CN102732432B - Aspergillus niger and application thereof to microbial preparation of (R)-epoxy azidopropane - Google Patents

Aspergillus niger and application thereof to microbial preparation of (R)-epoxy azidopropane Download PDF

Info

Publication number
CN102732432B
CN102732432B CN 201210189253 CN201210189253A CN102732432B CN 102732432 B CN102732432 B CN 102732432B CN 201210189253 CN201210189253 CN 201210189253 CN 201210189253 A CN201210189253 A CN 201210189253A CN 102732432 B CN102732432 B CN 102732432B
Authority
CN
China
Prior art keywords
epoxy
aspergillus niger
application
nitrine
propane
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN 201210189253
Other languages
Chinese (zh)
Other versions
CN102732432A (en
Inventor
朱勍
陈林
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhejiang University of Technology ZJUT
Original Assignee
Zhejiang University of Technology ZJUT
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhejiang University of Technology ZJUT filed Critical Zhejiang University of Technology ZJUT
Priority to CN 201210189253 priority Critical patent/CN102732432B/en
Publication of CN102732432A publication Critical patent/CN102732432A/en
Application granted granted Critical
Publication of CN102732432B publication Critical patent/CN102732432B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Abstract

The invention provides a novel strain Aspergillus niger 208 for preparing optically pure (R)-epoxy azidopropane and application thereof to microbial preparation of (R)-epoxy azidopropane. The bacterial strain is preserved in China Center for Type Culture Collection at the address of Wuhan University, Wuhan, China; and the zip code is 430072. The preserved date is May 9, 2012; and the preservationnumber is CCTCC NO:M 2012163. The invention provides a novel strain with stereoselectivity, which can be applied to preparation of (R)-epoxy azidopropane with high optical purity; and the invention provides research basis for diversity and reaction mechanism of chiral resolution microbe.

Description

Aspergillus niger and the application in microorganism preparation (R)-epoxy nitrine propane thereof
(1) technical field
The present invention relates to the new bacterial strain of a strain---aspergillus niger (Aspergillus niger) 208, and the application in microbial method preparation (R)-epoxy nitrine propane.
(2) background technology
The chemical structure of epoxy nitrine propane is:
Figure BDA00001730209100011
Racemic epoxy nitrine propane is made up of (R)-epoxy nitrine propane and (S)-two enantiomorphs of epoxy nitrine propane.
Epoxy nitrine propane is more stable in water, can substitute epoxy chloropropane, is a kind of very useful medicine intermediate.(R)-epoxy nitrine propane is the crucial chiral intermediate of synthetic L-carnitine and oxazolidone compounds.The L-carnitine can promote the decomposition of fat, plays an important role in the metabolism of longer chain fatty acid.The oxazolidone compounds is a kind of novel antiseptic-germicide, by suppressing the synthetic fungistatic effect that reaches of bacterioprotein, is used for the treatment of the G of anti-multiple medicine +, G -Anerobe and mycobacterium tuberculosis infection demonstrate fabulous prospect.
Utilize traditional chemical method to prepare the epoxide of chirality, need to add a large amount of solvents and expensive metal catalyst in the reaction, environment is caused great harm.The epoxide that biological process prepares chirality has reaction conditions gentleness, stereoselectivity height, advantages of environment protection.At present, the bibliographical information biological process prepares optically pure epoxy nitrine propane and has only following a kind of: (Tetrahedron:Asymmetry such as Jeffrey H, 15,2004, be substrate by epoxy chloropropane 1095-1102), use the method for Dynamic Kinetic Resolution, using halogenohydrin dehalogenation enzyme is the epoxy nitrine propane that catalyzer has obtained chirality.
(3) summary of the invention
The present invention seeks to for the new bacterial strain of a strain for the preparation of optical purity (R)-epoxy nitrine propane---aspergillus niger (Aspergillus niger) 208 is provided, and the application in microbial method preparation (R)-epoxy nitrine propane.
The technical solution used in the present invention is:
Aspergillus niger (Aspergillus niger) 208 is preserved in Chinese typical culture collection center, the address: China, Wuhan, Wuhan University, postcode 430072, preservation date on May 9th, 2012, deposit number CCTCC NO:M 2012163.
The colonial morphology of this bacterial strain: cultivate 72h for 30 ℃, the bacterium colony on the Cha Shi plate culture medium is rounded, diameter 2cm.In this process, colony colour is deepened gradually by initial white, becomes black.Bacterium colony and substratum are fitted loose, surface irregularity, middle fine and close, and the edge is rarer, the fine hair shape.
Comparing of the sequence of the sequence of the 18S rDNA of this bacterial strain and the 18S rDNA among the NCBI finds to have with aspergillus niger the homology of 98% sequence, and the 18S rDNA partial nucleotide sequence of this bacterial strain is as follows:
CGAGTGCTGCTACTGATCCGAGGTCACCTGGAAGAATGGTTGGAAAACGTCGGCAGGCGCCGGCCAATCCTACAGAGCATGTGACAAAGCCCCATACGCTCGAGGATCGGACGCGGTGCCGCCGCTGCCTTTCGGGCCCGTCCCCCCGGAGAGGGGGACGGCGACCCAACACACAAGCCGGGCTTGAGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACTGAATTCTGCAATTCACATTAGTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTTTTAACTGATTGCATTCAATCAACTCAGACTGCACGCTTTCAGACAGTGTTCGTGTTGGGGTCTCCGGCGGGCACGGGCCCGGGGGGCAGAGGCGCCCCCCCGGCGGCCGACAAGCGGCGGGCCCGCCGAAGCAACAGGGTACAATAGACACGGATGGGAGGTTGGGCCCAAAGGACCCGCACTCGGTAATGATCCTTCCGCAGGTACCCTTACGGAA。
Its phylogenetic tree as shown in Figure 1.Comprehensive The above results, this bacterial strain is accredited as aspergillus niger Aspergillus niger.
Microorganism involved in the present invention is to obtain by following program screening:
(1) soil sample that all parts of the country are adopted back is inoculated in the enrichment medium, at 30 ℃, cultivates 4 days on the shaking table of 200rpm, gets the 1mL nutrient solution and is inoculated in the new enrichment medium, cultivates 4 days again.The prescription of enrichment medium following (final concentration): Zulkovsky starch 0.1 ~ 0.5g/L, Semen Maydis powder 0.1 ~ 0.5g/L, K 2HPO 43H 2O 0.2 ~ 1g/L, KH 2PO 40.1 ~ 0.5g/L, NaCl2 ~ 10g/L, MgSO 47H 2O 0.1 ~ 1g/L, solvent are water, and pH 6 ~ 8, the bottled 100mL of 500mL triangle, and 121 ℃ of sterilization 20min are with the epoxy nitrine propane of preceding adding 1 ~ 5g/L.
(2) will be applied on the plate culture medium after the nutrient solution dilution of secondary enrichment, picking list bacterium colony is to slant preservation.Plate culture medium is the solid czapek's solution.
(3) picking list colony inoculation is to fermention medium, component following (final concentration): Zulkovsky starch 5 ~ 30g/L, analysis for soybean powder 5 ~ 20g/L, K 2HPO 43H 2O 0.2 ~ 1g/L, KH 2PO 40.1 ~ 0.5g/L, MgSO 47H 2O 0.1 ~ 1g/L, NaCl 2 ~ 10g/L, pH 6 ~ 8(121 ℃ of sterilization 20min); 25 ~ 40 ℃, 200rpm shaking culture 48 ~ 96 hours.
(4) centrifugal collection thalline, take by weighing the 1g wet thallus and be suspended in 10mL potassium phosphate buffer (0.1M, pH7.0) in, 100 μ L substrate mixed solutions join in the above-mentioned suspension 30 ℃, after 200rpm transforms 12h, 10000rpm is centrifugal, gets upper strata water 200 μ L and joins in the liquid phase bottle, adds 1.5mL AG methyl alcohol again, with reversed-phased high performace liquid chromatographic bacterial strain that qualitative detection is sieved whether the epoxide hydrolase activity is arranged, namely whether have corresponding glycol to produce.
Reversed-phased high performace liquid chromatographic: C18 chromatographic column, moving phase are that (60/40V/V, 1.0mL/min), the detection wavelength is 219nm to methanol.
(5) the epoxide hydrolase inoculation that obtains by aforesaid method is carried out multiple sieve to fermention medium, and transforms under these conditions; Detect the enantioselectivity of bacterial strain with chirality positive high performance liquid chromatography.
Chirality positive high performance liquid chromatography testing conditions: Waters high performance liquid chromatograph, chiral column AS-H(46cm * 25cm, 4 μ m, Daicel CHIRALPAK), moving phase is that (90/10V/V, 0.8mL/min), the detection wavelength is 219nm to normal hexane/Virahol.Substrate e.e. sCalculation formula: e.e. s(%)=(R-S)/(R+S) * 100%, wherein, R is the content of R type epoxy nitrine propane, and S is the content of S type epoxy nitrine propane.
The invention still further relates to the application of described aspergillus niger 208 in microbial method preparation (R)-epoxy nitrine propane.
Concrete, described being applied as: being substrate with racemation epoxy nitrine propane, is catalyzer with the wet thallus cell of aspergillus niger 208, under 25 ~ 40 ℃, reacts in the damping fluid of pH 6.0 ~ 8.4 1 ~ 12 hour, makes described (R)-epoxy nitrine propane.
Preferably, in the described damping fluid, the starting point concentration of aspergillus niger 208 wet thallus cells is 100 ~ 1000g/L, and the starting point concentration of substrate racemation epoxy nitrine propane is 0.1 ~ 20g/L.
Described damping fluid is the conventional damping fluid that is applicable to microbial transformation, is preferably one of following: phosphate buffered saline buffer, Tris-HCl damping fluid, barbitol buffer solution.
Preferably, also be added with the solubility promoter that volume is damping fluid volume 5 ~ 20% in the described damping fluid, described solubility promoter is one of following: (1) dimethyl sulfoxide (DMSO), (2) acetone, (3) N, dinethylformamide, (4) diazole alkane, (5) tetrahydrofuran (THF).
Described aspergillus niger 208 wet thallus cells can obtain after routine is applicable to the culture medium culturing of aspergillus niger, specifically can prepare as follows: the final concentration of substratum is formed: Zulkovsky starch 5 ~ 30g/L, analysis for soybean powder 5 ~ 20g/L, K 2HPO 43H 2O 0.2 ~ 1g/L, KH 2PO 40.1 ~ 0.5g/L, MgSO 47H 2O 0.1 ~ 1g/L, NaCl 2 ~ 10g/L, solvent are water, pH 6 ~ 8; 208,25 ~ 40 ℃ of above-mentioned culture medium inoculated aspergillus nigers, 100 ~ 200rpm shaking culture 48 ~ 96 hours, medium centrifugal is got precipitation and is washed through physiological saline, collects to obtain described aspergillus niger 208 wet thallus cells.
The slant medium of bacterial strain and seed culture medium are formed (final concentration): sucrose 30g/L, agar 15～20g/L, NaNO 32g/L, K 2HPO 43H 2O 1g/L, KCl 0.5g/L, MgSO 47H 2O0.5g/L, FeSO 47H 2O 0.01g/L, solvent are water, pH nature, 121 ℃ of sterilization 20min.
Concrete, described application can be as follows:
(1) final concentration that produces the enzyme substratum is formed: Zulkovsky starch 15.23g/L, analysis for soybean powder 10.88g/L, K 2HPO 43H 2O 0.8g/L, KH 2PO 40.4g/L, MgSO 47H 2O 0.98g/L, NaCl10g/L, solvent are water, pH 7; Shake bottled liquid measure 30%, inoculated aspergillus niger 208, in 30 ℃, 200rpm shaking culture 72h, will be centrifugal through the physiological saline washing in thalline, collect the wet thallus cell;
(2) get the phosphate buffered saline buffer of 100mM pH 7.2, the wet thallus cell that adds step (1) gained is 1000g/L to cell concn, and the racemic epoxy nitrine of adding substrate propane to concentration of substrate is 10g/L, 30 ℃ of water bath with thermostatic control shaking tables oscillatory reaction 10 hours, reaction is centrifugal with reaction solution after finishing, get supernatant liquor, add isopyknic n-hexane extraction, obtain (R)-epoxy nitrine propane.
Beneficial effect of the present invention is mainly reflected in: the invention provides and a kind ofly have stereoselectivity, can prepare high optical purity (R)-novel bacterial of epoxy nitrine propane; The present invention provides the foundation for the diversity of the microorganism of chiral separation and the research of reaction mechanism thereof.
(4) description of drawings
Fig. 1 is bacterial strain phylogenetic tree of the present invention.
(5) embodiment
The present invention is described further below in conjunction with specific embodiment, but protection scope of the present invention is not limited in this:
Embodiment 1: the separation of bacterial strain
Produce the separation of epoxide hydrolase bacterium: take by weighing 1g soil in the 100mL sterilized water, add some granulated glass spherees again, fully make soil suspension after the vibration, get the 1mL supernatant liquor in the 100ml enrichment medium, shaking culture is 4 days on 30 ℃, 200rpm shaking table.Draw in the new enrichment medium of 1mL nutrient solution adding and continue as stated above to cultivate 4 days, rule respectively then to bacterium and mould plate culture medium, obtain single bacterium colony.
Enrichment medium (final concentration): Zulkovsky starch 0.1g/L, Semen Maydis powder 0.1g/L, K 2HPO 43H 2O 0.8g/L, KH 2PO 40.4g/L, NaCl 0.5g/L, MgSO 47H 2O 0.5g/L, the bottled 100mL of 500mL triangle, solvent are water, 7.6,121 ℃ of sterilizations of pH 20min is with the epoxy nitrine propane of preceding adding 2g/L.
After the two-wheeled screening, with the enantiomeric excess value (e.e. value) of chiral hplc detection chiral epoxy nitrine propane, the e.e. value of described aspergillus niger 208 is 95%.
Embodiment 2: the cultivation of bacterial strain
Mould flat board and slant medium are formed (final concentration): sucrose 30g/L, agar 15～20g/L, NaNO 32g/L, K 2HPO 43H 2O 1g/L, KCl 0.5g/L, MgSO 47H 2O 0.5g/L, FeSO 47H 2O 0.01g/L, pH nature, 121 ℃ of sterilization 20min.
Picking aspergillus niger 208 is seeded to the inclined-plane on flat board, and 30 ℃ of thermostat containers are cultivated 2～3d, and the line of picking list bacterium colony is taken out to put in 4 ℃ of refrigerators behind 30 ℃ of thermostat containers cultivation 3d and preserved to corresponding bacterium and mould inclined-plane.
Embodiment 3: the acquisition of wet thallus cell
Substratum preparation: Zulkovsky starch 15g/L, analysis for soybean powder 8g/L, K 2HPO 43H 2O 0.8g/L, KH 2PO 40.4g/L, KCl 0.5g/L, MgSO 47H 2O 0.5g/L, pH 7.0, the bottled 100mL of 500mL triangle, 121 ℃ of sterilization 20min;
Inoculation one ring aspergillus niger 208 is in 30 ℃, 200rpm shaking table shaking culture 3d; Cultivation end secondary fermentation liquid is centrifugal and use the physiological saline washed twice, collects the wet thallus cell, is suspended in the phosphoric acid buffer of 100mM, pH 7.6, gets wet thallus cell, standby.
Embodiment 4: the acquisition of wet thallus cell
Substratum preparation: Zulkovsky starch 15g/L, analysis for soybean powder 10g/L, K 2HPO 43H 2O 0.8g/L, KH 2PO 40.4g/L, KCl 0.5g/L, MgSO 47H 2O 0.5g/L, pH 6.0, the bottled 100mL of 500mL triangle, 121 ℃ of sterilization 20min;
Inoculation one ring aspergillus niger 208 is in 35 ℃, 200rpm shaking table shaking culture 3d; Cultivation end secondary fermentation liquid is centrifugal and use the physiological saline washed twice, collects the wet thallus cell, is suspended in the phosphoric acid buffer of 100mM, pH 7.0, gets wet thallus cell, standby.
Embodiment 5:
In the phosphate buffered saline buffer of 10mL, 100mM (pH 7.2), add 2g embodiment 3 gained wet thallus cells; Add the racemic epoxy nitrine of 20mg propane as substrate, in 30 ℃ of water bath with thermostatic control shaking tables oscillatory reaction 10 hours, reaction solution was centrifugal, get supernatant liquor, through isopyknic n-hexane extraction, the e.e. value of product (R)-epoxy nitrine propane is 93.4%, and transformation efficiency is 74%.
Embodiment 6:
In the phosphate buffered saline buffer of 10mL, 100mM (pH 7.2), add 0.5g embodiment 3 gained wet thallus cells; Add the racemic epoxy nitrine of 10mg propane as substrate, in 35 ℃ of water bath with thermostatic control shaking tables oscillatory reaction 10 hours, reaction solution was centrifugal, get supernatant liquor, through isopyknic n-hexane extraction, the e.e. value of product (R)-epoxy nitrine propane is 80%, and transformation efficiency is 71%.
Embodiment 7:
In the phosphate buffered saline buffer of 10mL, 100mM (pH 7.2), add 0.3g embodiment 3 gained wet thallus cells; Add the racemic epoxy nitrine of 10mg propane as substrate, in 40 ℃ of water bath with thermostatic control shaking tables oscillatory reaction 10 hours, reaction solution was centrifugal, get supernatant liquor, through isopyknic n-hexane extraction, the e.e. value of product (R)-epoxy nitrine propane is 56%, and transformation efficiency is 60%.
Embodiment 8:
In the phosphate buffered saline buffer of 10mL, 100mM (pH 7.2), add 0.5g embodiment 4 gained wet thallus cells; Add the racemic epoxy nitrine of 20mg propane as substrate, in 30 ℃ of water bath with thermostatic control shaking tables oscillatory reaction 12 hours, reaction solution was centrifugal, get supernatant liquor, through isopyknic n-hexane extraction, the e.e. value of product (R)-epoxy nitrine propane is 97.7%, and transformation efficiency is 82%.
Embodiment 9:
In the phosphate buffered saline buffer of 10mL, 100mM (pH 7.2), add 0.5g embodiment 4 gained wet thallus cells; Add the racemic epoxy nitrine of 10mg propane as substrate, in 30 ℃ of water bath with thermostatic control shaking tables oscillatory reaction 8 hours, reaction solution was centrifugal, get supernatant liquor, through isopyknic n-hexane extraction, the e.e. value of product (R)-epoxy nitrine propane is 89%, and transformation efficiency is 71.5%.
Embodiment 10:
In the phosphate buffered saline buffer of 10mL, 100mM (pH 6.8), add 0.5g embodiment 4 gained wet thallus cells; Add the racemic epoxy nitrine of 20mg propane as substrate, in 30 ℃ of water bath with thermostatic control shaking tables oscillatory reaction 10 hours, reaction solution was centrifugal, get supernatant liquor, through isopyknic n-hexane extraction, the e.e. value of product (R)-epoxy nitrine propane is 71%, and transformation efficiency is 66.5%.
Embodiment 11:
In the phosphate buffered saline buffer of 10mL, 100mM (pH 7.6), add 0.5g embodiment 4 gained wet thallus cells; Add the racemic epoxy nitrine of 20mg propane as substrate, in 30 ℃ of water bath with thermostatic control shaking tables oscillatory reaction 10 hours, reaction solution was centrifugal, get supernatant liquor, through isopyknic n-hexane extraction, the e.e. value of product (R)-epoxy nitrine propane is 93.4%, and transformation efficiency is 74%.
Embodiment 12:
In the phosphate buffered saline buffer of 10mL, 100mM (pH 8.0), add 0.5g embodiment 3 gained wet thallus cells; Add the racemic epoxy nitrine of 50mg propane as substrate, in 30 ℃ of water bath with thermostatic control shaking tables oscillatory reaction 10 hours, reaction solution was centrifugal, get supernatant liquor, through isopyknic n-hexane extraction, the e.e. value of product (R)-epoxy nitrine propane is 88%, and transformation efficiency is 72%.
Embodiment 13:
In the Tris-HCl of 10mL, 100mM damping fluid (pH 7.2), add 0.5g embodiment 4 gained wet thallus cells; Add the racemic epoxy nitrine of 50mg propane as substrate, in 30 ℃ of water bath with thermostatic control shaking tables oscillatory reaction 10 hours, reaction solution was centrifugal, get supernatant liquor, through isopyknic n-hexane extraction, the e.e. value of product (R)-epoxy nitrine propane is 74%, and transformation efficiency is 78%.
Embodiment 14:
In the barbitol buffer solution of 10mL, 100mM (pH 7.2), add 0.5g embodiment 4 gained wet thallus cells; Add the racemic epoxy nitrine of 50mg propane as substrate, in 30 ℃ of water bath with thermostatic control shaking tables oscillatory reaction 10 hours, reaction solution was centrifugal, get supernatant liquor, through isopyknic n-hexane extraction, the e.e. value of product (R)-epoxy nitrine propane is 80.2%, and transformation efficiency is 73%.
Embodiment 15:
In the phosphate buffered saline buffer of 10mL, 100mM (pH 7.2), add 0.5g embodiment 3 gained wet thallus cells; Add the racemic epoxy nitrine of 100mg propane as substrate and 0.1mL DMSO, in 30 ℃ of water bath with thermostatic control shaking tables oscillatory reaction 10 hours, reaction solution was centrifugal, get supernatant liquor, through isopyknic n-hexane extraction, the e.e. value of product (R)-epoxy nitrine propane is 95.6%, and transformation efficiency is 74%.
Embodiment 16:
In the phosphate buffered saline buffer of 10mL, 100mM (pH 7.2), add 0.5g embodiment 3 gained wet thallus cells; Add the racemic epoxy nitrine of 100mg propane as substrate and 0.1mL DMF, in 30 ℃ of water bath with thermostatic control shaking tables oscillatory reaction 10 hours, reaction solution was centrifugal, get supernatant liquor, through isopyknic n-hexane extraction, the e.e. value of product (R)-epoxy nitrine propane is 83.2%, and transformation efficiency is 78%.

Claims (7)

  1. Aspergillus niger ( Aspergillus nige) 208, be preserved in Chinese typical culture collection center, the address: China, Wuhan, Wuhan University, postcode 430072, preservation date on May 9th, 2012, deposit number CCTCC NO:M2012163.
  2. 2. the application of aspergillus niger 208 as claimed in claim 1 in microbial method preparation (R)-epoxy nitrine propane.
  3. 3. application as claimed in claim 2, it is characterized in that described being applied as: be substrate with racemation epoxy nitrine propane, wet thallus cell with aspergillus niger 208 is catalyzer, under 25～40 ℃, in the damping fluid of pH6.0～8.4, reacted 1～12 hour, and made described (R)-epoxy nitrine propane.
  4. 4. application as claimed in claim 3 is characterized in that in the described damping fluid that the starting point concentration of aspergillus niger 208 wet thallus cells is 100～1000g/L, and the starting point concentration of substrate racemation epoxy nitrine propane is 0.1～20g/L.
  5. 5. application as claimed in claim 3 is characterized in that described damping fluid is one of following: phosphate buffered saline buffer, Tris-HCl damping fluid, barbitol buffer solution.
  6. 6. application as claimed in claim 3, it is characterized in that also being added with in the described damping fluid solubility promoter that volume is damping fluid volume 5～20%, described solubility promoter is one of following: (1) dimethyl sulfoxide (DMSO), (2) acetone, (3) N, dinethylformamide, (4) diazole alkane, (5) tetrahydrofuran (THF).
  7. 7. application as claimed in claim 3, it is characterized in that described aspergillus niger 208 wet thallus cells are obtained by following method: the final concentration of substratum is formed: Zulkovsky starch 5～30g/L, analysis for soybean powder 5～20g/L, K 2HPO 43H 2O 0.2～1g/L, KH 2PO 40.1～0.5g/L, MgSO 47H 2O 0.1～1g/L, NaCl 2～10g/L, solvent are water, pH6～8; 208,25～40 ℃ of above-mentioned culture medium inoculated aspergillus nigers, 100～200rpm shaking culture 48～96 hours, medium centrifugal is got precipitation and is washed through physiological saline, collects to obtain described aspergillus niger 208 wet thallus cells.
CN 201210189253 2012-06-06 2012-06-06 Aspergillus niger and application thereof to microbial preparation of (R)-epoxy azidopropane Active CN102732432B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN 201210189253 CN102732432B (en) 2012-06-06 2012-06-06 Aspergillus niger and application thereof to microbial preparation of (R)-epoxy azidopropane

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN 201210189253 CN102732432B (en) 2012-06-06 2012-06-06 Aspergillus niger and application thereof to microbial preparation of (R)-epoxy azidopropane

Publications (2)

Publication Number Publication Date
CN102732432A CN102732432A (en) 2012-10-17
CN102732432B true CN102732432B (en) 2013-09-11

Family

ID=46988736

Family Applications (1)

Application Number Title Priority Date Filing Date
CN 201210189253 Active CN102732432B (en) 2012-06-06 2012-06-06 Aspergillus niger and application thereof to microbial preparation of (R)-epoxy azidopropane

Country Status (1)

Country Link
CN (1) CN102732432B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104382991A (en) * 2014-11-27 2015-03-04 苏州嘉禧萝生物科技有限公司 Method for improving pharmacological activity of baikal skullcap root

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
Enzymatic dynamic kinetic resolution of epihalohydrins;Jeffrey H. Lutje Spelberg等;《Tetrahedron: Asymmetry》;20040405;第15卷(第7期);第1095-1102页 *
Jeffrey H. Lutje Spelberg等.Enzymatic dynamic kinetic resolution of epihalohydrins.《Tetrahedron: Asymmetry》.2004,第15卷(第7期),第1095-1102页.
Synthesis of N-(3-rosin acyloxy-2-hydroxyl) Propyl-N,N Diethanolamine and Its Anti-fungal Activity;Tao Liang等;《Advanced Materials Research》;20111231;第280卷;第124-127页 *
TaoLiang等.SynthesisofN-(3-rosinacyloxy-2-hydroxyl)Propyl-N N Diethanolamine and Its Anti-fungal Activity.《Advanced Materials Research》.2011

Also Published As

Publication number Publication date
CN102732432A (en) 2012-10-17

Similar Documents

Publication Publication Date Title
CN105112305B (en) A kind of red yeast rice and preparation method thereof rich in Monacolin K
CN110527646B (en) Tropical bacillus WZZ018 and application thereof
CN110527637A (en) A kind of Aspergillus terreus bacterial strain producing aconitic acid and its construction method and application
CN106434369B (en) One plant of aspergillus oryzae for producing L MALIC ACID and its application
CN102719378B (en) Method for preparing (-) gamma-lactam by catalysis asymmetry of microorganism
CN102634460B (en) Rhizopus oryzae RH1-5 and separating and culturing method thereof
CN103451124B (en) One strain rhodococcus and the purposes for the preparation of optical purity (R)-6-hydroxyl-8-chloroctanoic acid ester and other optical activity chirality alcohol
CN108300677A (en) One plant of streptomyces albus and its application in preparing microbialpreservatives
CN103045504B (en) Microorganism catalysis prepared (2S,3R)-2-benzoyl aminomethyl-3-hydroxybutyric acid ester and bacterial strain
CN104560941A (en) Method for enhancing worm grass fermentation biomass
CN102732432B (en) Aspergillus niger and application thereof to microbial preparation of (R)-epoxy azidopropane
CN103290065A (en) Method for preparing borneol by using microorganism separated from natural world
CN103589665B (en) Celebrating sheng, a reed pipe wind instrument rhodococcus and the application in preparation (S)-4-chloro-3-hydroxyl ethyl butyrate thereof
CN104017836B (en) A kind of preparation method of chiral benzene first sulfoxide
CN103820331B (en) Phlegmariurus endogenetic fungus and the methods and applications of product huperzine A thereof
CN103555590B (en) Geotrichum candidum and its application in preparation of (2R, 3S)-ethyl phenyl glycidate
CN102851216B (en) Aspergillus fumigatus and its use in microbial preparation of (R,R)-3-phenylglcidol
CN102102087A (en) Leifsonia xyli and use thereof in preparation of (R)-[3,5-bis(trifluoromethyl)phenyl]ethanol
CN105586289B (en) A kind of (+/-) gamma-lactam that can split obtains pseudomonad and its screening and application of (-) gamma-lactam
CN103074239B (en) Candida sorboxylosa and application thereof in preparation of (S)-4-chloro-3-hydroxybutanoate
CN103820332B (en) Huperzia serrata endogenetic epiphyte and the methods and applications of product huperzine A thereof
CN100547067C (en) Brevibacterium epidermidis ZJB-07021 and the preparation (S)-2, the application in the 2-dimethyl-cyclopropane carboxamide
CN106086090A (en) A kind of method that two-step microbial conversion method prepares R mandelic acid
CN102559540B (en) Flavobacterium aquati and application thereof in preparation of L-tryptophan by microbial transformation
CN102757443A (en) Sulfur-substituted podophyllum derivative and bioconversion, separation and purification method thereof

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant