CN102718848A - Recombinant protein of mycobacterium tuberculosis Rv 3120, preparation method and application in cellular immunological diagnosis thereof - Google Patents
Recombinant protein of mycobacterium tuberculosis Rv 3120, preparation method and application in cellular immunological diagnosis thereof Download PDFInfo
- Publication number
- CN102718848A CN102718848A CN2012101796616A CN201210179661A CN102718848A CN 102718848 A CN102718848 A CN 102718848A CN 2012101796616 A CN2012101796616 A CN 2012101796616A CN 201210179661 A CN201210179661 A CN 201210179661A CN 102718848 A CN102718848 A CN 102718848A
- Authority
- CN
- China
- Prior art keywords
- recombinant protein
- seq
- mycobacterium tuberculosis
- sequence
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention provides a recombinant protein of a mycobacterium tuberculosis specific marker Rv 3120. The recombinant protein comprises an amino acid sequence as shown in SEQ ID NO.1. The invention also provides a coding nucleotide sequence of the recombinant protein of the mycobacterium tuberculosis Rv 3120, a preparation method of the recombinant protein, and an application of the recombinant protein. According to the invention, a mycobacterium tuberculosis immunodominant antigen Rv 3120 is first reported on the basis of the research results of immunomics. The mycobacterium tuberculosis immunodominant antigen Rv 3120 is applied to the cellular immunological diagnosis of tuberculosis, and has relatively high sensibility; and moreover, compared with conventional skin test, the mycobacterium tuberculosis immunodominant antigen Rv 3120 has the advantages of faster performance, safety and reliability.
Description
Technical field
The invention belongs to biological medicine external diagnosis reagent field, recombinant protein, its preparation method and the application in diagnosis of cell mediated immunity thereof of particularly a kind of novel tuberculosis immunological marker thing Rv3120.
Background technology
White plaque is by pathogenic agent---and due to the m tuberculosis infection body, still be human important transmissible diseases so far.Diagnose mycobacterium tuberculosis (MTB) to infect fast and accurately, significant for control lungy.MTB diagnosis of infection method has a lot, and at present clinical method the most commonly used still relies on traditional phlegm smear bacteriology checking, but recall rate is low; MTB cultivates " gold standard " that can make a definite diagnosis as white plaque, but its incubation time is oversize, in general 4-6 week, is difficult to meet clinical needs; Though the Bactec technology has shortened incubation time, expense is higher, is difficult in the short period of time popularize; X line and CT examination only provide the diagnosis of iconography possibility; Polymerase chain reaction (PCR) technology and other gene diagnosis method remain at complicated operation as clinical diagnosis, and be higher to technology and personnel specialty competency profiling, and still can not be used for the cloudy quick diagnosis lungy of bacterium.The tuberculosis immunity mainly is a cellular immunization, comprises the T lymphocyte of sensitization and the scavenger cell that is activated.The T lymphocyte of sensitization can directly kill the target cell that has tubercule bacillus, and simultaneously to discharging the multiple phagocytal lymphokine of generation that acts on, making scavenger cell accumulate in focus formation on every side is main proliferative inflammation with the monocyte.The scavenger cell that is activated greatly strengthens the digestion of engulfing to tubercule bacillus, suppresses breeding, stops diffusion, even the ability of destroying, and fully divides the effect of waving cellular immunization.The white plaque diagnosis of cell mediated immunity technology of widespread use at present still depends on the skin test detection reagent---mycobacterium tuberculosis purified protein derivative (PPD).Yet there is the cross reaction with environment mycobacterium and BCG vaccine strain in PPD, so diagnostic value is on the low side.Thereby find new white plaque cellular immunization mark, and to set up new white plaque diagnosis of cell mediated immunity method be that diagnosis of tuberculosis is needed badly.
Summary of the invention
For overcoming the problems referred to above of the prior art; An object of the present invention is to provide a kind of mycobacterium tuberculosis Rv3120 recombinant protein; Its aminoacid sequence is shown in SEQ ID NO:1; Through using the pET32a plasmid, one section TrxTaq and STaq fusion tag and HisTag purification tag have been added in this native protein sequence front of Rv3120.
The aminoacid sequence of said TrxTaq and STaq fusion tag and HisTag purification tag is by forming from N-terminal the 1st to the 153rd amino acids residue sequence among the SEQ ID NO:1.Form natural Rv3120 Argine Monohydrochloride sequence from N-terminal the 154th to the 353rd amino acids residue sequence among the SEQ IDNO:1.
Another object of the present invention provides a kind of nucleotide sequence of Rv3120 recombinant protein of encoding above-mentioned, its have be selected from following c), d) or nucleotide sequence e):
C) nucleotide sequence shown in the SEQ ID NO:2;
D) be different from SEQ ID NO:2 but the amino acid sequence coded aminoacid sequence identical nucleotide sequence coded with SEQ ID NO:2;
E) under stringent hybridization condition with above-mentioned c) or d) in sequence hybridization, and coding has an active nucleotide sequence of said Rv3120 recombinant protein.
Another object of the present invention is to provide the preparation method of described mycobacterium tuberculosis Rv3120 recombinant protein, it is characterized in that, may further comprise the steps:
(1) preparation mycobacterium tuberculosis strain gene group DNA;
(2) amplification Rv3120 gene;
(3) the Rv3120 gene inserts expression plasmid;
(4) expression plasmid that makes up is transformed into host cell;
(5) abduction delivering albumen Rv3120;
(6) separation and purification abduction delivering product obtains the Rv3120 recombinant protein,
Wherein, the primer that in preparation mycobacterium tuberculosis Rv3120 gene, adopts is Rv3120-F and Rv3120-R, and the nucleotide sequence of said primer Rv3120-F is shown in SEQ ID No:3, and the nucleotide sequence of said primer Rv3120-R is shown in SEQ ID No:4.
Another object of the present invention is to provide the application of said mycobacterium tuberculosis Rv3120 recombinant protein in the reagent of preparation detection or diagnosis of tuberculosis.The gene primer of said Rv3120 recombinant protein is Rv3120-F and Rv3120-R, and the nucleotides sequence of said Rv3120-F is classified as shown in SEQ ID No:3, and the nucleotides sequence of said Rv3120-R is classified as shown in SEQ ID No:4.
Another object of the present invention is to provide the application in preparation white plaque detection kit of said mycobacterium tuberculosis Rv3120 recombinant protein, its specific antibody or its gene primer.The gene primer of said Rv3120 recombinant protein is Rv3120-F and Rv3120-R, and the nucleotides sequence of said Rv3120-F is classified as shown in SEQ ID No:3, and the nucleotides sequence of said Rv3120-R is classified as shown in SEQ ID No:4.
Another object of the present invention is to provide a kind of white plaque detection kit, the detection antigen in its component is said mycobacterium tuberculosis Rv3120 recombinant protein.
The purpose of this invention is to provide a kind of recombinant plasmid that comprises said mycobacterium tuberculosis Rv3120 gene.
Another object of the present invention provides a kind of novel tuberculosis diagnostic reagent, and it contains said mycobacterium tuberculosis Rv3120 recombinant protein.
A further object of the present invention provides the preparation method of mentioned reagent.
One aspect of the present invention provides a kind of recombinant plasmid that comprises said mycobacterium tuberculosis Rv3120 gene, is about to the Rv3120 gene order and inserts in the commercial expression plasmid sequence.The Rv3120 gene NCBI number of landing is: NC_000962.2; Albumen number is: CAB08377.1.
" Rv3120 gene order " of the present invention also comprises one or more codons among the NC_000962.2 is encoded that the degenerate codon of same amino acid replaces the back and the sequence that produces.Because the degeneracy of codon, so be low to moderate about 70% the degenerate sequence identical aminoacid sequence of also encoding with the NC_000962.2 nucleotide sequence homology.This term also is included under the tight condition of moderate, more preferably under highly tight condition with the nucleotide sequence of the nucleotide sequence hybridization of NC_000962.2.This term also comprises the nucleotide sequence homology at least 70% with NC_000962.2, more preferably at least 90% nucleotide sequence.
Recombinant plasmid of the present invention, the MCS place with Rv3120 gene insertion expression plasmid obtains usually.
Recombinant plasmid of the present invention can be selected various carrier known in the art for use in the preparation process, be connected in expression regulation sequence with will encoding nucleotide sequence operability of the present invention then, thereby forms protein expression vector.
Adoptable carrier has pET32a etc. among the present invention.In one embodiment of the present of invention, used plasmid is pET32a.
Another aspect of the present invention provides a kind of mycobacterium tuberculosis recombinant protein of being correlated with, and this albumen changes the recombinant expression plasmid that inserts the Rv3120 gene over to host cell and obtains.
Rv3120 recombinant protein as detection reagent is compared with the CAB08377.1 protein sequence on the NCBI, has added carrier correlated series and purification tag.For example, when using the pET32a plasmid, the protein sequence front has added one section TrxTaq and STaq fusion tag and the one section His Tag purification tag on the pET32a.
Used host cell should be complementary with expression plasmid.Can use prokaryotic cell prokaryocyte or eukaryotic cell etc., intestinal bacteria (E.coli) for example commonly used.Being used for transformed host cells can be BL21 (DE3) or BL21 plysS (DE3) bacterial strain etc.Used in one embodiment of the present of invention is exactly BL21 plysS (DE3) bacterial strain.
Another aspect of the present invention provides the preparation method of above-mentioned mycobacterium tuberculosis GAP-associated protein GAP, may further comprise the steps:
(1) preparation of mycobacterium tuberculosis strain gene group DNA;
(2) amplification of Rv3120 gene;
(3) the Rv3120 gene inserts expression plasmid;
(4) expression plasmid that makes up is transformed into host cell;
(5) abduction delivering albumen Rv3120;
(6) separation and purification abduction delivering product obtains the Rv3120 recombinant protein.
Among the above-mentioned preparation method, various experiment parameters are all selected by routine operation, are decided by concrete experiment condition.
Rv3120 gene order of the present invention can use the pcr amplification method to obtain.Can related nucleotide sequences disclosed according to the present invention, especially open reading frame sequence designs primer, and uses the prepared genomic dna of ordinary method well known by persons skilled in the art to be template, amplification and obtain correlated series.
Among the present invention, the used expression plasmid of recombinant protein can be pET32a etc.
In one embodiment of the present of invention, recombinant protein Rv3120 obtains as follows: design primer (Rv3120-F (SEQ ID No:3): CAA
GGTACCATGAGTCCGTCTCCATCG; Rv3120-R (SEQ ID No:4): CCT
AAGCTTCTACAGTGACCGTTGGGC)
DNA is a template with H37Rv pnca gene group, pcr amplification Rv3120 gene, and the purified back of the PCR product of this gene double digestion, the clone makes up plasmid.Order-checking shows among the sequence inserted and the GeneBank that (the Rv3120 gene NCBI number of landing is NC_000962.2 to the corresponding gene order of the full genome of H37Rv tuberculosis; Albumen number is: CAB08377.1) in full accord.The recombinant plasmid transformed that checking is good is carried out protein expression to host cell.
Among the present invention, expressing the used host cell of Rv3120 albumen is colibacillary BL21 (DE3) bacterial strain or BL21 plysS (DE3) bacterial strain.
Among the present invention, abduction delivering Rv3120 albumen can adopt several different methods, as using sec.-propyl-β-D-sulfo-galactopyranoside (IPTG).
Among the present invention, separation and purification reorganization Rv3120 albumen also can adopt several different methods, like affinity chromatography, ion exchange chromatography etc.
In one embodiment of the present of invention; Reorganization Rv3120 albumen can obtain as follows: will identify that good recombinant plasmid joins in the competent escherichia coli cell; Place 45min on ice; Thermal shock is 90 seconds in 42 ℃ of water-baths, ice bath 3min, the LB substratum that does not contain antibiotic preheating of adding 500ul.37 ℃ of shaking tables, 220rmp cultivates 45-60min.Get and a certain amount ofly be coated with containing on the solid LB substratum plate of kantlex, be inverted in overnight cultures in 37 ℃ of incubators after the drying at room temperature.Picking is cloned, and puts into the LB liquid nutrient medium of the resistance that contains the 50ug/ml kantlex, and 220rmp cultivates about OD to 0.6 for 37 ℃, adds IPTG, and 37 ℃ of 3h collect the thalline after IPTG induces, resuspended back ultrasonication.Target protein is contained in the supernatant, and the centrifugal 30min of 10000g collects supernatant.(2CV deionized water rinsing, 5CV contain the washing BufferI balance of 5mM imidazoles, and 6CV contains appearance on the target protein supernatant to carry out affinity purification with the IMAC affinity chromatographic column; 6CV contains the washing Buffer I flushing of 5mM imidazoles; 6CV contains washing Buffer 2 flushing of 10mM imidazoles, and 10CV contains the Elution Buffer wash-out of 500mM imidazoles), collected the target protein of column purification; Use 20mM Tris-HCl; The solution dialysis of pH 8.0,10kDa ultrafiltration pipe concentrates the target protein liquid after dialysing, with the concentration of target protein behind the BCA method mensuration purifying.
Another aspect of the present invention provides the application of recombinant protein Rv3120 in diagnosis of tuberculosis.
Rv3120 is the member of molybdenum cofactor biosynthesizing albumen E, is positioned at the RD5 district.Recombinant protein of the present invention is used for the preparation of white plaque detection kit, can carry out immunoreation with reorganization Rv3120, also can carry out PCR to the blood samples of patients extract with the Rv3120 gene primer, thereby reach testing goal.
The invention provides a kind of detection diagnostic method lungy, it contains recombinant protein Rv3120.
The local cytokine that produces after method of the present invention mainly is upset based on ELISPOT detection principle cell, this cytokine is caught by specific monoclonal antibody.After cell decomposed, captive cytokine and biotin labeled two resistive connections closed, and combine with the avidin of alkali phosphatase enzyme mark more thereafter.After the BCIP/NBT substrate was hatched, the spot that " purple " appears in the PVDF orifice plate showed that cell has produced cytokine, through obtaining a result after the analysis of ELISPOT enzyme couplet spot analysis system to spot.
Its implementation method reference implementation example 3.
Compare with natural mycobacterium tuberculosis Rv3120 albumen; This recombinant protein more is prone to adopt the method for affinity chromatography to carry out purifying, and purity can reach more than 90%, not only greatly reduces its production cost; And has higher stability; This recombinant protein under not freeze dried situation 4 ℃ can preserve for 1 week, can preserve 3 months for-20 ℃, preserved at least 1 year for-80 ℃.
The present invention is based on the achievement in research of immune group; Reported first the Rv3120 specific antigens can be applied to diagnosis of tuberculosis; And be the T cellular targets antigen that activity is stronger, be used for the diagnosis of white plaque cellular immunology, it is high to have higher susceptibility; And compare the skin test test, more quick and safe and reliable.
Description of drawings
Fig. 1 is the SDS-PAGE figure of recombinant protein Rv3120 after being further purified and concentrating.The 1st, molecular weight of albumen standard, the 2nd, the target protein (5 μ g) after purifying concentrates, the 3rd, the target protein (2.5 μ g) after purifying concentrates.
Fig. 2 is antigen ESAT6, CFP10, Rv3120 and control group test.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in the restriction scope of the present invention.Others of the present invention are because the disclosure of this paper is conspicuous to those skilled in the art, the experimental technique of unreceipted actual conditions in the following example, and usually according to normal condition, or the condition of advising according to manufacturer.Unless otherwise indicated, otherwise per-cent and umber calculate by weight.
Only if definition separately, the same meaning that employed all specialties and scientific words and one skilled in the art are familiar with in the literary composition.In addition, any with the institute similar content of putting down in writing or the equalization method and material all can be applicable among the present invention.The usefulness that preferable implementation method described in the literary composition and material only present a demonstration, but can not limit the content of this aspect.
The structure of embodiment 1 recombinant plasmid pET32a-Rv3120
(1) target gene design of primers
Rv3120-F（SEQ?ID?No:3）：CAA
GGTACCATGAGTCCGTCTCCATCG
Rv3120-R（SEQ?ID?No:4）：CCT
AAGCTTCTACAGTGACCGTTGGGC
Restriction enzyme site is respectively Kpn I, Hind III.
(2) pcr amplification of target gene, clone and sequencing
With mycobacterium tuberculosis H37Rv genomic dna is template, and Rv3120-F and Rv3120-R are primer, uses Taq enzyme (precious biotechnology (Dalian) ltd), through the PCR Rv3120 protein gene that directly increases.PCR reaction conditions: 94 ℃ of preparatory sex change 5min; (94 ℃, 30s; 58 ℃, 30s; 72 ℃, 40s) 35 circulations; 72 ℃ are extended 5min; 4 ℃ of preservations.Reaction finishes the back and separates the purpose fragment with 1% agarose gel electrophoresis, and the back is reclaimed test kit (Invitrogen) with DNA and reclaimed.Cut with Kpn I and Hind III enzyme, the clone is built in pET32a plasmid Kpn I and the Hind III restriction enzyme site.Order-checking shows among the sequence inserted and the GeneBank that (the Rv3120 gene NCBI number of landing is the full genome corresponding gene sequences of H37Rv tuberculosis: NC_000962.2; Albumen number is: CAB08377.1) in full accord.
Abduction delivering and the purifying of embodiment 2 recombinant protein Rv3120
The reorganization pET32a-Rv3120 plasmid that 0.5ul checks order correct is put into 100ul e. coli bl21 (DE3) physS competent cell (TIANGEN), place 45min on ice, in 42 ℃ of water-baths; Thermal shock 90s; Leave standstill 3min on ice, add the LB substratum that does not contain antibiotic preheating of 500ul, 37 ℃ of shaking tables; 220rmp cultivates 45-60min.Get and a certain amount ofly be coated with containing on the solid LB substratum plate of kantlex, be inverted in overnight cultures in 37 ℃ of incubators after the drying at room temperature.The picking clone; Put into the LB liquid nutrient medium of the resistance that contains the 50ug/ml kantlex, 220rmp cultivates about OD to 0.6 for 37 ℃; Adding final concentration is 10mM IPTG; 37 ℃ of 3h collect the thalline after IPTG induces, in the resuspended back ultrasonication of the ratio of the wet bacterium of the every gram of 10ml Washing Buffer I.Target protein is contained in the supernatant as a result.The centrifugal 30min of 10000g collects supernatant.(2CV deionized water rinsing, 5CV contain the washing Buffer I balance of 5mM imidazoles, and 6CV contains appearance on the target protein supernatant to carry out affinity purification with IMAC affinity chromatographic column (Bio-Rad); 6CV contains the washing Buffer I flushing of 5mM imidazoles, and 6CV contains washing Buffer 2 flushings of 10mM imidazoles, and 10CV contains the Elution Buffer wash-out of 500mM imidazoles); Collected the target protein (as shown in Figure 1) of column purification; Use 20mM Tris-HCl, the solution dialysis of pH 8.0,10kDa ultrafiltration pipe concentrates the target protein liquid after dialysing; With the concentration of target protein behind the BCA method mensuration purifying, SDS-PAGE electrophoretic analysis target protein purity.
Behind the recombinant protein nickel post affinity purification of present embodiment, purity can reach more than 90%, not only greatly reduces its production cost; And has higher stability; This recombinant protein under not freeze dried situation 4 ℃ can preserve for 1 week, can preserve 3 months for-20 ℃, preserved at least 1 year for-80 ℃.
Concrete steps are:
Operation steps:
1, sample collection: the about 5ml of aseptic collection human peripheric venous blood can preserve under room temperature after the sample collection to the anticoagulant heparin pipe, is not placed on refrigeration or refrigeration chamber; And marked.
2, separation, collection and the counting of the single karyolymph cell of peripheral blood:
A, get the whole blood of 5ml, add isopyknic RTPMI-1640 serum-free medium, and mixing.
B, get the lymphocyte separation medium that 15ml centrifuge tube adds 4ml, and the blood sample of mixing is slowly joined the surface of lymphocyte separation medium, boundary is between the two wanted obviously, mixing not, and the tight pipe lid of lid is handled with care.
C, centrifuge tube is put into horizontal centrifuge, 1000g, room temperature, centrifugal 22min carefully takes out the visible blood ingredient layering in back.
D, single karyolymph cellular layer is transferred in the new 15ml centrifuge tube with Dispette; And adding 10ml RTPMI-1640 serum-free medium carries out mixing; Put into whizzer 600g centrifuge washing 10min, adding serum-free medium, the centrifugal 10min of 350g;
E, taking-up centrifuge tube are abandoned supernatant, and the RPMI-1640 that adds 400 μ l contains the serum nutrient solution, and piping and druming cell mixing wants soft during piping and druming, avoid cell to receive the damage of external force as far as possible.
F, (Sysmex carries out LC on XT-2000i) in automatic counter for counting to get 120ul.
G, adjustment cell concn to 2.5 * 10
6/ ml prepares 500 μ l;
3, the activation of plate: 200 μ l/wellRPMI-1640 contain the serum nutrient solution, and 5-10min topples over.
4, according to the experimental design arrangement: each detects sample and needs 2 holes, adds different sample cells 100 μ l/well.
Negative control: every hole adds 10 μ lRPMI-1640 and contains the serum nutrient solution
Positive control: every hole adds 10 μ lPHA
Test hole a: every hole adds 10 μ l mycobacterium tuberculosis specific antigens ESAT6 (according to the ordinary method preparation of hereinafter) 5ug/ml
Test hole b: every hole adds 10 μ l mycobacterium tuberculosis specific antigens CFP10 (according to the ordinary method preparation of hereinafter) 5ug/ml
Stimulator antigen: every hole adds 10ul mycobacterium tuberculosis recombinant antigen Rv312010ug/ml
Wherein:
Mycobacterium tuberculosis specific antigens ESAT6 and CFP10 are existing diagnostic antigens commonly used, and the conventional preparation method of ESAT6 and CFP10 recombinant protein is: with the mycobacterium tuberculosis genomic dna is template, make up pET21a-esat6 or Pet32a-cfp10 recombinant plasmid with proteic Auele Specific Primer by conventional gene engineering method; Change e. coli bl21 (DE3) physS expression strain over to; 1mMIPTG induces 3h can obtain a large amount of recombinant proteins for 37 ℃, and its purity of nickel post affinity purification reaches more than 90%, and recombinant protein is used 20mM Tris-HCl; PH 8.0 dialysis back ultrafiltration and concentration; The BCA method detects protein concentration, presses the packing of 1mg/ pipe, and freeze-drying is preserved.
5, after adding all samples, cover the plate lid, put into 37 ℃, 5%CO
2Incubator is cultivated 16-20hr (17h);
6, half hour before taking out culture plate, be ready to clap water paper, loading slot (washing lotion), wash bottle, balance under 50 * washing lotion placement room temperature prepared 1 * Washing buffer for a moment, decides according to experimental program.
7, wash plate: topple over liquid in the hole, 1 * Washing buffer of 200 μ l/well washs 5 times, and each 30sec claps and does, and firmly clap, and claps clean; The PBS washing lotion;
8, add and dilute good enzyme labelled antibody, 50 μ l/well, 4 ℃ of incubators are hatched 1hr; The single stage method reaction.
9, wash plate: topple over liquid in the hole, 1 * Washing buffer of 200 μ l/well washs 5 times, and each 30sec claps and does, and firmly clap, and claps clean;
10, colour developing: add the colour developing liquid prepare, 100 μ l/well, the room temperature 7min that keeps in Dark Place;
11, treat that spot grows into suitable size after, with deionized water wash 2 times, the color development stopping process.Clap to do and take off resist afterwards, dry naturally.Plate is not placed in the baking box, prevented that the film embrittlement from breaking; Also can directly use directly flushing with tap water, but can not be with the hole directly facing to current, and should be with the endways water flushing of plank, current will ease up, and can lath be taken off, and dry after washing the bottom surface gently, place and treat that nature dries.
The various parameters of 12, ELISPOT plate spot counting, and record spot are done statistical study (as shown in Figure 2).
The result judges: then be judged to be positive findings when test hole A or B reach following standard:
(1), deducts negative control hole spot number >=6 with the spot number of test hole A or B if negative control hole spot number is 0-5;
(2) if negative control hole spot number >=6, the spot number of test hole A or B must be greater than 2 times negative control hole spot number.
The result explains: the positive findings prompting detects in the sample and contains to the special effector T cell of mycobacterium tuberculosis; The negative findings prompting detects in the sample and does not contain to the special effector T cell of mycobacterium tuberculosis.Table 2 is recombinant protein Rv3120 and existing ESAT6, and CFP10 stimulates clinical samples to produce the sensitized T lymphocyte experimental result respectively.
Table 1ELISPOT test design
Table 2
Recombinant protein Rv3120 and ESAT6, CFP10 stimulate the lymphocytic ELISPOT experimental result of clinical samples T case load 67 respectively
The result of table 2 shows that the Rv3120 recombinant protein antigen is stimulating clinical samples to produce in the detection of responsiveness T lymphocyte, and the susceptibility of its detection is 82.1% (32/39), and specificity is 92.9% (26/28).Its susceptibility is lower than CFP10 antigen 94.9% (37/39), but is higher than ESAT6 antigen 76.9% (30/39), and overall specificity is a little less than CFP10 antigen 96.4% (27/28) and ESAT6 antigen 96.4% (27/28).
Rv3120 recombinant protein of the present invention can also can use with existing known diagnostic antigen combination, thereby improve the detection sensitivity to the latent tuberculosis patient separately as diagnostic reagent.
Except that the foregoing description, the present invention can also have other embodiment.The technical scheme of replacement or equivalent transformation formation is modified, is changed, is equal in all employings, all falls in protection scope of the present invention.
Claims (9)
1. mycobacterium tuberculosis Rv3120 recombinant protein; It is characterized in that; Its aminoacid sequence through using the pET32a plasmid, has added one section TrxTaq and STaq fusion tag and HisTag purification tag in this native protein sequence front of Rv3120 shown in SEQ ID NO:1.
2. Rv3120 recombinant protein according to claim 1 is characterized in that, the aminoacid sequence of said TrxTaq and STaq fusion tag and HisTag purification tag is by forming from N-terminal the 1st to the 153rd amino acids residue sequence among the SEQ ID NO:1.
3. the nucleotide sequence of the Rv3120 recombinant protein of encode claim 1 or 2, it is characterized in that having be selected from following c), d) or nucleotide sequence e):
C) nucleotide sequence shown in the SEQ ID NO:2;
D) be different from SEQ ID NO:2 but the amino acid sequence coded aminoacid sequence identical nucleotide sequence coded with SEQ ID NO:2;
E) under stringent hybridization condition with above-mentioned c) or d) in sequence hybridization, and coding has an active nucleotide sequence of said Rv3120 recombinant protein.
4. the preparation method of mycobacterium tuberculosis Rv3120 recombinant protein according to claim 1 and 2 is characterized in that, may further comprise the steps:
(1) preparation mycobacterium tuberculosis strain gene group DNA;
(2) amplification Rv3120 gene;
(3) the Rv3120 gene inserts expression plasmid;
(4) expression plasmid that makes up is transformed into host cell;
(5) abduction delivering albumen Rv3120;
(6) separation and purification abduction delivering product obtains the Rv3120 recombinant protein,
Wherein, the primer that in preparation mycobacterium tuberculosis Rv3120 gene, adopts is Rv3120-F and Rv3120-R, and the nucleotide sequence of said primer Rv3120-F is shown in SEQ ID No:3, and the nucleotide sequence of said primer Rv3120-R is shown in SEQ ID No:4.
5. claim 1 or the 2 described mycobacterium tuberculosis Rv3120 albumen application in the reagent of preparation detection or diagnosis of tuberculosis.
6. application according to claim 5; It is characterized in that; The gene primer of said Rv3120 recombinant protein is Rv3120-F and Rv3120-R, and the nucleotides sequence of said Rv3120-F is classified as shown in SEQ ID No:3, and the nucleotides sequence of said Rv3120-R is classified as shown in SEQ ID No:4.
7. claim 1 or 2 described mycobacterium tuberculosis Rv3120 recombinant proteins, its specific antibody or its gene primer application in preparation white plaque detection kit.
8. application according to claim 7; It is characterized in that; The gene primer of said Rv3120 recombinant protein is Rv3120-F and Rv3120-R, and the nucleotides sequence of said Rv3120-F is classified as shown in SEQ ID No:3, and the nucleotides sequence of said Rv3120-R is classified as shown in SEQ ID No:4.
9. a white plaque detection kit is characterized in that, the detection antigen in its component is claim 1 or 2 described mycobacterium tuberculosis Rv3120 recombinant proteins.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012101796616A CN102718848A (en) | 2012-06-01 | 2012-06-01 | Recombinant protein of mycobacterium tuberculosis Rv 3120, preparation method and application in cellular immunological diagnosis thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012101796616A CN102718848A (en) | 2012-06-01 | 2012-06-01 | Recombinant protein of mycobacterium tuberculosis Rv 3120, preparation method and application in cellular immunological diagnosis thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102718848A true CN102718848A (en) | 2012-10-10 |
Family
ID=46944739
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012101796616A Pending CN102718848A (en) | 2012-06-01 | 2012-06-01 | Recombinant protein of mycobacterium tuberculosis Rv 3120, preparation method and application in cellular immunological diagnosis thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102718848A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103884847A (en) * | 2014-03-14 | 2014-06-25 | 中国科学院生物物理研究所 | Mycobacterium M. tuberculosis holoprotein chip and application thereof |
| CN110156886A (en) * | 2019-05-13 | 2019-08-23 | 成都仁钦生物科技有限公司 | The marker and its detection method of mycobacterium tuberculosis infection and application |
| US20190293645A1 (en) * | 2016-09-22 | 2019-09-26 | Pace Diagnostics, Inc. | Mycobacterium tuberculosis proteins in diagnostic assays and devices for tuberculosis detection and diagnosis |
| CN110423279A (en) * | 2019-06-20 | 2019-11-08 | 扩增生物科技(北京)有限公司 | Mycobacterium tuberculosis recombinant fusion protein EECC and its preparation method and application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1807456A (en) * | 2005-01-19 | 2006-07-26 | 上海赛金生物医药有限公司 | Recombinant human parathormone PTH1-34 preparation method |
| CN1888069A (en) * | 2006-07-13 | 2007-01-03 | 复旦大学 | Recombinant protein Rv3425 and its application of in preparing tuberculosis kit |
| CN101235090A (en) * | 2008-01-31 | 2008-08-06 | 复旦大学 | Specificity fusion protein applied to tuberculosis rapid diagnosis |
-
2012
- 2012-06-01 CN CN2012101796616A patent/CN102718848A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1807456A (en) * | 2005-01-19 | 2006-07-26 | 上海赛金生物医药有限公司 | Recombinant human parathormone PTH1-34 preparation method |
| CN1888069A (en) * | 2006-07-13 | 2007-01-03 | 复旦大学 | Recombinant protein Rv3425 and its application of in preparing tuberculosis kit |
| CN101235090A (en) * | 2008-01-31 | 2008-08-06 | 复旦大学 | Specificity fusion protein applied to tuberculosis rapid diagnosis |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103884847A (en) * | 2014-03-14 | 2014-06-25 | 中国科学院生物物理研究所 | Mycobacterium M. tuberculosis holoprotein chip and application thereof |
| CN103884847B (en) * | 2014-03-14 | 2015-08-26 | 中国科学院生物物理研究所 | A kind of Much's bacillus holoprotein chip and application |
| US20190293645A1 (en) * | 2016-09-22 | 2019-09-26 | Pace Diagnostics, Inc. | Mycobacterium tuberculosis proteins in diagnostic assays and devices for tuberculosis detection and diagnosis |
| CN110156886A (en) * | 2019-05-13 | 2019-08-23 | 成都仁钦生物科技有限公司 | The marker and its detection method of mycobacterium tuberculosis infection and application |
| CN110423279A (en) * | 2019-06-20 | 2019-11-08 | 扩增生物科技(北京)有限公司 | Mycobacterium tuberculosis recombinant fusion protein EECC and its preparation method and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102175875B (en) | Detection kit for diagnosing tuberculosis | |
| CN113980145B (en) | Mycobacterium tuberculosis fusion protein and preparation method and application thereof | |
| CN102718848A (en) | Recombinant protein of mycobacterium tuberculosis Rv 3120, preparation method and application in cellular immunological diagnosis thereof | |
| CN105601747A (en) | Mycobacterium tuberculosis fusion protein and application thereof in induction of peripheral blood mononuclear cells to generate cytokines | |
| CN104805091B (en) | The expression and dedicated expression vector therefor of rh-insulin, engineering bacteria and application | |
| CN111705070B (en) | Evaluation and application of mycobacterium tuberculosis fusion protein in clinical diagnosis value of tuberculosis | |
| CN105567660A (en) | Escherichia coli recombinate expression method of mycobacterium tuberculosis Rv 2837c active protein and applications thereof | |
| CN102993278A (en) | Purification method of methicillin-resistant staphylococcus aureus (MRSA) vaccine recombinant protein antigen FnbA1 | |
| CN102718871A (en) | Recombinant protein of mycobacterium tuberculosis specific marker Rv 1284, preparation method and application thereof | |
| CN105524177A (en) | Mycobacterium tuberculosis specific fusion protein, and encoding gene and application thereof | |
| CN103063843A (en) | Specific marker of mycobacterium tuberculosis and application thereof | |
| CN102898511A (en) | Purification method in preparation of methicillin staphylococcus aureus-resistant recombinant genetic engineering vaccine candidate antigen I12C | |
| CN105131094A (en) | Mycobacterium tuberculosis Rv 3248 c recombinant protein, preparation method and application of mycobacterium tuberculosis Rv 3248 c recombinant protein | |
| CN105294844A (en) | Mycobacterium tuberculosis Rv3457c recombinant protein as well as preparation method and application thereof | |
| CN103509100B (en) | A kind of IL-1 R antagonist mutant | |
| CN101805397A (en) | Mycobacterium tuberculosis ESAT-6 recombinant dipolymer, preparation method and application thereof | |
| CN103387604A (en) | CD8+T cell epitope polypeptide of S1 protein of chicken IBV (Infectious Bronchitis Virus) S1 protein | |
| CN104151411B (en) | Albumen and pharmaceutical composition for diagnosis of tuberculosis | |
| CN105131095A (en) | Mycobacterium tuberculosis Rv 2991 recombinant protein, preparation method and application of mycobacterium tuberculosis Rv 2991 recombinant protein | |
| CN102174114B (en) | Whole blood INF-gamma specific antigen protein and preparation method and application thereof | |
| CN103257236A (en) | Application of specific CTL cell epitope peptide of HLA-A24 restrictive Mycobacterium tuberculosis | |
| CN102584962A (en) | Preparation method and application of mycobacterium tuberculosis Rv3117 recombinant protein | |
| CN104558145A (en) | Preparation methods for fetuin A recombinant protein and polyclonal antibody | |
| CN109490541A (en) | A kind of method for building up for the indirect ELISA detecting Brucella abortus HSP70 | |
| KR101270662B1 (en) | Diagnostic kits of Brucella abortus using 26kDa recombinant antigenic protein and Lipopolysaccaride |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20121010 |