CN103820332B - Huperzia serrata endogenetic epiphyte and the methods and applications of product huperzine A thereof - Google Patents
Huperzia serrata endogenetic epiphyte and the methods and applications of product huperzine A thereof Download PDFInfo
- Publication number
- CN103820332B CN103820332B CN201410045032.3A CN201410045032A CN103820332B CN 103820332 B CN103820332 B CN 103820332B CN 201410045032 A CN201410045032 A CN 201410045032A CN 103820332 B CN103820332 B CN 103820332B
- Authority
- CN
- China
- Prior art keywords
- huperzine
- huperzia serrata
- endogenetic epiphyte
- serrata endogenetic
- epiphyte
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The present invention relates to microbial technology field, be specifically related to Huperzia serrata endogenetic epiphyte and produce the methods and applications of huperzine A.The present invention provides a kind of Huperzia serrata endogenetic epiphyte, named blood red close red bacterium S80, and its depositary institution and preserving number be: China typical culture collection center, CCTCC M2013646.Another technical scheme of the present invention for a kind of Huperzia serrata endogenetic epiphyte of offer, named Fructus Mangifera Indicae Guignardia S107, its depositary institution and preserving number is: China typical culture collection center, CCTCC M2013647.The present invention produce huperzine A Huperzia serrata endogenetic epiphyte be from Huperziaceae plant Herba Lycopodii serrati live body isolated and purified to filamentous fungi, after liquid fermentation, HPLC, LC/MS test experience proves that this bacterium can produce huperzine A, it is a kind of important microorganism finding huperzine A source new drugs, has bigger using value.
Description
Technical field
The present invention relates to microbial technology field, be specifically related to Huperzia serrata endogenetic epiphyte and the method producing huperzine A thereof
And application.
Background technology
Senile dementia is a kind of serious, degeneration brain illness, and owing to its sickness rate is high, disability rate is high, give society and
Family causes serious harm and huge financial burden, and along with social senilization, senile dementia sickness rate rises relatively,
According to statistics, the world has more than 5,000 ten thousand old peoples to suffer from senile dementia in various degree, and therefore treatment senile dementia is pendulum
A great problem in current social.
Huperzine A [(-) Huperzine A, Hup A] be China scientist Liu Jiasen in 1986 from Herba Lycopodii serrati
The one novel lycopods alkaloid effective monomer of isolated.Pharmacological evaluation shows, its energy acetylcholine esterase inhibition activity,
Effectively improve memory of elderly person function, treatment senile dementia is had special efficacy.Huperzine A is mainly derived from wild Serpentis
Foot stone China fir herb, and this plant is harsh to environmental requirement, poor growth, is distributed scattered, the resource updates cycle is long, and huperzine
First content in Herba Lycopodii serrati is little, only ten thousand/several, cause the price of huperzine A on international market constantly to rise, one
Degree reaches 500,000 dollars every kilogram, becomes the bottleneck of restriction huperzine A exploitation.Owing to the structure of huperzine A is special, in skeleton
Caged scaffold be difficult to synthetic, current all chemical synthesis process steps are complicated, synthesis condition is harsh, productivity is the lowest, difficult
To realize industrialized production；Plant tissue culture cannot eliminate the microorganism of inherence and pollute, simultaneously because plant growing condition ten
Divide harshness, fail the most so far to walk out laboratory.
Plant endogenesis epiphyte owing to living in plant, long-term and plant interaction, it is possible to produce identical with host
Or chemistry similar composition.The Ramulus et folium taxi cuspidatae of anticancer component can be synthesized since Strobel in 1993 etc. isolate from yewtree
Alcohol, it is desirable to use endogenetic fungus fermentation synthesis medicinal ingredient.Microorganism has and easily carries out industrialized production, and easy mutation improves
The effectively content of product, tunning is single compared with plant component, and effective ingredient such as can be easily separated at the advantage.Therefore from endogenetic fungus
Extract active component and replace extracting active component from plant, not only can solve the exhausted crisis of many resources of medicinal plants, and
And also reduce the production cost of active component.
The most existing much about being separated to produce the report of huperzine A endogenetic fungus from Herba Lycopodii serrati plant, such as patent
CN101195804A(Li Wankui etc., number of patent application: 200610119149.7, interior raw branch acremonium), CN101240304A (Wu
East just etc., number of patent application: 200710003519.5, cladosporium sp), CN101942393A (Chaud Doc etc., number of patent application:
20091010186852.3, bamboo parasitic fungus), patent CN103103134A (Wu Shuisheng etc., number of patent application: 201110355882.X,
Anthrax) etc.；Yang Xiaojun (" research I of endogenetic fungus YD-01 secondary metabolite " 2006,37(5): 479-480, middle traditional Chinese medicines
Section's college journal) all report the bacterial strain producing huperzine A and the like.Below all show to utilize Huperzia serrata endogenetic epiphyte
Fermenting and producing huperzine A becomes a kind of possible, and using endogenetic fungus fermenting and producing huperzine A is to solve huperzine A raw material to come
The cost-effective new way in source.But the strain huperzine A of report yields poorly at present, it is impossible to be applied to industrialized production.Cause
This, necessitated by further isolated and purified new, high yield huperzine A endogenetic fungus, send out for being found suitable for industrialization
Ferment produces huperzine A and creates a kind of possible.
Summary of the invention
It is an object of the invention to provide the Huperzia serrata endogenetic epiphyte of fermenting and producing huperzine A medicine, and produce huperzine
The methods and applications of first.
For achieving the above object, the present invention provides a kind of Huperzia serrata endogenetic epiphyte, named blood red close red bacterium
(Pycnoporus sanguineus) S80, its depositary institution and preserving number be: China typical culture collection center, CCTCC
M2013646。
The blood red close red bacterium S80 of above-mentioned Huperzia serrata endogenetic epiphyte, its microscopic morphology is: mycelia without every, have branch, spore
Son is circular, monospore.
The blood red close red bacterium S80 of above-mentioned Huperzia serrata endogenetic epiphyte, its genome ITS feature base sequence such as SEQ ID
Shown in NO:1.
The blood red close red bacterium S80 of above-mentioned Huperzia serrata endogenetic epiphyte, its liquid culture colony characteristics is PDA culture medium 28
DEG C cultivate, rotating speed is 140rpm, cultivates and has a small amount of mycelium pellet on the 3rd day, and within the 5th day, fermentation liquid becomes viscous, and mycelium pellet increases, diameter
Increasing, its colony characteristics is: growth is rapid, and neat in edge becomes the radial flat board that is paved with, and aerial hyphae is dried undeveloped in carpet
Shape.
Another technical scheme of the present invention is for providing a kind of Huperzia serrata endogenetic epiphyte, named Fructus Mangifera Indicae Guignardia
(Guignardia mangiferae) S107, its depositary institution and preserving number be: China typical culture collection center,
CCTCC M2013647。
Above-mentioned Huperzia serrata endogenetic epiphyte Fructus Mangifera Indicae Guignardia S107, its microscopic morphology is: spore is oval, and mycelia has
Every, branch, smooth, in a tubular form, and spacing, monospore.
Above-mentioned Huperzia serrata endogenetic epiphyte Fructus Mangifera Indicae Guignardia S107, its genome ITS feature base sequence such as SEQ
Shown in ID NO:2.
Above-mentioned Huperzia serrata endogenetic epiphyte Fructus Mangifera Indicae Guignardia S107, its liquid culture colony characteristics is PDA culture medium
28 DEG C of cultivations, rotating speed is 140rpm, cultivates and has a small amount of mycelium pellet on the 3rd day, and fermentation liquid is green, and within the 5th day, fermentation liquid is dark green
Color, mycelium pellet has no and rises appreciably, the 8th day color gray, and mycelium pellet increases.Its colony characteristics is: poor growth, mycelia
Fine and close undeveloped, in celadon, back side blackish green, edge is irregular, and bacterium colony swells, and has the black globule；
The another technical scheme of the present invention extracts stone China fir for providing a kind of Phlegmariurus phlegmaria (L) Holub endogenetic fungus Huperzia serrata endogenetic epiphyte
The method of alkali first, comprises the following steps:
(1) the most blood red close red bacterium S80 or Fructus Mangifera Indicae Guignardia S107 of above-mentioned Huperzia serrata endogenetic epiphyte strain is taken, aseptic
Under the conditions of, with Inoculating needle picking mycelia, access the solid PDA medium of sterilizing, activate 48 hours in 28 DEG C；
(2) take the strain after activation, aseptically, transfer into sterilized liquid PDA culture medium, in 28 DEG C
140rpm shaking table is cultivated 72 hours, obtains seed liquor；
(3) seed liquor prepared being accessed in liquid PDA culture medium by the mass ratio of 10:1, at 28 DEG C, 140rpm shakes
Bed is cultivated 10 days；
(4), after having fermented, add 2% tartaric acid of 30ml, stand overnight, ultrasonic twice, each each 40min, collected by suction
Supernatant, regulating to pH value with ammonia is 9.0, and the dichloromethane adding triplication extracts 3 times, collects extract, 60 DEG C of recovery
Dichloromethane, obtains huperzine A primary extract with the methanol dissolution residual substance of 10ml.
The another technical scheme of the present invention is for providing the most blood red close red bacterium S80 of a kind of above-mentioned Huperzia serrata endogenetic epiphyte strain
Or Fructus Mangifera Indicae Guignardia S107 prepares the application of huperzine A.
Beneficial effects of the present invention: the Huperzia serrata endogenetic epiphyte of product huperzine A of the present invention is to plant from Huperziaceae
The isolated and purified filamentous fungi arrived in thing Herba Lycopodii serrati live body, through liquid fermentation, proving through HPLC, LC-MS test experience should
Bacterium can produce the compound huperzine A identical with host plant, is find huperzine A source new drugs a kind of important micro-
Biology, has bigger using value.This Huperzia serrata endogenetic epiphyte can under household condition be cultivated, it is possible to use this microorganism
Feature and modern fermentation technique, reach industrialized production huperzine A, to solve the bottleneck problem of huperzine A exploitation, simultaneously
Endangered huperzine A natural resources can be saved.
Accompanying drawing explanation
Fig. 1 is the microscopic morphology figure of Fructus Mangifera Indicae Guignardia S107 of the present invention；
Fig. 2 is the microscopic morphology figure of the blood red close red bacterium S80 of the present invention；
Fig. 3 is the colonial morphology figure of Fructus Mangifera Indicae Guignardia S107；
Fig. 4 is the colonial morphology figure of blood red close red bacterium S80；
Fig. 5 is Hup A standard substance HPLC chromatogram；
Fig. 6 is Fructus Mangifera Indicae Guignardia S107 fermented product extract chromatogram；
Fig. 7 is blood red close red bacterium S80 fermented product extract chromatogram；
Fig. 8 is Hup A standard quality spectrogram；
Fig. 9 is Fructus Mangifera Indicae Guignardia S107 fermented product extract mass spectrum；
Figure 10 is blood red close red bacterium S80 fermented product extract mass spectrum.
Detailed description of the invention
By describing the technology contents of the present invention, structural feature in detail, being realized purpose and effect, below in conjunction with embodiment
And coordinate accompanying drawing to be explained in detail.
The Huperzia serrata endogenetic epiphyte of product huperzine A of the present invention is from Huperziaceae plant Herba Lycopodii serrati
Huperzia serrata (Thumb) Trev live plant uses endogenetic fungus separating and purifying technology separate to obtain.Through molecule
Biology and Morphological Identification named Fructus Mangifera Indicae Guignardia (Guignardia mangiferae) S107, blood red close red bacterium
(Pycnoporus sanguineus) S80, has been preserved in China typical culture collection center, Wuhan, China university, preservation the most
Date: December 10 in 2013；The most blood red close red bacterium S80 preserving number is: CCTCC M2013646, Fructus Mangifera Indicae Guignardia S107 protect
Tibetan number is: CCTCC M2013647.
Embodiment 1
1, bacterial strain microscopic morphology is observed: the endogenetic fungus point that the present invention two kinds produces huperzine A is inoculated in flat board central authorities,
Again the 45 ° of oblique cutting people of coverslip of bacterium of having gone out are connect in the flat board of bacterium (2/flat board), cultivated in 28 DEG C of fungal culture casees, treat
After bacterial strain length (6d) to a certain extent, take inserted sheet (carrying out in super-clean bench) in basis of microscopic observation.
Referring to the microscopic morphology figure that Fig. 1 is Fructus Mangifera Indicae Guignardia S107 of the present invention, described Fructus Mangifera Indicae Guignardia S107's is micro-
Form is: spore is oval, and mycelia has every, branch, smooth, in a tubular form, spacing, monospore.
Refer to the microscopic morphology figure that Fig. 2 is the blood red close red bacterium S80 of the present invention, described blood red close red bacterium S80 microscopic morphology
For: mycelia without every, have branch, spore is circular, monospore.
2, bacterial strain plate morphology is observed: the endogenetic fungus point that the present invention produces huperzine A receives 3 flat board central authorities.In 28
Cultivating in DEG C fungal culture case, the growing state of timing every day observed and recorded thalline, including colony diameter, colony colour, mycelia
The strain morphology changes such as change.
Huperzia serrata endogenetic epiphyte Fructus Mangifera Indicae Guignardia S107, its liquid culture colony characteristics is PDA culture medium 28 DEG C training
Supporting, rotating speed is 140rpm, cultivates and has a small amount of mycelium pellet on the 3rd day, and within the 5th day, fermentation liquid becomes viscous, and mycelium pellet increases, and diameter increases
Greatly；Refering to the colonial morphology figure that Fig. 3 is Fructus Mangifera Indicae Guignardia S107, its colony characteristics is: poor growth, and mycelia densification is undeveloped,
In celadon, back side blackish green, edge is irregular, and bacterium colony swells, and has the black globule.
The blood red close red bacterium S80 of Huperzia serrata endogenetic epiphyte, its liquid culture colony characteristics is PDA culture medium 28 DEG C training
Supporting, rotating speed is 140rpm, cultivates and has a small amount of mycelium pellet on the 3rd day, and fermentation liquid is green, and within the 5th day, fermentation liquid is dark green, mycelia
Ball has no and rises appreciably, the 8th day color gray, and mycelium pellet increases, and refers to the colonial morphology that Fig. 4 is blood red close red bacterium S80
Figure, its colony characteristics is: growth is rapid, and neat in edge becomes the radial flat board that is paved with, and aerial hyphae is dried undeveloped in carpet
Shape.
3, Huperzia serrata endogenetic epiphyte molecular biological characteristics of the present invention
Microorganism collection: the present invention is produced huperzine A endogenetic fungus and connects from PDA fluid medium, 28 DEG C, 140r/min, shakes
Bottle cultivate, until thalline grow to a certain amount of after, 8000rpm is centrifuged 5min, abandons supernatant, the thalline of precipitation is gone to EP pipe in, in-80
In DEG C refrigerator-freezer, pre-freeze one is stand-by for evening.
DNA extraction: use CTAB method to extract genomic DNA (having amendment), take the thalline after appropriate lyophilizing, fill in mortar
Divide and grind, add the CTAB solution 1ml being preheated to 65 DEG C, take 500ul and proceed to 2ml centrifuge tube, add 20 μ l mercaptoethanols, mixed
Close, 65 DEG C of temperature bath 1h；Temperature bath adds the phenol of isopyknic 1:1 after terminating: chloroform, slowly shakes, 12000rpm, 20 DEG C from
Heart 10min, takes supernatant to new centrifuge tube, repeats above step, clarify to supernatant, supernatant is proceeded to 1.5ml and is centrifuged
Pipe (carrying 2～4 times altogether).Adding 7/10 volume isopropanol, precipitate at 4 DEG C, after 30min, 10000rpm is centrifuged 10min, abandons supernatant；
With 75% cold ethanol (500ul) washing precipitation, then 10000rpm, 4 DEG C of centrifugal 10min, abandon supernatant (being repeated once), natural wind
Dry；It is eventually adding 20ul ultra-pure water fully to dissolve, finally places-20 DEG C of Refrigerator stores standby.
PCR expand: use ITS1 and ITS4 as upstream and downstream primer, build 20 μ l reaction systems (containing ddH2O12.2 μ l,
The each 1 μ l of 10 × buffer2 μ l, dNTP1.6 μ l, Primer ITS1 and Primer ITS4, template 1 μ l, Taq enzyme 0.2 μ l.), with
94 DEG C of denaturations 5min；94 DEG C of degeneration 30s, 55 DEG C of annealing 1min, 72 DEG C extend 1min, 32 circulations；72 DEG C of extension 10min, 4
DEG C insulation condition carry out reaction amplification.After end, using this PCR primer taken turns as template, again expand 100 μ l.
Gel electrophoresis: use TBE to cook buffer, take 1ul6 × loading buffer and 2ul sample (genome and amplification
Product) mixing loading, through the agarose gel electrophoresis of 1.0%, and observed and recorded result under gel imaging system.
Product purification: use centrifugal pillar PCR primer purification kit (EZ-10Spin Column PCR Product
Purification Kit) purified pcr product.PCR primer after purification delivers raw work biological engineering Shanghai limited company
Complete order-checking.
Two kinds of product huperzine A Huperzia serrata endogenetic epiphyte genebank numbers of logining of the present invention are respectively as follows: Fructus Mangifera Indicae ball
Seat bacterium (Guignardia mangiferae) the S107 number of logining KF973223, blood red close red bacterium (Pycnoporus
Sanguineus) the S80 number of logining KF973224, ITS base sequence is:
Blood red close red bacterium (Pycnoporus sanguineus) S80(SEQ ID NO:1):
CTTCGGGGCATGTGCACACCCTGCTCATCCACTCTACACCTGTGCACTTACTGTAGGTTTGGCGTGGGCTTCGGGGC
CTCGGGGTCTTTGAGGCATTCTGCCGGCCTATGTATCACTACAAACACATAAAGTAACAGAATGTATGAGCGTCTAA
CGCATCTAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTA
ATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCC
TGTTTGAGTGTCATGGAATTCTCAACCCACACGTCCTTGTGATGC
TGTGGGCTTGGACTTGGAGGCTTGCTGGCCCTCGTCGGTCGGCTCCTCTTGAATGCATTAGCTTGATTCCGTGCGGA
TCGGCTCTCAGTGTGATAATTGTCTACGCTGTGACCGTGAAGCGTTTGGCGAGCTTCTAACCGTCCTGTATGGGACA
ACCTCTTGACATCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAGAT
Fructus Mangifera Indicae Guignardia (Guignardia mangiferae) S107(SEQ ID NO:2):
CCAGAGTAGGCGCTACAACGCCGAAATGACCTTCTCACCCTTGTGTACTCACTATGTTGCTTTGGCGGGTCGACCTG
GTTCCGACCCAGGCGGCCGGCGCCCCCAGCCTTAACTGGCCAGGACGCCCGGCTAAGTGCCCGCCAGTATACAAAAC
TCAAGAATTCATTTTGTGAAGTCCTGATATATCATTTAATTGATTAAAACTTTCAACAACGGATCTCTTGGTTCTGG
CATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGC
ACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTATTGG
GCAACGTCCGCTGCCGGACGTGCCTTGAAGACCTCGGCGACGGCGTCCTAGCCTCGAGCGTAGTAGTAAAATATCTC
GCTTTGGAGTGCTGGGCGACGGCCGCCGGACAATCGACCTTCGGTCTATTTTTCCAAGGTTGACCTCGGATCAGGTA
GGGATACCCGCTGAACTTAAGCATATCAATAAGCCGGAGGAG
Sequence alignment and cladogram build: by two kinds of Huperzia serrata endogenetic epiphyte 18S rDNA sequence results of the present invention
All being converted to FASTA form, online BLAST retrieves, and compares with the 18S rDNA sequence of other funguses in GenBank,
Same with Fructus Mangifera Indicae Guignardia (Guignardia mangiferae) and blood red close red bacterium (Pycnoporus sanguineus) respectively
Source property is 100%.
Embodiment 2
One, the collection of Huperzia serrata endogenetic epiphyte of the present invention
1, the Herba Lycopodii serrati adopted back from Liancheng County, Longyan Guan Zhishan separates Serpentis according to the separation method of stone latitude etc.
Foot stone China fir endogenetic fungus.The fresh Herba Lycopodii serrati live plant tap water adopted is rinsed well, immerses 75% ethanol
(5min), with aseptic water washing 5 times；0.1% mercuric chloride (about 1min) it is dipped in aseptic filter paper again, again with aseptic after blotting
Water rinses, and aseptic filter paper blots, and finally by 75% soak with ethanol 30s, aseptic filter paper blots.With the shears after sterilizing, difference is planted
Fabric texture material (i.e. root, stem, leaf) is divided into the size of about 5mm length.Then every kind of sample proceeds to respectively containing 3% streptomycin
On PDA plate, for the separation of endogenetic fungus.Cultivate a couple of days in 28 DEG C of constant incubators.Routine observation endogenetic fungus bacterium colony
Formational situation, observes after 3-5 days that sample edge part has mycelia to grow, and picking Tip Splitting is transferred in fresh PDA flat board, pure
Change 2-3 time, the bacterial strain being purified to is carried out culture presevation.
2, bacterial strain PDB fluid medium after purification is carried out fermentation culture.
3, the manufacture method of PDB fluid medium: the Rhizoma Solani tuber osi 200g chopping removed the peel after cleaning, adds water to 1000ml and boils
Boil half an hour, filter off Rhizoma Solani tuber osis with eight layers of gauze, be subsequently adding 20g glucose, add water and complement to 1000ml, divide after stirring and dissolving
Dress sterilizing (121 DEG C of high pressure steam sterilization 20min).
Two, the preparation of Huperzia serrata endogenetic epiphyte bacterial strain fermentation liquor of the present invention
1, take the Huperzia serrata endogenetic epiphyte of the present invention, aseptically, with a small amount of mycelia of Inoculating needle picking, accessed
The solid PDA medium test tube of sterilizing, activates 48 hours in 28 DEG C.
2, take the strain after activation, aseptically, transfer into sterilized liquid PDA culture medium, in 28 DEG C
140rpm shaking table is cultivated 72 hours, obtains seed liquor.
3, the seed liquor prepared is transferred by the amount of 10% fill in 100ml/250ml liquid PDA culture medium, in 28
At DEG C, 140rpm shaking table is cultivated 10 days.
4, after having fermented, first taking the bacterial strain fermentation liquor of 1ml, 17000rpm is centrifuged 15min and takes supernatant, for ELISA primary dcreening operation
Produce the bacterial strain of huperzine A.Remaining ferment liquid adds 2% tartaric acid of 30ml, stands overnight, ultrasonic twice, each each 40min,
Collected by suction supernatant, regulating to pH value with ammonia is 9.0, and the dichloromethane adding triplication extracts 3 times, collects extract,
60 DEG C are reclaimed dichloromethane, merge organic facies, are evaporated to do, add in three times in returnable bottle with 10ml absolute methanol, molten
Solving, taking-up dries up, and adds 0.2% formic acid 200 μ l, adds the C-18 solid phase pillar activated, collects the sample of 40% methanol-eluted fractions
3ml, dries up, and adds 0.2% formic acid 200 μ l, and 17000r/min is centrifuged 10min, takes supernatant standby.
Three, the Huperzia serrata endogenetic epiphyte of the present invention produces the determination of huperzine A characteristic
1) ELISA primary dcreening operation
Character according to antigen and requirement of experiment, dilute envelope antigen HupA-OVA with the carbonate buffer solution of pH9.6
Become 1:200 concentration, with 100 μ l/ holes, hatch 16h for 4 DEG C.Discarding liquid in hole, wash plate 3 times with PBST, each 3min, in water suction
Pat dry on paper.Wash plate and add confining liquid, 200 μ l/ holes, hatch 2h for 37 DEG C.Discard liquid in hole, wash plate 3 times with PBST, often
Secondary 3min, pats dry in absorbent paper.In 96 orifice plate closed, it is separately added into PBS handles sample well and dilution factor is 1:
The each 50 μ l of monoclonal antibody (Hup A-McAb) of the huperzine A of 8000, after vibration mixing, are placed in 37 DEG C and hatch 1h.Discard hole
Interior liquid, washes plate 3 times with PBST, and each 3min pats dry in absorbent paper.Every hole adds the ELIAS secondary antibody (HRP-of diluted fresh
IgG) (dilution factor is 1:5000) 100 μ l/ hole, hatches 40min for 37 DEG C, and liquid of turning washes plate 3 times with PBST, each 3min, in
Pat dry in absorbent paper.Add freshly prepared nitrite ion 100 μ l/ hole, after vibration mixing, incubated at room 10min, close observation,
After colour developing 10min, every hole adds 50 μ l2M H2SO4Solution terminates reaction, vibration mixing, stands 5min, makes termination thorough, color
Homogeneous.On enzyme mark analyzer, measure light absorption value in wavelength 450nm.
Take the bacterial strain (Fructus Mangifera Indicae Guignardia S107, blood red close red bacterium S80) of two kinds of bacterium of Huperzia serrata endogenetic epiphyte of the present invention
Detecting in fermentation liquid primary extract 50 μ l addition reaction system, each sample adds holes, and its value is OD450Sample, if two skies
In vain, the standard substance of the variable concentrations huperzine A that six PBS dissolve, blank well adds same volume PBS, huperzine A standard substance dense
Degree is followed successively by 104, 5x103, 103, 5x102, 102, 50ng/ml, to each sample OD450Value is averaged, according to formula suppression ratio=
(B0-B)/B0, calculates suppression ratio, and wherein B0 is blank value (maximum), and B is the value of standard substance, with suppression ratio as vertical coordinate, and mark
The logarithm of quasi-product solution concentration is abscissa Criterion curve, obtains a regression equation.By sample according to seeking suppression ratio with method,
Its suppression ratio substitution regression equation calculation is gone out the log concentration of sample, then seeks concentration, concentration=10^ sample concentration logarithm.
2) HPLC and LC-MS analyzes
(1) HPLC (high performance liquid chromatography) condition
Chromatographic condition: chromatographic column: XTerraMS C-18 (2.1 × 50mm, 5 μm) flows phase: methanol 0.2% formic acid (15:
85)；Flow velocity: 1.00/min；Column temperature: 30 DEG C；Sample size: 20 μ l；
(2) LC-MS (Mass Spectrometry Conditions) condition: ion source: ESI；Detection mode: cation detects；Acquisition mode: MS
scan；Detection object: huperzine A, m/z(243.2 → 211.5)；Capillary voltage: 3.0KV, taper hole voltage: 35V, ion source
Temperature: 110 DEG C, desolventizing temperature: 350 DEG C, desolventizing throughput: 654L/hr.
(3) interpretation of result
Huperzia serrata endogenetic epiphyte Fructus Mangifera Indicae Guignardia S107 of the present invention, blood red close red bacterium S80 tunning chromatogram such as figure
Shown in 6,7, the retention time of aim colour spectral peak is respectively 30.789min, 30.734min, protects with huperzine A standard substance chromatograph
Stay time 31.599min Fig. 5, basically identical.
Fig. 9, Figure 10 are respectively huperzine A target components in Huperzia serrata endogenetic epiphyte tunning of the present invention
Mass spectrum, it all has for m/z243.51/211.49211.55 molecular ion peak, is illustrated in figure 8 huperzine A standard substance and divides
Daughter ion peak m/z243.52/211.55, by comparing, the target peak of two kinds of Huperzia serrata endogenetic epiphyte tunnings of the present invention
Mass spectrum consistent with the mass spectrum of standard substance huperzine A, it can be assumed that the present invention produces huperzine A Huperzia serrata endogenetic epiphyte
Tunning in there is huperzine A compound.
Fructus Mangifera Indicae Guignardia (Guignardia mangiferae) S107 of the present invention, blood red close red bacterium (Pycnoporus
Sanguineus) S80ELISA screening suppression ratio is respectively 60.4%, and 90.1%.
Huperzia serrata endogenetic epiphyte through above HPLC, LC-MS, the huperzine A monoclonal antibody detection present invention passes through
Fermentation can produce huperzine A compound.
The Huperzia serrata endogenetic epiphyte Fructus Mangifera Indicae Guignardia (Guignardia of product huperzine A of the present invention
Mangiferae) S107, blood red close red bacterium (Pycnoporus sanguineus) S80 are to live from Huperziaceae plant Herba Lycopodii serrati
The isolated and purified filamentous fungi arrived in body, through liquid fermentation, through ELISA, HPLC, LC-MS detection proves that this bacterial strain can produce
With the compound huperzine A of parasitic plant, it is the important microbe finding huperzine A source new drugs, has bigger using value.
The foregoing is only embodiments of the invention, not thereby limit the scope of the claims of the present invention, every utilize this
Equivalent structure or equivalence flow process that bright description and accompanying drawing content are made convert, or are directly or indirectly used in other relevant skills
Art field, is the most in like manner included in the scope of patent protection of the present invention.
Claims (3)
1. a Huperzia serrata endogenetic epiphyte, named blood red close red bacterium (Pycnoporus sanguineus) S80, its preservation
Unit and preserving number be: China typical culture collection center, CCTCC M 2013646.
2. the method that a Huperzia serrata endogenetic epiphyte extracts huperzine A, it is characterised in that comprise the following steps:
(1) Huperzia serrata endogenetic epiphyte strain as claimed in claim 1 is taken, aseptically, with Inoculating needle picking mycelia,
Access the solid PDA medium of sterilizing, activate 48 hours in 28 DEG C；
(2) take the strain after activation, aseptically, transfer into sterilized liquid PDA culture medium, in 28 DEG C at 140rpm
Shaking table is cultivated 72 hours, obtains seed liquor；
(3) seed liquor prepared is accessed in liquid PDA culture medium by the mass ratio of 10:1,140rpm shaking table training at 28 DEG C
Support 10 days；
(4) after having fermented, adding 2% tartaric acid of 30ml, stand overnight, ultrasonic twice, each each 40min, on collected by suction
Clear liquid, regulating to pH value with ammonia is 9.0, and the dichloromethane adding triplication extracts 3 times, collects extract, and 60 DEG C are reclaimed two
Chloromethanes, obtains huperzine A primary extract with the methanol dissolution residual substance of 10ml.
Huperzia serrata endogenetic epiphyte the most according to claim 1 prepares the application of huperzine A.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410045032.3A CN103820332B (en) | 2014-02-07 | 2014-02-07 | Huperzia serrata endogenetic epiphyte and the methods and applications of product huperzine A thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410045032.3A CN103820332B (en) | 2014-02-07 | 2014-02-07 | Huperzia serrata endogenetic epiphyte and the methods and applications of product huperzine A thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103820332A CN103820332A (en) | 2014-05-28 |
| CN103820332B true CN103820332B (en) | 2016-08-17 |
Family
ID=50755627
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410045032.3A Active CN103820332B (en) | 2014-02-07 | 2014-02-07 | Huperzia serrata endogenetic epiphyte and the methods and applications of product huperzine A thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103820332B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107868757B (en) * | 2017-07-03 | 2020-10-20 | 浙江工业大学 | Endophytic fungi and application thereof |
| CN114848689B (en) * | 2022-05-12 | 2023-04-07 | 暨南大学 | Herba Lycopodii Serrati effective component, its preparation method and application in preparing medicine for preventing or treating senile dementia |
-
2014
- 2014-02-07 CN CN201410045032.3A patent/CN103820332B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| A novel endophytic huperzine A-producing fugus, Shirala sp. Slf14,isolated from Huperzia serrata;Zhu D,et al;《J. Appl. Microbiol.》;20101231;第109卷;1469-1478 * |
| 产生物碱和石杉碱甲石杉科植物内生真菌的研究;苏经迁;《中国优秀硕士学位论文全文数据库》;20120515(第2012/05期);第E057-56页 * |
| 蛇足石杉内生真菌的分离和抗植物病原真菌活性;龚玉霞等;《安徽师范大学学报( 自然科学版)》;20071130;第30卷(第6期);689-692 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103820332A (en) | 2014-05-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11459593B2 (en) | Dendrobium officinale endophytic fungus strain and extracellular polysaccharide produced thereby, and extraction method and application of extracellular polysaccharide | |
| CN103740606B (en) | Plant raw streptomycete and produce antibiotic promise and irrigate method and the application of nest mycin | |
| CN109082382A (en) | Cordyceps sinensis Hirsutella sinensis ZJB18002 and its application | |
| CN109439550A (en) | The gingko endogenous ball Tuber Melanosporum of one plant of anti-ginger Ralstonia solanacearum and its application | |
| CN106010980B (en) | A kind of endogenetic fungus Brazil class shell roundlet spore bacterial strain and its application | |
| CN108865895A (en) | Paecilomyces hepiali chen ZJB18001 and its application | |
| CN103820331B (en) | Phlegmariurus endogenetic fungus and the methods and applications of product huperzine A thereof | |
| CN103724190B (en) | Compound EngyodontiuminA in the secondary fungus metabolite of a kind of deep-sea, preparation method and its usage | |
| CN103820332B (en) | Huperzia serrata endogenetic epiphyte and the methods and applications of product huperzine A thereof | |
| CN103834577B (en) | The methods and applications of phlegmariurus mycorrhizal fungi and product selagine thereof | |
| CN110024696A (en) | Huang covers small crisp handle mushroom and the application in preparation natural bacteriostatic agent | |
| CN103103134B (en) | Huperzia serrata endophytic fungi and its use in production of huperzine a | |
| CN105420119B (en) | Ginseng endogenetic fungus and its application | |
| CN109234175A (en) | The Fusarium oxysporum DCLZJ-4 bacterial strain and application thereof of one plant of production chonglou saponin | |
| CN104726379B (en) | The superior strain W 273 of one plant of biological pesticide Wuyiencin and its application | |
| CN104774774B (en) | One plant of production pseurotin A glycyrrhiza endophytic fungi | |
| CN101293886B (en) | Preparing method and application of white banksia rose endogenetic epiphyte product of snail optical black shell bacterium ketone A | |
| CN109161488A (en) | One plant height produces Irpex lacteus strain and its cultural method of cordycepin | |
| CN104593267B (en) | Monascus purpureus and its application in 1 DNJ is prepared | |
| CN108085273A (en) | One plant of streptomyces antifungus and its metabolin, metabolin preparation method and application | |
| CN108949867B (en) | Method for preparing actitoxin by fermenting marine bacteria | |
| CN102911877B (en) | Marine fungi cladosporium sphaerospermum and application thereof | |
| CN102851216B (en) | Aspergillus fumigatus and its use in microbial preparation of (R,R)-3-phenylglcidol | |
| CN105837590A (en) | Compound with anti-Candida albicans activity, preparation method and application thereof | |
| CN107254504A (en) | A kind of method that microbial bacterial agent improves lamp-dish flower acetic content |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |