This adenovirus carrier all has using value in vaccine research and gene therapy.

(Adenovirus Ad) is a kind of two strands, nonencapsulated dna virus to the technical background adenovirus.Complete virion is the icosahedron symplex structure, diameter 70-100nm.Capsid contains 240 six conjuncted (Hexon), 12 5-linked bodies (Penton) and 12 ciliums (Fiber), and some small proteins, like VI, VIII, IX, IIIa etc.In surpassing 50 kinds adenoviral serotype, the Ad5 carrier of doing transgenosis commonly used.The genomic dna of mammalian adenoviruses is about 36kb, genomic two ends respectively have an appointment 100 reverse terminal repeat (Inverted terminal repeat, ITR).ITR combines with terminal protein (TP), and is relevant with transcribing of genome duplication and early gene.

The life cycle of adenovirus,, be divided into early transcription district and late transcription district with the node that copies as of virus genom DNA.The former has E1A, E1B, E2, E3 and E4 totally 5 discrete transcription units; Have only a transcription unit late period, receive major late promoter (Major late promoter, MLP) regulation and control.Late transcription unit forms L1-L5 totally 5 kinds of mRNA families through the shearing processing of mRNA.The C-terminal of all late transcription mRNA all has a common untranslated leader, be called three leaders (Tripartite leader, TPL).TPL is spliced by 3 different positionss of adenoviral gene group, long 203bp, and the translation of mRNA is relevant with late period.It is all different that the early transcription district respectively distinguishes coded albumen.The E1 gene coding region is the required area of virus replication, after virus gets into nucleus, is activated immediately, and its encoded protein (E1A and E1B) is regulated all early functions.E2 district gene product is divided E2A (DBP) and E2B (pTP and Pol), and the copy machine of viral DNA is provided.The E3 district is the nonessential region of virus replication, and coding is participated in virus and the interactional polypeptide of host, can weaken cells infected by the probability of immunity of organism identification, leaves out the E3 district to not significantly influence of virus infection; E4 district coding is closed host gene and is expressed, and makes its protein that helps viral proliferation, also other district's gene transcription of adjustable.Main late transcription district code sets becomes most of protein of capsid, for the assembling of virion provides " material of construction ".Fig. 1 is the genomic synoptic diagram of 5 type adenovirus.

Adenovirus carrier is because of host range is wide, the exogenous gene expression level is high, unconformability to characteristics such as karyomit(e) and mature preparation process are widely used in gene therapy and vaccine research ^[1-2]Adenovirus carrier the most commonly used is the replication defective property reorganization 5 type adenovirus of E1 disappearance; The recombinant adenovirus of this E1 genetically deficient can be at HEK293 cell (contain and express adenovirus E 1 gene) high efficiently multiplying, but in other does not express the cell of adenovirus E 1 gene, does not then duplicate and produce progeny virus.Though E1 genetically deficient virus replication defective extremely guaranteed the security of adenovirus carrier well, for vaccine carrier, the virus vector genome has replication and is proved to be the immune effect that can improve vaccine greatly ^[3]Therefore, a kind of carrier of deleted adenovirus intermediate gene is invented in this case, a kind ofly keeps the New-type adenovirus carrier system that the viral genome replication can not produce progeny virus and lays the foundation for finally setting up.

The E1 gene is the regulatory gene that adenovirus is expressed in life cycle the earliest, all is essential for the expression of duplicating with structural protein of adenoviral gene group.

The IVa2 expression of gene is between adenovirus in life cycle between early gene and the late gene expression; Therefore be called as intermediate gene (intermediate gene), also be called as the early gene (delayed early gene) of delay because its expression is right after after the gene in early days ^[7]IVa2 is that (major late promoter, activating transcription factor MLP) have vital role to the activation of MLP in adenovirus major late promoter ^[8,9]And the main coat protein Hexon of adenovirus, Penton, the expression of late proteins such as Fiber all receives the regulation and control of MLP.Simultaneously, IVa2 goes in shell (encapsidation) process to have played the part of the key player in the assembling (assembly) and the viral genome of virus capsid protein ^[4]Therefore, the recombinant adenovirus of disappearance IVa2 gene is gone into the shell process at the assembling of the expression of structural protein and virion and genome in theory and is obstructed, thereby can not produce progeny virus.

Mainly be to carry out to virus genomic operation traditionally through the mode of recombinating in external molecular cloning or the body.Carry out genetically engineered operation for the bigger virus of the vaccinia virus that reaches 200kb and so on genome, most of strategies all are to be utilized in the body of viral DNA natural generation in reproduction process homologous recombination to carry out.But natural homologous recombination efficiency is relatively low, and the background of nonrecombinant is too high, and distinguishing recombinant virus then is a more loaded down with trivial details thing with wild virus.

Directly disappearance IVa2 gene is inconvenient on the adenoviral gene group.Because the adenoviral gene group is bigger; Length is about 36kb; Be difficult to find proper restriction site directly to remove the IVa2 gene; And its 5 ' end coding region and E2B Gene Partial are overlapping and can not all remove, so we utilize a kind of accurate disappearance of directly on the adenoviral gene group, carrying out the IVa2 gene order based on the PCR target practice method of λ-RED recombinase system [].

The existing Red recombinase system that utilizes is transformed bacillus coli gene group, the successful report of streptomycete and baculovirus etc. ^[13-15]There are some researches show; In the time of lambda particles phage Red recombinase (three subunits of Exo are formed for Gam, Bet) existence; Sequence-specific homologous recombination can take place with target sequence in linear DNA fragment efficiently in intestinal bacteria, and only need very short homology arm (～40bp).And the such homology arm of length can be added in the two ends of DNA very easily through the PCR primer ^[12]And conventional homologous recombination is the plasmid that contains homology arm to be forwarded among the host go.In intestinal bacteria, because the existence of endogenic exonuclease recBCD (Exo V), linear dna fragmentation can be degraded by it, can not transform ^[11]

Summary of the invention a kind ofly to keep adenoviral gene group replication and blocks the New-type adenovirus carrier system that it produces the progeny virus ability in order to set up; The present invention has adopted the strategy that keeps the E1 gene function and lack the IVa2 gene, obtains a kind ofly can express the E1 gene and can not express the New-type adenovirus carrier of IVa2 gene through the genetic manipulation means.The present invention has also described the method that obtains this New-type adenovirus carrier.Particularly, this reproducible atoxigenic adenovirus system has lacked the major part (1140bp) of IVa2 gene in the adenoviral gene group in this system, make virus can not produce progeny virus; Be in the operation on the basis of original E1 and E3 genetically deficient, (E1A E1B) expresses the unit, makes virus obtain the genome duplication ability to insert artificial constructed E1 gene; This reproducible atoxigenic adenovirus carrier packaging system finally has two kinds of forms:

1) this system comprises following 3 key elements: the HeLa-IVa2 cell; PBHG Δ IVa2; PDC316-MCS-(PGK-E1-polyA) (E1 expresses the unit and is inserted in former E1 district), this is wherein a kind of form.

2) another kind of form is, this system comprises following 3 key elements: HeLa-IVa2 cell, pBHG Δ IVa2 (PGK-E1-polyA), pDC316 (E1 expresses the unit and is inserted in former E3 district).

This system's purposes is vaccine carrier and therapy of tumor, and characteristics are to reach the more effect of high dosage with less dosage, reduces the immunoreation to carrier.

Detailed Description Of The Invention a kind ofly to keep adenoviral gene group replication and blocks the New-type adenovirus carrier system that it produces the progeny virus ability in order to set up; The present invention has adopted the strategy that keeps the E1 gene function and lack the IVa2 gene, obtains a kind ofly can express the E1 gene and can not express the New-type adenovirus carrier of IVa2 gene through the genetic manipulation means.The present invention has also described the method that obtains this New-type adenovirus carrier.

The adenovirus carrier of E1 genetically deficient also is called as first-generation adenovirus carrier, and also often delete to obtain bigger capacity in its E3 district.Further lack on this basis E2 with or the adenovirus carrier of part E4 be called as s-generation adenovirus carrier.The adenovirus carrier that lacks all adenovirus encoding soxs is called as the third generation.The adenovirus carrier of the most widely using at present is the first-generation.

Because the E1 gene is adenovirus starts transcript and expression the earliest in life cycle a gene; It all is absolutely necessary for other early gene and the activation of middle and advanced stage gene transcription; Therefore lacking the E1 gene is the of paramount importance strategy that makes up replication defective sexual gland virus carrier, and the stable E1 gene that carries can fully replenish the required E1 gene function of adenoviral replication in the HEK293 cell.The adenovirus carrier of E1 genetically deficient becomes fool proof because of it can not produce progeny virus in normal cell, has therefore obtained number of applications.

Yet; The adenovirus carrier of E1 genetically deficient also can not carry out genome duplication because of the E1 disappearance; Therefore can not produce " amplification " effect behind the cells infected, promptly can not become more a large amount of genomes, thereby produce higher exogenous gene expression by the minority genome duplication.Therefore; The present invention has designed a kind of E1 of reservation gene function and has lacked the recombinant adenovirus of IVa2 gene function; Make it keep genome duplication function and go into the shell process at the assembling of the expression of structural protein and virion and genome and hindered, thereby can not produce progeny virus.

IVa2 gene length 1628bp, between the IX of adenoviral gene group gene and E2B gene, 5 ' end of its encoding sox has 3 ' end of 488bp and E2B gene coding region overlapping.Because the E2B gene is the indispensable gene of adenoviral replication, therefore when deletion IVa2 gene, to keep this part overlap.We comprise that to IVa2 gene coding region 3 ' end the long 1140bp fragment of terminator codon lacks operation in design.

Directly disappearance IVa2 gene is inconvenient on the adenoviral gene group.Because the adenoviral gene group is bigger; Length is about 36kb; Be difficult to find proper restriction site directly to remove the IVa2 gene, so let us utilize a kind of accurate disappearance of directly on the adenoviral gene group, carrying out IVa2 gene 11 40bp sequence based on the PCR target practice method of λ-RED recombinase system.The synoptic diagram of this method is seen Fig. 4.

The existing Red recombinase system that utilizes is transformed bacillus coli gene group, the successful report of streptomycete and baculovirus etc. ^[13-15]The principle of this method is as lambda particles phage Red recombinase (Gam; Bet; Three subunits of Exo are formed) when existing, sequence-specific homologous recombination can take place with target sequence in linear DNA fragment efficiently in intestinal bacteria, and only need very short homology arm (～40bp).And the such homology arm of length can be added in the two ends of DNA very easily through the PCR primer ^[12]And conventional homologous recombination is the plasmid that contains homology arm to be forwarded among the host go.In intestinal bacteria, because the existence of endogenic exonuclease recBCD (Exo V), effective reorganization can not be taken place by its degraded in linear dna fragmentation.The characteristics of this method be on big genome, directly insert, delete, operation such as replacement, avoid loaded down with trivial details subclone process, the present invention is used for this method the transformation of adenoviral gene group.(synoptic diagram of the gene of pFG140 is seen Fig. 2 and Fig. 8 to use PCR-targeting technological method based on the RED recombinase successfully to lack adenoviral gene group plasmid pFG140; The Microbix Company products) and pBHGloxp (delta) E3; 1Cre (Microbix company) goes up IVa2 (1140bp) fragment in the adenoviral gene group, has made up the adenoviral gene group plasmid pFG140/ Δ IVa2 (synoptic diagram of its gene is seen Fig. 2 and Fig. 9) and the pBHG Δ IVa2 of IVa2 disappearance.Annotate: pFG140/ Δ IVa2 is consistent with pFG140/ Δ IVa2kan, and kan representes that this plasmid is the kalamycin resistance male.Δ is consistent with delta, representes the implication of this genetically deficient.

On the AdMax of Microbix company system-based, transform.Concrete the present invention is with shuttle plasmid pDC316 and adenovirus skeleton plasmid pBHGloxp (delta) E3, and 1Cre is that material is transformed.Make virus assemble and to go out poison and suppress the expression of late protein through disappearance IVa2 gene (1140bp), the IVa2 gene order of disappearance is 524 to 1627 bit sequences of IVa2 gene, altogether 1104bp.

Express unit (PGK promotor-E1AE1B-SV40polyA) viral genome can be duplicated through introducing artificial constructed E1; And it is a kind of constructive expression that this artificial constructed E1 expression unit is compared with the E1 genetic expression unit of wild-type adenovirus; Do not receive viral late period life cycle to the influence that E1 genetic expression suppresses, make virogene continue to duplicate.

Because the IVa2 gene product is essential for completion life cycle of adenovirus, the production that has therefore lacked the recombinant adenovirus of IVa2 gene must be carried out on the cell strain of trans-complementation IVa2 function.Therefore we have made up the mammalian cell expression plasmid pAAV2neo-IVa2 that comprises the IVa2ORF total length.Its composition is that " the tailing signal polyA of CMV promotor-IVa2 gene-bovine growth hormone gene " arranged between 2 AAV2ITR, and the neo expression casette is arranged on the plasmid skeleton, makes can screen resistance clone with G418 behind this plasmid transfection cell.

In order to prove that constructed pAAV2neo-IVa2 has the trans-complementation function; Behind this plasmid and pFG140-Δ IVa2 (1104) cotransfection HEK293 cell; Successfully obtain the recombinant adenovirus Ad5 Δ IVa2 (1104) of IVa2 genetically deficient, and directly used pFG140-Δ IVa2 (1104) plasmid transfection HEK293 cell just can't obtain recombinant virus.Ad5 Δ IVa2 (1104) virus is identified through PCR and the order-checking proof has successfully lacked IVa2 gene 11 40bp fragment at estimating position.Western blot detects the expression less than IVa2 after confirming that also Ad5 Δ IVa2 (1104) infects the HEK293 cell.And recombinant virus Ad5 Δ IVa2 (1104) also can only be in transfection increase in the HEK293 cell of pAAV2neo-IVa2.Through pFG140/ Δ IVa2 and pAAV2neo-IVa2 cotransfection HEK293 cell, obtained the recombinant adenovirus Ad5 Δ IVa2 (1104) of IVa2 disappearance; This recombinant virus Ad5 Δ IVa2 (1104) can not breed in normal HEK293 cell, and can only be in transfection increase in the HEK293 cell of pAAV2neo-IVa2.The propagation that shows Ad5 Δ IVa2 (1104) virus of acquisition depends on the function that external source provides IVa2.

For the cell strain that obtains stably express IVa2 gene as producing cell, the pAAV2neo-IVa2 transfection that we are made up adds the G418 screening and obtains HeLa-IVa2 to the HeLa cell; Transfectional cell carry out mono-clonalization, totally 59 cell strains, picking out can stably express IVa2 gene and support the monoclonal cell HeLa-IVa2-C009 that the recombinant adenovirus of IVa2 genetically deficient duplicates, and is used for a large amount of preparations of IVa2 genetically deficient recombinant adenovirus.Equally, the pAAV2neo-IVa2 transfection that also we is made up adds the G418 screening and obtains HEK293-IVa2 to the HEK293 cell.

In order to obtain the adenovirus carrier of rf, the present invention has made up the E1 gene expression plasmid pPGK-E1AE1B of artificial design, has wherein carried E1 genetic expression unit, is made up of PGK promotor-E1 gene coding region-SV40polyA.In order to verify the function of this plasmid, pPGK-E1AE1B is imported the HeLa cell obtained the HeLa/pGK-E1AE1B stable cell line.Infect HeLa and HeLa/pGK-E1AE1B with the non-Ad5-EGFP that duplicates, visiblely behind the 2d on the HeLa/pGK-E1AE1B cell, see obvious CPE and change, and the EGFP fluorescent brightness is also obviously strong; After the Ad5-EGFP that duplicates infects the cell freezing-thawing and cracking after the HeLa/pGK-E1AE1B pathology; Infect HeLa and HeLa/pGK-E1AE1B once more; Seeing has obvious CPE to change on the HeLa/pPGK-E1AE1B cell; And variation is not obvious on the HeLa cell, proves that the adenovirus carrier that the HeLa/pGK-E1AE1B cell can support E1 to lack property duplicates and pass poison.

On this basis, the E1 genetic expression unit in the pPGK-E1AE1B plasmid is inserted the E3 disappearance district or the E1 disappearance of adenoviral gene group and distinguish, then through obtaining reproducible and atoxigenic adenovirus carrier with the reorganization of shuttle plasmid cotransfection cell.

The mCMV promotor upper reaches with E1 genetic expression unit inserts shuttle plasmid pDC316 or other shuttle plasmid (Microbix company) that should series obtain to carry the unitary universal shuttle plasmid of E1 genetic expression; Insert foreign gene (like EGFP) in its mCMV promotor promotor downstream, obtain to carry the unitary shuttle plasmid of E1 genetic expression; Itself and pBHG Δ IVa2 plasmid co-transfection HeLa-IVa2-C009 cell are obtained Ad5-Δ E1/E1 ⁺-Δ IVa2-X virus, this virus can continuous passage on HeLa-IVa2-C009.

E1 genetic expression unit is inserted into the E3 district that the adenoviral gene group lacks in the pBHG Δ IVa2 plasmid, has obtained pBHG Δ IVa2-E1 ⁺With pBHG Δ IVa2-E1 ⁺Produce cell strain HeLa-IVa2-C009 with the shuttle plasmid cotransfection that carries foreign gene X, obtained Ad5-Δ IVa2-Δ E3/E1 ⁺-X virus, this virus can continuous passage on HeLa-IVa2-C009.

The present invention has set up a kind of recombinant adenoviral vector system and method that obtains to keep E1 gene function and disappearance IVa2 gene function, can obtain the recombinant adenovirus Ad5-Δ E1/E1 of IVa2 gene function disappearance with this carrier system and method ⁺-Δ IVa2-X and Ad5-Δ IVa2-Δ E3/E1 ⁺-X.Recombinant adenovirus Ad5-Δ E1/E1 ⁺The characteristics of-Δ IVa2-X are to have inserted artificial constructed E1 genetic expression unit in the E1 of adenoviral gene group disappearance district; Recombinant adenovirus Ad5-Δ IVa2-Δ E3/E1 ⁺The characteristics of-X are to have inserted artificial constructed E1 genetic expression unit in adenoviral gene group E3 disappearance district.

This reproducible atoxigenic adenovirus carrier packaging system finally has two kinds of forms:

1) this system comprises following 3 key elements: the HeLa-IVa2 cell; PBHG Δ IVa2; PDC316-MCS-(PGK-E1-polyA) (E1 expresses the unit and is inserted in former E1 district), this is wherein a kind of form.

2) another kind of form is, this system comprises following 3 key elements: HeLa-IVa2 cell, pBHG Δ IVa2 (PGK-E1-polyA), pDC316 (E1 expresses the unit and is inserted in former E3 district).

Operation to virogene mainly is to carry out through the mode of recombinating in external molecular cloning or the body traditionally.For the less virus of genome; Like adeno-associated virus (wild-type adeno-associated virus 2 type genomes size is 4680bp); Monkey polyomavirus SV40 (the genome size is 5243bp) etc. only need cut conventional molecular cloning means such as connection through vitro enzyme, can reach the transformation purpose easily.And be similar to the medium sized virus of adenovirus and so on genome (about genome 36kb), and though also can cut ways of connecting through enzyme, because genome is bigger than normal, proper restriction site is few, rather effort operates.Sometimes operation for ease must obtain the mutant strain that restriction enzyme site changes earlier, and common adenovirus 5 type mutant strain dl309 get rid of the product after 3 with 4 Xba I sudden changes in the wildtype adenovirus virus ^[9]This process steps is loaded down with trivial details, and workload is big.Carry out genetically engineered operation for the bigger virus of the vaccinia virus that reaches 200kb and so on genome in addition, most of strategies all are to utilize in the body of viral DNA natural generation in reproduction process homologous recombination to carry out.But natural homologous recombination efficiency is relatively low, and the background of nonrecombinant is too high, and distinguishing recombinant virus then is a more loaded down with trivial details thing with wild virus.

Conventional homologous recombination is the plasmid that contains homology arm to be forwarded among the host go.In intestinal bacteria, because the existence of endogenic exonuclease recBCD (Exo V), linear dna fragmentation can be degraded by it, can not transform ^[10]But there are some researches show; In the time of lambda particles phage Red recombinase (three subunits of Exo are formed for Gam, Bet) existence; Sequence-specific homologous recombination can take place with target sequence in linear DNA fragment efficiently in intestinal bacteria, and only need very short homology arm (～40bp).And the such homology arm of length can be added in the two ends of DNA very easily through the PCR primer ^[11]Existing successful use Red recombinase system is transformed bacillus coli gene group, the report of streptomycete and baculovirus etc. ^[12-14]Except the bacillus coli gene group, the transformation of streptomycete and baculovirus is based on mostly that the clone that is structured on the clay (Cosmid) realizes, and in virological investigation, a large amount of infections clone all is to be structured on plasmid (Plasmid) skeleton.This case utilizes the Red recombinase, serves as to transform object with adenovirus infection sex clone pFG140, is example through deleted adenovirus IVa2 gene, has set up a kind of accurate fast virus genomic method on the plasmid skeleton that is structured in of transforming.

In order to set up PCR target practice method, made up universal template plasmid pAK.This plasmid is that the kanamycin gene expression cassette is cloned in the pMD18-T carrier, has added rare restriction endonuclease Swa I site simultaneously at the two ends of kantlex expression cassette.After recombinating successfully, only need cut behind the recon from connecting, can remove unnecessary kalamycin resistance gene sequence with Swa I enzyme.With pAK is template; Preparation is used for the linear DNA fragment of homologous recombination: if lack certain gene; Only need amplification to contain the kanamycin gene of Swa I restriction enzyme site,, can obtain to be used for the linear DNA fragment of deletion mutantion simultaneously through the homology arm of primer introducing 39bp at PCR product two ends; If insert certain gene, method is similar with disappearance, just before amplification, needs this gene clone in the MCS MCS1 or MCS2 of pAK, and the plasmid figure of pAK sees Fig. 3.

The replication type adenovirus carrier bacterin can be simulated cause of disease reproduction process in vivo, repetitious stimulation immunity system for a long time, thus induce strong, lasting, comprehensively immunoreation, have broad application prospects.But to the immunoreation meeting of adenovirus carrier itself application of adenovirus carrier vaccine is caused disadvantageous effect, and if adenovirus late protein hexon (Hexon), penton albumen (Penton) etc. are the autoimmune major antigens of carrier.Therefore a kind of reservation genome duplication ability suppresses the carrier system that the adenovirus late protein is expressed simultaneously, in the research of adenovirus carrier vaccine, has potential and is worth.We make up this carrier system through the strategy of deleted adenovirus IVa2 gene.

PAAV2neo-IVa2 is promotor with CMV, expresses the IVa2ORF total length.Behind this plasmid and pFG140-Δ IVa2 (1104) cotransfection HEK293 cell, obtained the recombinant adenovirus Ad5 Δ IVa2 (1104) of IVa2 genetically deficient.In order to reduce the possibility that reverse mutation produces wild poison, the IVa2ORF that the IVa2 gene order of pFG140-Δ IVa2 (1104) disappearance and pAAV2neo-IVa2 express has only an end homology.Ad5 Δ IVa2 (1104) does not detect the wild poison (not delivering data) that reverse mutation produces after repeatedly go down to posterity (more than 3 times) in the HEK93 of transfection pAAV2neo-IVa2 cell, explain that the probability of reverse mutation is very low.Recombinant virus through the PCR assay certificate in the desired location deletion mutantion IVa2 gene; Western blot detects the expression less than IVa2 after confirming that also Ad5 Δ IVa2 (1104) infects the HEK293 cell.Explain that the method that PCR practices shooting has lacked the IVa2 gene accurately, does not change the 26S Proteasome Structure and Function of infections clone pFG140 simultaneously.Recombinant virus Ad5 Δ IVa2 (1104) can only increase in the HEK293 of transfection pAAV2neo-IVa2 cell, shows that the recombinant virus that lacks IVa2 can not produce progeny virus, and the function of the effective trans-complementation IVa2 of the pAAV2neo-IVa2 that makes up ability.This case lays the foundation for the expression of our next step research recombinant adenovirus Ad5 Δ IVa2 (1104) late protein, the assembling of virion.

Concrete work comprises:

The PCR-targeting technological method based on the RED recombinase has been used in this case, this method is used for the transformation of adenoviral gene group.The characteristics of this method be on big genome, directly insert, delete, operation such as replacement, avoid the loaded down with trivial details process of subclone step by step.Adenoviral gene group plasmid pFG140/ Δ IVa2 and the pBHG Δ IVa2 that has successfully made up the IVa2 disappearance based on the PCR-targeting technological method of RED recombinase used in this case.The IVa2 gene is the intermediate gene (intermediate gene) of adenovirus in life cycle, and the IVa2 afunction is expressed by the late protein of adenovirus and viral genome is packaged into virion and is obstructed, but does not influence duplicating of adenoviral gene group.

From the adenoviral gene group, amplify 100K and IVa2 gene coded sequence, be inserted among the expression vector pAAV2neo, be built into pAAV2neo-IVa2 (Fig. 5) and pAAV2neo-100K (Figure 12 A).This part work purpose is that essential element is provided for the adenovirus of disappearance 100K or IVa2 gene is trans.Enzyme cuts evaluation (Figure 12 B) and sequencing analysis shows that structure is entirely true, transfection HEK293 cell, and G418 selects to cultivate the acquisition stable cell line.

For the cell strain that obtains stably express IVa2 gene as producing cell, the pAAV2neo-IVa2 transfection that we are made up adds the G418 screening and obtains HEK293-IVa2 to the HEK293 cell;

Accomplished 100K, the transfection of the structure of IVa2 expression plasmid, evaluation and HEK293 cell strain and the foundation of stable cell line.

Accomplished the structure of expression plasmid pPGK-E1AE1B and pPGK-E1A:

Structure has obtained expression E1a and E1aE1b expression of gene plasmid pPGK-E1AE1B and two plasmids of pPGK-E1A (Figure 13), enzyme cut identify and the sequencing analysis correct.For making up the replication type adenovirus carrier, we lay a good foundation.

Set up the HeLa/pGK-E1AE1B stable cell line:

PPGK-E1AE1B is imported the HeLa cell obtained the HeLa/pGK-E1AE1B stable cell line.Infect HeLa and HeLa/pGK-E1AE1B with the non-Ad5-EGFP that duplicates, visiblely behind the 2d on the HeLa/pGK-E1AE1B cell, see obvious CPE and change, and EGFP fluorescent brightness also obviously strong (Figure 14); After the Ad5-EGFP that duplicates infected the cell freezing-thawing and cracking after the HeLa/pGK-E1AE1B pathology, 0.22um filtered, and infected HeLa and HeLa/pGK-E1AE1B, and can see behind the 5d has obvious CPE to change (Figure 15) on the HeLa/pPGK-E1AE1B cell.Above result proves that the adenovirus carrier that the HeLa/pGK-E1AE1B cell can support E1 to lack property duplicates and pass poison; The adenovirus carrier packaging cell line of this new E1 disappearance for we set up in the future lays the foundation.

Through pFG140/ Δ IVa2 and pAAV2neo-IVa2 cotransfection HEK293 cell, obtained the recombinant adenovirus Ad5 Δ IVa2 (1104) of IVa2 disappearance; This recombinant virus Ad5 Δ IVa2 (1104) can not breed in normal HEK293 cell, and can only be in transfection increase in the HEK293 cell of pAAV2neo-IVa2.The result shows that the propagation of Ad5 Δ IVa2 (1104) virus of acquisition depends on the function that external source provides IVa2.

In order to obtain the adenovirus carrier of rf, E1 genetic expression unit PGK-E1-SV40polyA is inserted the adenoviral gene group, E3 district and former E1 district have successively been selected in the position of insertion; Reorganization obtains reproducible and atoxigenic adenovirus carrier and receives the miRNA regulation and control to duplicate or produce the adenovirus carrier of poison then.

Accomplished structure, the rescue of Ad5-CMV-EGFP-E1AE1B+ and Ad5-CMV-EGFP-E1A+ recombinant adenovirus, and the research of copy function:

E3 district (Figure 16) with pGK-E1AE1B and pGK-E1A insert the adenoviral gene group respectively obtains New Replication type adenoviral gene group plasmid pBHG-pGK-E1AE1B and pBHG-pGK-E1A (Figure 17).With the replication type adenovirus geneome plasmid that builds respectively with pDC-316-EGFP plasmid co-transfection HEK293 cell, save out Ad5-CMV-EGFP-E1AB+ and Ad5-CMV-EGFP-E1A+ virus (Figure 18).With adenovirus E3 district two ends dna sequence dna design primer, be the fragment (Figure 19) that template can amplify expection 3.8kb with the Ad5-CMV-EGFP-E1AE1B+ genome.Research shows that Ad5-CMV-EGFP-E1AE1B+ has self-replicating and produces malicious ability.This virus can in HeLa cell and A549 cell, duplicate and produce progeny virus (Figure 20, Figure 21); But " virulence " of virus obviously weakens, and reason is still waiting research, and the adenovirus carrier of this replicability possibly have better immune effect as vaccine carrier.

The E1A that has accomplished recombinant adenovirus Ad5-CMV-EGFP-E1AB+ expresses and identifies:

Recombinant adenovirus Ad5-CMV-EGFP-E1AB+ infects HeLa cell (MOI 5), harvested cell after 24 hours, cracking, Western blot proof has the expression (Figure 22) of E1A, one anti-for Ad5 E1A monoclonal antibody M58 (Abcam, ab76552).Simultaneously dl309 is infected the HeLa cell with replication defect type Ad5-CMV-EGFP with identical MOI, respectively as positive control and negative control.This experiment has also detected in the HeLa/pGK-E1AE1B stable cell line of the 3rd part structure; The proteic expression of E1A (Figure 22 swimming lane E) is also arranged; Though the expression amount of E1A is lower in the HeLa/pGK-E1AE1B cell strain, but still can support duplicating of replication-defective adenoviral.The evaluation of Western blot, strong proof duplicating of the recombinant adenovirus Ad5-CMV-EGFP-E1AB+ that makes up, be because the pGK-E1AE1B fragment of inserting causes.

The PCR-Targeting technology is used for knock out achieve success (Figure 23) of pFG140 adenoviral gene group plasmid IVa2 gene, order-checking correct (Figure 24).Show that the PCR-Targeting technology of being set up is successfully used to the transformation in any site of viral genome on the plasmid vector, for the directional transformation of big genomic viral carrier provides effective new technology.

Accomplished rescue and the evaluation of the recombinant adenovirus Ad5 Δ IVa2 (1104) of IVa2 genetically deficient:

With the recombinant plasmid pFG140-Δ IVa2 (1104) of adenovirus infection sex clone pFG 140 and disappearance IVa2 gene transfection HEK293 cell respectively, the former has obtained recombinant virus AdpFG140, but the latter do not observe recombinant virus generation (Figure 25 A, B).Behind pAAV2neo-IVa2 and pFG140-Δ IVa2 (1104) cotransfection HEK 293 cells, observe cytopathy (Figure 25 C).HEK293 cell freezing-thawing and cracking with pathology; Get the supernatant HEK293 cell of pAAV2neo-IVa2 plasmid that infected HEK293 and transfection respectively after centrifugal; The result only can observe cytopathy at the HEK293 cell of transfection pAAV2neo-IVa2 plasmid; (Figure 25 D E), explains to have obtained recombinant adenovirus Ad5 Δ IVa2 (1104) and do not occur pathology on the cell of untransfected.IVa2 two ends frame sequence design primer with disappearance carries out the PCR evaluation; AdpFG140 (adenovirus of IVa2 gene complete) can amplify the dna fragmentation of 1314bp; And the recombinant adenovirus Ad5 Δ IVa2 (1104) of IVa2 disappearance can only amplify the fragment (Figure 26) of 1089bp, accord with expectation.Ad5 Δ IVa2 (1104) and AdpFG140 are infected the HEK293 cell respectively, and the former detects the expression less than IVa2, and the latter then can detect (Figure 27).

Set up the HEK293-IVa2 stable expression cell strain:

PAAV2neo-IVa2 is imported the HEK293 cell, and the G418 screening has obtained the HEK293-IVa2 stable cell line.Behind recombinant virus Ad5 Δ IVa2 (1104) the infection HEK293-IVa2 cell with IVa2 genetically deficient, can observe cytopathy, but Ad5 Δ IVa2 (1104) infects the HEK293 cell, does not observe cytopathy.Explain that the HEK293-IVa2 cell can support the duplicating of recombinant adenovirus of IVa2 genetically deficient.

The shuttle plasmid pDC316-RFP-E1 (Fig. 7) and the pDC316-RFP-E1A (Figure 28) that contain E1 and E1A expression cassette have been made up.Made up the adenovirus skeleton plasmid pBHG Δ IVa2 (Figure 10) of IVa2 genetically deficient.

The IVa2 gene order of disappearance is 524 to 1627 bit sequences of IVa2 gene, altogether 1104bp.

The pAAV2neo-IVa2 carrier: pcr amplification pBHGlox (delta) E1, the 3Cre:5519-7146bp fragment is inserted among the pAAV2neo, increases the kozak sequence in the primer.Fig. 5 sees pAAV2-neo-IVa2 band kozak sequence.

PBHGlox (delta) E1,3Cre disappearance IVa2 gene removes the Kan expression cassette simultaneously, sees pBHG (delta) IVa2.

Make up the pGK-E1-SV40LpolyA expression cassette, Figure 13 B sees 18TS-pGK-E1-SV40LpA.

Description of drawings:

The genomic synoptic diagram of Fig. 15 type adenovirus.

The synoptic diagram of the gene of Fig. 2 pFG140.

The plasmid figure of Fig. 3 pAK.

Fig. 4 directly carries out the synoptic diagram of method of the accurate disappearance of IVa2 gene 11 40bp sequence on the adenoviral gene group based on the PCR target practice method of λ-RED recombinase system.

The plasmid figure of Fig. 5 pAAV2neo-IVa2.

The construction strategy of Fig. 6 IVa2 genetically deficient.A：Lane?1：pFG140-ΔIVa2(1104)，Lane?2：pFG140-ΔIVa2(1104)?digest?with?Swa?I，Lane?3：PCR?product?of?kanamycin?cassette，Lane?4：pFG140?digest?with?HindIII，Lane?5：pFG140-ΔIVa2(1104)digest?with?HindIII；B：sequencing?of?pFG140-ΔIVa2(1104)prove?the?deletion?of?IVa2

Fig. 7 pDC316-RFP-E1, the shuttle plasmid of band E1.Earlier transform the Pacl among the 18TS-pGK-E1-SV40LpA as NheI, be inserted into the XbaI enzyme cutting site of PDC316-RFP then.

The plasmid figure of Fig. 8 pFG140.

The plasmid figure of Fig. 9 pFG140/ Δ IVa2.PFG140/ Δ IVa2 is consistent with pFG140/ Δ IVa2 kan, and kan representes that this plasmid is the kalamycin resistance male.Δ is consistent with delta, representes the implication of this genetically deficient.PFG140 disappearance IVa2 gene, but also leave the Kan expression cassette, in pFG140 (delta) IVa2 Kan.This plasmid also is the plasmid that has gone out poison.

Figure 10 HindIII enzyme is cut the electrophorogram of the adenovirus skeleton plasmid pBHG Δ IVa2 that identifies IVa2 genetically deficient.1:pBHGlox (delta) E1,3Cre HindIII enzyme is cut; 2:pBGH Δ IVa2 (k) HindIII enzyme is cut; 3:pBGH Δ IVa2HindIII enzyme is cut; M:DL15000.

Figure 11 pDC316-RPF-E1 and pBHG cotransfection, the malicious spot of appearance.

Figure 12 pAAV2neo-100K, the structure of IVa2 and evaluation.Wherein, figure A is the plasmid construction figure of pAAV2neo-100K and/or pAAV2neo-IVa2.Figure B is pAAV2neo-100K, and the restriction enzyme digestion and electrophoresis of IVa2 is identified figure, and 1 swimming lane: pAAV2neo SmaI enzyme is cut; 2 swimming lanes: pAAV2neo-100K SmaI enzyme is cut evaluation; 3 swimming lanes: the pAAV2neo-IVa2SmaI enzyme is cut evaluation.

The structure iron of Figure 13 expression plasmid pPGK-E1AE1B and pPGK-E1A.Figure A is: pPGK-E1A is denoted as 18TS-pGK-E1A-SV40LPA among the plasmid figure; Figure B is: pPGK-E1AE1B is denoted as 18TS-pGK-E1-SV40LPA among the plasmid figure.

Figure 14 is non-, and the Ad5-EGFP that duplicates infects HeLa and HeLa/PGK-E1AE1B cell.Up figure is the HeLa cell, and last left side figure be a uninfecting virus, on neutralize that to go up right be common light microscopic and the fluorescent microscope of the non-Ad-EGFP that duplicates of infection.Descending figure is the HeLa/PGK-E1AE1B cell, and following left side figure is a uninfecting virus, and following neutralization is right down for infecting common light microscopic and the fluorescent microscope of the non-Ad-EGFP that duplicates.

Figure 15 Ad5-EGFP goes down to posterity HeLa and HeLa/pPGK-E1AE1B cell.

Figure 16 E1 gene inserts adenoviral gene group E3 district synoptic diagram.

The enzyme of Figure 17 pBHG-pGK-E1AE1B plasmid is cut evaluation.Lane 1:BamH I enzyme is cut evaluation; Lane 2:HindIII enzyme is cut evaluation.

The rescue of Figure 18 Ad5-CMV-EGFP-E1AB+ virus.

Figure 19 recombinant virus Ad5-CMV-EGFP-E1AB ⁺PCR identify.With adenovirus E3 district two ends dna sequence dna design primer, A: with Ad5-CMV-EGFP-E1AB ⁺Genome is a template, B: with replication defect type Ad5-CMV-EGFP genome is template.

Figure 20 Ad5-CMV-EGFP-E1AB ⁺In the HeLa cell, duplicate and go down to posterity.

Figure 21 Ad5-CMV-EGFP-E1AB ⁺Can in the A549 cell, duplicate.A:Ad5-CMV-EGFP-E1AB ⁺Infect the A549 cell, MOI 0.01; B: replication defect type Ad5-CMV-EGFP infects the A549 cell, and MOI 0.01.

Figure 22 Western blot identifies the expression of E1A.A:HEK 293 cells; B:Ad5-CMV-EGFP-E1AB ⁺Infect the HeLa cell; C: replication defect type Ad5-CMV-EGFP infects the HeLa cell; D:dl309 infects the HeLa cell; The E:HeLa/pGK-E1AE1B cell strain; The F:HeLa cell.

The enzyme of Figure 23 pFG140 Δ IVa2 (1104) is cut evaluation.A:pFG140 Δ IVa21#; B:pFG140 Δ IVa22#; C:pFG140 Δ IVa21#SwaI enzyme is cut; D:pFG140 Δ IVa2 2#SwaI enzyme is cut; E:Kan cassettePCR product; The F:pFG140HindIII enzyme is cut; G:pFG140 Δ IVa2 1#HindIII enzyme is cut; H:pFG140 Δ IVa22#SwaI enzyme is cut.

Figure 24 checks order proves that pFG140 Δ IVa2 has lacked the IVa2 gene in desired location.

The rescue (100 *) of Figure 25 recombinant virus Ad5 Δ IVa2 (1104).A:pFG140 transfection HEK293 cell; B:pFG140 Δ IVa2 (1104) transfection HEK29 cell; C:pAAV2neo-IVa2and pFG140-Δ IVa2 (1104) cotransfection HEK293 cell; D: the product of cell lysis of the HEK293 cell infection C of transfection pAAV2neo-IVa2; The product of cell lysis of E:HEK293 cell infection C.

The PCR of Figure 26 recombinant adenovirus Ad5 Δ IVa2 (1104) identifies.IVa2 two ends frame sequence design primer with disappearance.1: with adenovirus AdpFG140 genome is template, obtains the PCR product of 1314bp; 2: with adenovirus Ad5 Δ IVa2 (1104) genome is template (IVa2gene is deleted), obtains the PCR product of 1089bp.

Figure 27 Western blot detects the expression of IVa2.1:pAAV2neo-IVa2 transfection HEK293 cell; 2:AdpFG140 infects the HEK293 cell; 3:Ad5 Δ IVa2 (1104) infects the HEK293 cell; The 4:HEK293 cell.

Figure 28 pDC316-RFP-E1A plasmid figure.

Figure 29 E1 expression cassette is uploaded poison through the replication type adenovirus that pDC316 is inserted into the rescue of back, E1 district at the HeLa cell.

Following examples have been done detailed explanation to " a kind of IVa2 gene function disappearance recombinant adenoviral vector and preparation method " described in the present invention and detailed process thereof, but and do not mean that restriction content of the present invention.

Employed experiment material comprises in the implementation process of this case: carrier, bacterial strain, cell and reagent etc.Wherein, plasmid pET30a (+) is available from Novagen company, and pFG140 is available from Microbix company, and pDM18-T is available from Takara company, and the pAAV2-neo carrier is provided by Beijing slender acanthopanax and molecular medicine institute.Contain the intestinal bacteria BW25113 that expresses Red recombinase pIJ790 plasmid, be so kind as to give competence Electro MAX by German Tuebingen Bertolt doctor Gust of university ^TMDH10B is available from Invitrogen company.HEK 293 cells are cultivated with containing 10% foetal calf serum DMEM available from ATCC.The Pyrobest archaeal dna polymerase of Taq archaeal dna polymerase and high-fidelity is available from Takara company, and L-arabinose is available from Merck company, and various restriction endonucleases and T4 dna ligase are all available from NEB company.Primer synthesizes and order-checking is all accomplished in Invitrogen company.DNA purifying and glue reclaim test kit available from sky root company.PRO-PREP ^TMProtein extraction solution is available from the match Parkson.Transfection reagent Lipofactamine2000 is available from Invitrogen company.How anti-available from Abcam (ab21939) the IVa2 mouse is, and the sheep anti mouse two of IRDye 800 marks is anti-available from Rockland company.

The structure of embodiment 1 template plasmid pAK

At first made up universal pcr template plasmid pAK.A SwaI site has respectively been introduced at the two ends of kanamycin gene expression cassette in the pAK plasmid.This site can make things convenient for the excision of kantlex expression casette.Fig. 3 is a pcr template pAK structural representation.

With pET30a (+) carrier is template amplification kalamycin resistance gene expression cassette wherein, introduces Swa I restriction enzyme site (underscore sign) at its two ends through primer.

Primer sequence is: Kan_F and Kan_R.

Kan_F：5′- ATTTAAATACAATAAAACTGTCTGCT-3′

Kan_R：5′- ATTTAAATCTTAGAAAAACTCATCGA-3′

The pcr amplification condition is 94 ℃ of preparatory sex change 5min; 94 ℃ of 30s, 50 ℃ of 30s, 72 ℃ of 1min, 30 circulations; Last 72 ℃ are extended 10min.PCR product behind the purifying is connected with pMD18-T; Be converted into behind the intestinal bacteria DH10B with penbritin and the two screenings of kantlex; Obtain clone's called after pAK of two resistances, send the kalamycin resistance gene expression cassette of Invitrogen company sequencing analysis insertion and the Swa I restriction enzyme site of both sides.

Fig. 2 is seen in the acquisition of embodiment 2 pFG140-Δ IVa2 (1104)

After proving disappearance IVa2 gene with plasmid pFG140 (seeing Fig. 8, is an adenovirus infection sex clone, and the bacterial plasmid skeleton is inserted in the E1 gene), can save out recombinant adenovirus trans providing under the IVa2 function situation.The research relevant with pFG140 is a proof procedure, is not final invention product form.

The structure of the pFG140 (leaving the Kan expression cassette) of disappearance IVa2 gene is seen pFG140 (delta) IVa2 Kan.This plasmid also can be used for reorganization and produces adenovirus.

Particularly, be primer with Del_IVa2_F and Del_IVa2_R, carry out pcr amplification with the linearizing pAK plasmid of Xmn I as template, obtained to be used for the linear DNA fragment of target property disappearance IVa2 gene.Kanamycin gene in the fragment is used for the screening of recon, and the homology arm of 39bp has been introduced at two ends through primer.Go out recombinant clone (Fig. 4) with penbritin and kantlex pair resistance screenings after pFG140 and this linear DNA fragment successively be transformed into BW5113/pIJ790.Carry out enzyme with Swa I and HindIII and cut evaluation, pick out correct recon pFG140-Δ IVa2 (1104).The result shows, cuts pFG140-Δ IVa2 (1104) with Swa I enzyme and can cut out the 870bp fragment, and length conforms to the kanamycin gene clip size.With HindIII respectively the enzyme result that cuts pFG140 and pFG140-Δ IVa2 (1104) show that both banding patterns only have a bar segment size that notable difference (arrow indication band) is arranged, the former is for should be 3437bp, and the latter is 3212bp, conforms to expection.Order-checking is simultaneously identified and has been confirmed that adenovirus IVa2 is by kantlex expression cassette reorganization replacement (Fig. 6).

Particularly, be used for the preparation of the linear DNA fragment of target disappearance IVa2 gene:

Because 1 to 521 at 5 of IVa2 ' end is overlapping with 3 of E2B gene ' end, so the IVa2 gene order that we design disappearance is 524 to 1627 bit sequences.

Primer sequence is: Del_IVa2_F and Del_IVa2_R.

Del_IVa2_F：

5′- CTCTGTTTGGATTTGGATCAAGCAAGTGTCTTGCTGTCTATTTAAATACAATAAAACTG-3′

Del_IVa2_R：

5′- GCGAAACGAGGAGATATGCTGGATCGAGATGCCGTAGAGTATTTAAATCTTAGAAAA-3′

Every primer by the IVa2 dna homolog arm (underscore sign) of 39bp and 18 or 20bp and pAK DNA template on the complementary sequence of kalamycin resistance gene expression cassette both sides sequence form.With Xmn I linearizing pAK DNA is template obtains target disappearance IVa2 gene with PCR method linear DNA fragment.The PCR condition is: 94 ℃ of preparatory sex change 5min; 94 ℃ of 30s, 45 ℃ of 30s, 72 ℃ of 1min, 10 circulations; 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 1min, 20 circulations; Last 72 ℃ are extended 10min.PCR product glue reclaims purifying.

The homologous recombination of embodiment 3 λ-Red recombinase-mediated

Present embodiment has been introduced the process that knocks out IVa2 gene in the adenoviral gene group plasmid with the PCR-Targeting method.The fresh activatory BW25113/pIJ790 of picking mono-clonal, document is pressed in 30 ℃ of cultivations ^[8]Preparation electroreception attitude is transformed into (BioRad 0.2cm electricity revolving cup, 2.5kV, 200 Ω, 25 μ F) among the BW25113/pIJ790, coating LB dull and stereotyped (containing 25 μ g/mL paraxin, 100 μ g/mL penbritins), 30 ℃ of overnight cultures with the pFG140 electricity.Picking mono-clonal, adding final concentration are that the L-arabinose of 10mmol/L induces λ-Red recombinase to express, and 30 ℃ are cultured to OD ₆₀₀Be 0.4, press document ^[8]Preparation electroreception attitude, the PCR product electricity of getting behind the 100ng purifying goes to (BioRad 0.2cm electricity revolving cup, 2.5kV in the BW25113/pIJ790+pFG140 cell; 200 Ω, 25 μ F), coating LB is dull and stereotyped (to contain 50 μ g/mL kantlex; 100 μ g/mL penbritins), 37 ℃ of overnight cultures.The clone that the picking diameter is bigger, the alkaline lysis method of extracting plasmid.With the clone of plasmid size accord with expectation, Swa I and HindIII enzyme respectively cut evaluation.Enzyme is cut and is identified correct clone, the evaluation of further checking order.Flow process is seen Fig. 4.

Structure and the expression of embodiment 4IVa2 expression vector pAAV2neo-IVa2

For trans pFG140-Δ IVa2 (1104) is provided the IVa2 function of disappearance; The recombinant adenovirus of rescue IVa2 disappearance; Be primer amplification IVa2 ORF total length and be inserted in the pAAV2neo carrier with IVa2_F and IVa2_R, obtained the expression plasmid pAAV2neo-IVa2 (Fig. 5) of IVa2.Behind this plasmid transient transfection HEK293 cell 48h, detected the proteic expression of IVa2 (Figure 27) with Western blot method.Fig. 5 is the pAAV2neo-IVa2 structural representation.

The structure of pAAV2neo-IVa2 (band kozak sequence) carrier: pcr amplification pBHGlox (delta) E1, the 3Cre:5519-7146bp fragment is inserted among the pAAV2neo, increases the kozak sequence in the primer.The visible pAAV2-neo-IVa2 of Fig. 5 (band kozak sequence).

The primer sequence of pcr amplification:

IVa2_F：ATA GAATTCGCGCCACCATGGAAACCAGAGGTAAG(EcoR?I)

IVa2_R：GAT GTCGACTTATTTAGGGGTTTTGCG(Sal?I)

In addition, be template with pFG140, with IVa2_F-wo kozak and IVa2_R: with IVa2_R be the complete ORF of primer amplification IVa2 (not carrying the kozak sequence).

IVa2_F-wo?kozak：5′-ATA GAATTCGGCTCATGGAAACCAGAG-3′(EcoR?I)

IVa2_R：5′-GAT GTCGACTTATTTAGGGGTTTTGCG-3′(SalI)

IVa2_F-wo kozak is used to increase the upper reaches PCR primer of the IVa2 that do not carry the kozak sequence, and wo kozak is the meaning of not carrying the kozak sequence.

Be inserted in the expression vector pAAV2neo carrier through EcoR I and Sal I double digestion.Sma I enzyme is cut and is identified correct clone, the evaluation of checking order again.Clone's called after pAAV2neo-IVa2-wo kozak.

These 2 kinds of plasmids of pAAV2neo-IVa2 that makes up or pAAV2neo-IVa2-wo kozak transfection respectively obtain HEK293-IVa2 and HeLa-IVa2 cell and HEK293-IVa2-wo kozak and HeLa-IVa2-wo kozak cell to HEK293 and HeLa cell.The IVa2 gene function that is used for the trans-complementation disappearance.Wherein the existing E1 gene function of HEK293-IVa2 cell and HEK293-IVa2-wo kozak cell has the IVa2 gene function again; HeLa-IVa2 cell and HeLa-IVa2-wo kozak cell do not have the E1 gene function that the IVa2 gene function is only arranged.

The rescue and the evaluation of embodiment 5 recombinant viruses

With the recombinant plasmid pFG140-Δ IVa2 (1104) of adenovirus infection sex clone pFG140 and disappearance IVa2 gene transfection HEK293 cell respectively, the former has obtained recombinant virus AdpFG140, but the latter do not observe recombinant virus generation (Figure 25 A, B).Explain that the IVa2 gene is essential for producing recombinant virus.

Behind pAAV2neo-IVa2 and pFG140-Δ IVa2 (1104) cotransfection HEK 293 cells, observe cytopathy (Figure 25 C), obtained recombinant virus Ad5 Δ IVa2 (1104).The HEK293 cell freezing-thawing and cracking of pathology; Get the supernatant HEK293 cell of pAAV2neo-IVa2 plasmid that infected HEK293 and transfection respectively after centrifugal; The result only can observe cytopathy at the HEK293 cell of transfection pAAV2neo-IVa2 plasmid; And do not occur on the cell of untransfected pathology (Figure 25 D, E).The successfully trans function that the IVa2 of pFG140-Δ IVa2 (1104) disappearance is provided of pAAV2neo-IVa2 is described, and recombinant virus Ad5 Δ IVa2 (1104) in transfection can effectively duplicate on the HEK293 cell of pAAV2neo-IVa2 plasmid.

Particularly, with pFG140-Δ IVa2 (1104) and pAAV2neo-IVa2 with the Lipofactamine2000 cotransfection to HEK 293 cells, per 2～3d changes liquid 1 time, until observing viral plaque and cytopathy.As negative control, pFG140 transfection HEK293 cell is as positive control with pFG140-Δ IVa2 (1104) and pAAV2neo cotransfection HEK 293 cells.The viral nomenclature of positive control rescue is AdpFG140.Fig. 5 is the rescue (100 *) of recombinant virus Ad5 Δ IVa2 (1104).

The PCR of the rescue of recombinant virus identifies: IVa2 two ends frame sequence design primer delIVa2_F and delIVa2_R with disappearance carry out the PCR evaluation; AdpFG140 (adenovirus of IVa2 gene complete) can amplify the dna fragmentation of 1314bp; And the recombinant adenovirus Ad5 Δ IVa2 (1104) of IVa2 disappearance can only amplify the fragment (Figure 26) of 1089bp, accord with expectation.Ad5 Δ IVa2 (1104) and AdpFG140 are infected the HEK293 cell respectively, and the former detects the expression less than IVa2, and the latter then can detect (Figure 27).The PCR of Fig. 6 recombinant adenovirus Ad5 Δ IVa2 (1104) identifies.Figure K is the expression that Western blot detects IVa2.

delIVa2_F：5′-ATGTCGTTTCTCAGCAGCTG-3′

delIVa2_R：5′-CTACTGCCGTACAGCGAAA-3′

The evaluation of recombinant virus:

PCR identifies: the cell freeze thawing of generation pathology 3 times, the centrifugal 2min of 2000rpm, supernatant 0.22 μ m membrane filtration.Get 500 μ L virus liquid, the DNase I that adds 100U handled 30 minutes for 37 ℃, added 50 ℃ of digestion of Proteinase K (final concentration 100ug/mL) 1h then, the extracting of phenol chloroform, ethanol sedimentation, last 50 μ L TE (pH 7.9) dissolving.Getting the viral genome that 2 μ L extract is template, as primer, carries out the PCR evaluation with IVa2 deletion fragment two ends delIVa2_F and delIVa2_R, and the PCR condition is: 94 ℃ of preparatory sex change 5min; 94 ℃ of 30s, 50 ℃ of 30s, 72 ℃ of 75s, 30 circulations; Last 72 ℃ are extended 10min.

delIVa2_F：5′-ATGTCGTTTCTCAGCAGCTG-3′

delIVa2_R：5′-CTACTGCCGTACAGCGAAA-3′

Western blot identifies: will infect the cell after recombinant adenovirus or the transfection, and use PRO-PREP ^TMProtein extract extracting albumen, 12% polyacrylamide gel carries out the SDS-PAGE electrophoresis; After electrophoresis finished, the 100mA constant current changeed film 1h, 5% skimmed milk room temperature sealing 1 hour down; The IVa2 mouse is resisted dilution in 1: 1000 more, 4 ℃ of degree incubated overnight; PBST washing 3 times, the sheep anti mouse two that adds IRDye 800 marks of dilution in 1: 5000 resists, room temperature lucifuge reaction 1h; PBST lucifuge washing 3 times, thieving paper blots liquid on the film, carries out infrared scan with Odyssey IR fluorescence scanning imaging system.

The structure of embodiment 6pBHG Δ IVa2

Knock out adenoviral gene group plasmid pBHGlox (delta) E1, the IVa2 gene among the 3Cre with the PCR-Targeting method.Detailed process is consistent with embodiment 3.At pBHG loxp (delta) E3, the last disappearance of 1Cre is fallen IVa2 gene (1140bp), obtains pBHG Δ IVa2-Kan; PBHGlox (delta) E1,3Cre disappearance IVa2 gene removes the Kan expression cassette simultaneously, sees pBHG Δ IVa2.

The HindIII enzyme is cut and is identified that pBHG delta IVa2 sees Figure 10, and among the figure, 1:pBGH HindIII enzyme is cut, and 2:pBGHdeltaIVa2-kan HindIII enzyme is cut, and 3:pBGHdeltaIVa2 HindIII enzyme is cut M:DL15000.The implication of Δ is consistent with delta.

The unitary structure of embodiment 7 adenovirus E 1 genetic expressions

At first be on the pT-simple carrier, to make up four restriction enzyme site Pac I-BamHI-XhoI-NheI, its PCR primer is:

PBXN_F： TTAATTAAgca GGATCCagt CTCGAGtga GCTAGCa(Pac?I-BamH?I-Xho?I-Nhe?I)

PBXN_R：GCTAGCTCACTCGAGACTGGATCCTGCTTAATTAAA

Amplification then: 3 fragments such as PGK promoter, SV40LpolyA and E1 gene.

The template of SV40LpolyA is pGL4.14 [luc2/Hygro], and the purpose fragment of amplification is that length is the fragment of 222bps between the 1787-2008bp;

The template of E1 gene is pXC1, and the purpose fragment of amplification is that length is the fragment of 30522bps between the 458-3509bp;

Their employed PCR primer sequences are distinguished as follows:

The primer of PGK promoter:

pGK_F：CTC TTAATTAACCATCGAATTCTACCGGG(Pac?I)

pGK_R：TAT GGATCCTCGACGAATTCGGTACC(BamHI)

The primer of SV40LpolyA:

SV40Late_pA_F：GAC CTCGAGCAGACATGATAAGATAC(XhoI)

SV40Late_pA_R：CTT GCTAGCTACCACATTTGTAGAGG(NheI)

The primer of E1 gene:

E1_F：AGT GGATCCCGTGTAGTGTATTTATACC(BamHI)

E1_R：AGT CTCGAGCTCAATCTGTATCTTCAT(XhoI)

Then PGK promoter, E1 gene, SV40LpolyA are inserted wherein, make up the PGK-E1-SV40LpolyA expression cassette as E1 genetic expression unit, Figure 13 A sees 18TS-pGK-E1-SV40LpA.

Embodiment 8 inserts the E1 genetic expression unit of manual work design in the adenoviral gene group

The E1 genetic expression unit of manual work design is inserted in the adenoviral gene group, 2 kinds of strategies is arranged:

1) on shuttle plasmid pDC316, adds artificial constructed E1 genetic expression unit (PGK promotor-E1AE1B-SV40polyA).The original exogenous gene expression unit (mCMV promoter-MCS-SV40polyA) of this plasmid still keeps, and can be used for inserting foreign gene such as red fluorescent protein RFP.

2) at pBHGloxp (delta) E3, the E3 of 1Cre disappearance is inserted E1 genetic expression unit (PGK promotor-E1AE1B-SV40 polyA) on the position.

Embodiment 9 reproducible atoxigenic adenovirus systems are set up

Final reproducible atoxigenic adenovirus system is formed has 2 cover systems, and they all can carry out the preparation of described virus packing respectively:

First cover system comprises following 3 key elements composition:

1) viral packing cell (comprising but be not limited to the HeLa-IVa2 cell);

2)pBHGΔIVa2；

3) pDC316-MCS-(PGK-E1-polyA) (E1 expresses the unit and is inserted in former E1 district).

In this cover system, the E1 expression cassette is inserted into former E1 district through pDC316, and the replication type adenovirus of saving after 3 key element actings in conjunction of this system is uploaded poison at the HeLa cell.

Second cover system comprises following 3 key elements composition:

1) viral packing cell (comprising but be not limited to the HeLa-IVa2 cell);

2)pBHGΔIVa2(PGK-E1-polyA)；

3) pDC316 (E1 expresses the unit and is inserted in former E3 district).

In this cover system, the E1 expression cassette is inserted into former E3 district through pDC316, and the replication type adenovirus of saving after 3 key element actings in conjunction of this system is uploaded poison at the HeLa cell.

The shuttle plasmid of band E1, Fig. 7 sees pDC316-RFP-E1.Earlier transform the PacI among the 18TS-pGK-E1-SV40LpA (seeing Figure 13 B) as NheI, be inserted into the XbaI enzyme cutting site of PDC316-RFP then.

Figure 11 is pDC316-RPF-E1 and pBHG cotransfection, the malicious spot of appearance.

Reference:

[1]Tatsis?N，Ertl?H?C.Adenoviruses?as?vaccine?vectors[J].Mol?Ther，2004，10(4)：616-29.

[2]Prem?S.Adenoviruses：Basic?biology?to?gene?therapy[M].U?S?A：R.G.landes?company，1999：91-101.

[3]Robert-Guroff?M.Replicating?and?non-replicating?viral?vectors?for?vaccine?development[J].Curr?Opin?Biotechnol，2007，18(6)：546-56

[4]Flint?S?J.Regulation?of?adenovirus?mRNA?formation[J].Adv?Virus?Res，1986，31：169-228

[5]Lutz?P，Kedinger?C.Properties?of?the?adenovirus?IVa2?gene?product，an?effector?oflate-phase-dependent?activation?of?the?major?late?promoter[J].J.Virol，1996，70：1396-1405.

[6]Tribouley?C，Lutz?P，Staub?A，et?al.The?product?of?the?adenovirus?intermediate?geneIVa2?is?a?transcriptional?activator?of?the?major?late?promoter[J].J?Virol，1994；68(7)：4450-4457

[7]Zhang?W，Imperiale?M?J.Requirement?of?the?adenovirus?IVa2?protein?for?virusassembly[J].J?Virol，2003，77(6)：3586-94

[8]Gust?B，Challis?GL，Fowler?K，et?al.PCR-targeted?Streptomyces?gene?replacementidentifies?a?protein?domain?needed?for?biosynthesis?of?the?sesquiterpene?soil?odorgeosmin[J].Proc?Natl?Acad?Sci?U?S?A，2003，100(4)：1541-6

[9]Jones?N，Shenk?T.Isolation?of?adenovirus?type?5?host?range?deletion?mutants?defectivefor?transformation?of?rat?embryo?cells[J].Cell，1979，17：683-689.

[10]Lorenz，M?G，Wackernagel?W.Bacterial?gene?transfer?by?natural?genetictransformation?in?the?environment[J].Microbiol?Mol?Biol?Rev，1994，58(3)：563-602

[11]Murphy，K.C.Use?of?bacteriophageλrecombination?functions?to?promote?genereplacement?in?escherichia?coli[J].J.Bacteriol，1998，180(8)：2063-2071.

[12]Datsenko?K?A，Wanner?B?L.One-step?inactivation?of?chromosomal?genes?inEscherichia?coli?K-12?using?PCR products[J].Proc?Natl?Acad?Sci?U?SA.2000，97(12)：6640-5.

[13]Gust?B，Challis?G?L，Fowler?K，et?al.PCR-targeted?Streptomyces?gene?replacementidentifies?a?protein?domain?needed?for?biosynthesis?of?the?sesquiterpene?soil?odorgeosmin[J].Proc?Natl?Acad?Sci?U?S?A，2003，100(4)：1541-6

[14]Lung?O?Y，Cruz-Alvarez?M，Blissard?G?W.Ac23，an?envelope?fusion?protein?homologin?the?baculovirus?Autographa?californica?multicapsid?nucleopolyhedrovirus，is?a?viralpathogenicity?factor[J].J?Virol.，2003，77(1)：328-39.

Claims (6)

1. the invention describes a kind of reproducible atoxigenic adenovirus system.

2. according to claim 1, in this reproducible atoxigenic adenovirus system, adenovirus has lacked the major part (1140bp) of IVa2 gene, makes virus can not produce progeny virus.

3. according to claim 1, on the basis of original E1 and E3 genetically deficient, (E1A E1B) expresses the unit, makes virus obtain the genome duplication ability to insert artificial constructed E1 gene.

4. according to claim 1, reproducible atoxigenic adenovirus carrier packaging system, wherein a kind of form are that 3 key elements that constitute this system are: the HeLa-IVa2 cell; PBHG Δ IVa2; PDC316-MCS-(PGK-E1-polyA) (E1 expresses the unit and is inserted in former E1 district).

5. according to claim 1, reproducible atoxigenic adenovirus carrier packaging system, wherein a kind of form are that 3 key elements that constitute this system are: HeLa-IVa2 cell, pBHG Δ IVa2 (PGK-E1-polyA), pDC316 (E1 expresses the unit and is inserted in former E3 district).

6. purposes is vaccine carrier and therapy of tumor, and characteristics are to reach the more effect of high dosage with less dosage, reduces the immunoreation to carrier.

Images