CN102692500A - ANGPTL4 as a marker of liver cancer metastasis by serological detection and application thereof - Google Patents
ANGPTL4 as a marker of liver cancer metastasis by serological detection and application thereof Download PDFInfo
- Publication number
- CN102692500A CN102692500A CN2011100680425A CN201110068042A CN102692500A CN 102692500 A CN102692500 A CN 102692500A CN 2011100680425 A CN2011100680425 A CN 2011100680425A CN 201110068042 A CN201110068042 A CN 201110068042A CN 102692500 A CN102692500 A CN 102692500A
- Authority
- CN
- China
- Prior art keywords
- angptl4
- cell
- antibody
- kit
- albumen
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention relates to ANGPTL4 as a marker of liver cancer metastasis by serological detection and an application thereof. Specifically, the invention provides an application of angiopoietin-like protein 4(ANGPTL4 protein) in (a) the preparation of a diagnostic reagent or kit for the detection of liver cancer metastasis and (b) the preparation of a diagnostic reagent or kit for serological detection of liver cancer. The invention also provides a related detection kit. The invention also provides a method for inhibiting hepatoma cell metastasis by the use of an antagonist of the ANGPTL 4 protein.
Description
Technical field
The present invention relates to oncology and diagnostic field.More specifically, the present invention relates to a kind of serum markers that can be used for detecting hepatoma Metastasis and uses thereof.
Background technology
ANGPTL4 gene (this gene is by inventor's laboratory called after pp1158 at first) [Zhu Hongxin etc.; China's tumour magazine (2002) 24 (2): 123-125] be exactly the new gene that utilizes this functional screening technology platform from the human placenta cDNA library, to be cloned into; This gene cDNA total length is 1943bp; ORFs contains 1218bp, 406 amino acid of encoding, and estimated molecular weight is 45.2kDa.The N end has a hydrophobic signal peptide and (Coiled-Coil) domain that curls, and the C end has fibrin former state (Fibrinogen-like) domain.And at first the cDNA sequence of this gene (protogene is called pp1158) was logined (accession number is AF202636) on GenBank in 2000.At present with clone's such as Yoon PGAR [Mol.Cell.Biol., Jul 2000; 20:5343-5349] and clone's such as Kim HFARP [Biochem.J, 2000,346:603-610] to unify definite designation by HUGO be ANGPTL4 (angiopoietin-like 4).
The effect of ANGPTL4 in metastases more and more causes people's attention.Present research shows that ANGPTL4 is very complicated to the influence of metastases; Different effects is arranged in different tumours: the research to Lewis lung cancer cell and MC B16F0 shows that ANGPTL4 can be through the double influence to blood vessel and tumour cell; Promptly change blood vessel infiltration and tumour cell motion and invade the profit ability, suppress the transfer of tumour cell.In contrast; Current research in breast cancer shows; TGF β 1 induces the rise of ANGPTL4 in breast cancer, the ANGPTL4 of breast cancer cell secretion can destroy the connection between the endothelial cell, increases the perviousness of pulmonary capillary; Promote the migration of striding vascular endothelial cell of tumour cell, the lung that has started breast cancer with TGF β 1 jointly shifts.
(hepatocellular carcinoma is one of common cancer of China HCC) to primary hepatocyte hepatocarcinoma, occupies second of people's tumor mortality.The middle and advanced stages that belong to when symptom appears in liver cancer, excision back recurrence and metastasis rate is high more.Therefore, the early diagnosis of liver cancer (comprising cancer metastasis) is significant with reduction PLC mortality rate to the life span that prolongs the patient.
The diagnosis of liver cancer at present mainly relies on methods such as imaging examination, liver puncture histological examination, yet these detection methods all have certain limitation.Even for example well FNA still limitedly has higher false negative rate because of drawing materials, and there is the tumour of making to spread and the danger of needle track implantation.The serology detection technique of cancer is the emphasis of research always.Yet at present existing the detection to cancer (like HCC) still lacks gratifying blood serum designated object, more lacks the blood serum designated object that can be used for detecting or judging hepatoma Metastasis.
Therefore, this area presses for the blood serum special mark that exploitation can be used for detecting or judging hepatoma Metastasis.
Summary of the invention
The object of the invention just provides a kind of blood serum special mark that can be used for detecting or judging hepatoma Metastasis.
In first aspect of the present invention, the purposes of PP1158 4 (ANGPTL4 albumen) or its specific antibody is provided, they are used to prepare diagnostic reagent or the kit that detects hepatoma Metastasis by (a); And/or (b) be used to prepare diagnostic reagent or the kit that serum detects liver cancer.
In another preference, described ANGPTL4 albumen or its specific antibody coupling have or have a detectable label.
In another preference, said detectable label is selected from down group: chromophore, chemiluminescent groups, fluorophore, isotope or enzyme.
In another preference, said diagnostic reagent is a monoclonal antibody.
In another preference, described specific antibody is a monoclonal antibody.
In another preference, described detection hepatoma Metastasis is that serum detects.
In another preference, it is ELISA method or double antibodies sandwich time resolution immunofluorescence technique (TRFIA method) that described serum detects.
In second aspect of the present invention, a kind of diagnostic kit that is used to detect hepatoma Metastasis is provided, described kit contains a container, contains ANGPTL4 albumen or its specific antibody in the said container; And label or instructions, said label or instructions indicate said kit and are used for detection or diagnosing liver cancer transfer.
In another preference, indicate following content in described label or the instructions:
(i) if the serum ANGPTL4 concentration of detected object is higher than 93.5ng/ml, then the probability of this object generation liver cancer is greater than normal population; And/or
If (ii) the serum ANGPTL4 concentration of detected object is higher than 130ng/ml, then the probability of this object generation hepatoma Metastasis is greater than normal population (or general liver cancer patient).
In another preference, said liver cancer comprises hepatocellular carcinoma, especially primary hepatocyte hepatocarcinoma.
In another preference, described ANGPTL4 albumen or its specific antibody coupling have or have a detectable label.
In another preference, said detectable label is selected from down group: chromophore, chemiluminescent groups, fluorophore, isotope or enzyme.
In another preference, described antibody is monoclonal antibody.
In the third aspect of the invention, the purposes of a kind of PP1158 4 (ANGPTL4 albumen) is provided, it is used as the mark that serum detects hepatoma Metastasis.
In fourth aspect of the present invention, the purposes of the antagonist of a kind of PP1158 4 (ANGPTL4 albumen) is provided, it is used to prepare the medicine that suppresses the HCC transfer or is used to prepare the suppressant that suppresses the HCC transfer.
In another preference, described antagonist comprises siRNA, antisense RNA, antibody or its combination to ANGPTL4.
In should be understood that within the scope of the present invention, above-mentioned each technical characterictic of the present invention and hereinafter can mutual combination between specifically described each technical characterictic in (like embodiment), thus constitute new or optimized technical scheme.As space is limited, this tired no longer one by one stating.
Description of drawings
Fig. 1 has shown ANGPTL4 high expressed in the SMMC-7721 of high metastatic potential.Wherein, adopt quantitative PCR (a) and Western blot (c) to detect the expression of ANGPTL4 mRNA and albumen in each SMMC-7721 respectively; The method of employing ELISA (b) detects the expression of secreted ANGPTL4 albumen in the cell culture medium supernatant.The result shows SMMC-7721 (MHCC-LM3, MHCC-97, MHCC-97L, MHCC-97H) the middle high expressed of ANGPTL4 at high metastatic potential.
Fig. 2 has shown that exogenous expression ANGPTL4 promotes the migration of vascular endothelial cells of striding of Huh7 and SMMC-7721 HCC.Each is schemed as follows:
A.Western blot detects ANGPTL4 and secreted ANGPTL4 albumen (sANGPTL4) is the expression in Huh7-lenti-ANGPTL4 and SMMC-7721-lenti-ANGPTL4 and the corresponding control cells stablizing overexpressing cell.
B. adopt quantitative PCR detection ANGPTL4 stablizing the expression that overexpressing cell is ANGPTL4 mRNA in Huh7-lenti-ANGPTL4 and SMMC-7721-lenti-ANGPTL4 and the corresponding control cells.
C. adopt the ELISA method to detect the expression of secreted ANGPTL4 albumen in the cell culture medium supernatant.
D.Huh7-lenti-ANGPTL4 cell and control group Huh7-lenti-control cell cross migration of vascular endothelial cells are tested representative picture (scale is 100 μ m) and migrating cell is counted statistical graph (* refers to P＜0.001).
E.SMMC-7721-lenti-ANGPTL4 cell and control group SMMC-7721-lenti-control cell cross migration of vascular endothelial cells are tested representative picture (scale is 100 μ m) and migrating cell is counted statistical graph (* refers to P＜0.001).
Fig. 3 has shown that ANGPTL4 promotes to shift in the liver of SMMC-7721 cell in nude mouse and lung shifts.Shift in the liver of liver in-situ inoculating SMMC-7721-lenti-ANGPTL4 cell and corresponding cellular control unit thereof and lung transfer (left figure, scale are 100 μ m); Right figure is statistical graph (* refers to P＜0.05).
Fig. 4 has shown the level of people sANGPTL4 in the nude mice serum.Wherein, liver in-situ inoculating SMMC-7721-lenti-ANGPTL4 cell and corresponding cellular control unit thereof, people sANGPTL4 level in its serum of 6 weeks back detection.*P＜0.01
Fig. 5 has shown that interference ANGPTL4 and ANGPTL4 antibody all can suppress the migration of vascular endothelial cells of striding of MHCC-97L cell.Each is schemed as follows:
A. in the MHCC-97L cell, disturb and stride that migration of vascular endothelial cells is tested representative picture (200 *) and migrating cell is counted statistical graph (* refers to P＜0.05) behind the ANGPTL4.
Behind the b.ANGPTL4 antibody treatment MHCC-97L cell, stride that migration of vascular endothelial cells is tested representative picture (200 *) and migrating cell is counted statistical graph, * refers to P＜0.05.
Fig. 6 has shown that secreted ANGPTL4 albumen promotes the migration of vascular endothelial cells of striding of Huh7 and SMMC-7721.Each is schemed as follows:
A. Western blot detects the expression of ANGPTL4 in COS7-lenti-ANGPTL4 and the COS7-lenti-control cell pyrolysis liquid neutrality condition property supernatant of culture medium.
B. conditionality supernatant of culture medium (CM-ANGPTL4) and the control group (CM-control) that contains people sANGPTL4 albumen handled and striden migration of vascular endothelial cells behind the Huh7 and test representative picture (200 *) (left figure); Right figure is that statistical graph is counted in cell migration.
Stride migration of vascular endothelial cells behind c.CM-ANGPTL4 treatment S MMC-7721 and the control group and test representative picture (200 *) (left figure); Right figure is that statistical graph is counted in cell migration; * refer to P＜0.05.
Fig. 7 has shown that secreted ANGPTL4 albumen promotes MHCC-97L cell lung in vivo to shift.Wherein, the conditionality supernatant of culture medium is handled in the experiment, and tail intravenous inoculation MHCC-97L cell causes hepatic metastases and lung to shift.
Fig. 8 has shown the concentration of ANGPTL4 in HCC patients serum and the normal healthy controls group serum.Each is schemed as follows:
The statistical study figure of the concentration of ANGPTL4 in a HCC patients serum and the normal healthy controls group serum;
B HCC patient occur together shift in the liver with the liver of not occurring together in shift the statistical study figure of the concentration of ANGPTL4 among the patients serum.* refer to P＜0.05.
Fig. 9 has shown the ROC curve of serum ANGPTL4.Wherein, The ROC TG-AUC is that 0.709 ± 0.026 (95% credibility interval is 0.659 and 0.759) .cut-off value is set in 93.5ng/ml distinguishing normal healthy controls group and liver cancer patient, its susceptibility and specificity be 44.7% with the threshold value (cut-off) of 87.4%. arrow indication serum ANGPTL4 be 93.5ng/ml.
Embodiment
The inventor is surprised to find that first that through extensive and deep research secreted ANGPTL4 can promote the external migration of vascular endothelial cells and hepatic metastases in animal body and lung of striding of HCC to shift in HCC; In addition, whether ANGPTL4 concentration and liver cancer patient take place to shift in the liver closely related in the liver cancer patient blood serum.Therefore, serum ANGPTL4 can be used as the mark that detects hepatoma Metastasis and/or liver cancer.Accomplished the present invention on this basis.
ANGPTL4 albumen and gene
In the present invention; Term " albumen of the present invention ", " ANGPTL4 albumen ", " ANGPTL4 polypeptide " or " PP1158 ANGPTL4 " interchangeable use all refer to have albumen or the polypeptide of human angiogenin-like protein ANGPTL4 amino acid sequence AAG22490 (gi:10732648).They comprise the PP1158 ANGPTL4 that contains or do not contain initial methionine.In addition, this term also comprises the ANGPTL4 and the fragment thereof of total length.The ANGPTL4 albumen of indication of the present invention comprise its complete amino acid sequence, its secretory protein, its mutant with and function on active fragment.
In the present invention, term " ANGPTL4 gene ", " ANGPTL4 polynucleotide " or " PP1158 Gene A NGPTL4 " interchangeable use all refer to have the nucleotide sequence of people ANGPTL4 nucleotide sequence (AF202636).Need be understood that when the identical amino acid of coding, the replacement of nucleotide is acceptable in the codon.Need be understood that in addition when producing conservative aminoacid replacement by the nucleotide replacement, the conversion of nucleotide also is can be received.
Under the situation of the amino acid fragment that has obtained ANGPTL4, can construct its nucleotide sequence of coding according to it, and come the designs specificity probe according to nucleotide sequence.Nucleotide full length sequence or its fragment can use the method for pcr amplification method, recombination method or synthetic to obtain usually.For the pcr amplification method; Can ANGPTL4 nucleotide sequence disclosed according to the present invention; Especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of conventional method well known by persons skilled in the art as template, amplification and must relevant sequence.When sequence is longer, usually need carries out twice or pcr amplification repeatedly, and then the fragment that each time amplifies is stitched together by proper order.
In case obtained relevant sequence, just can come to obtain in large quantity relevant sequence with recombination method.This normally is cloned into carrier with it, changes cell again over to, from the host cell after the propagation, separates obtaining relevant sequence then through conventional method.
In addition, also the method for available synthetic is synthesized relevant sequence, especially fragment length more in short-term.Usually, through first synthetic a plurality of small fragments, and then connect and to obtain the very long fragment of sequence.
At present, can be fully obtain the dna sequence dna of code book invention albumen (or its fragment, derivant) through chemosynthesis.Can this dna sequence dna be introduced in various existing dna moleculars as known in the art (like carrier) and the cell then.
Through the recombinant DNA technology of routine, polynucleotide sequence of the present invention capable of using can be used to express or produce the ANGPTL4 polypeptide of reorganization.In general following steps are arranged:
(1). with the polynucleotide (or variant) of coding human ANGPTL4 polypeptide of the present invention, or with recombinant expression carrier conversion that contains these polynucleotide or transduction proper host cell;
(2). the host cell of in proper culture medium, cultivating;
(3). separation, protein purification from nutrient culture media or cell.
Among the present invention, the ANGPTL4 polynucleotide sequence can be inserted in the recombinant expression carrier.In a word, as long as can in host, duplicate and stablize, any plasmid and carrier can be used.A key character of expression vector is to contain origin of replication, promoter, marker gene and translation control element usually.
Method well-known to those having ordinary skill in the art can be used to make up and contains ANGPTL4 DNA sequences encoding and suitable transcribing/the translate expression vector of control signal.These methods comprise extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technique of body etc.Described dna sequence dna can effectively be connected on the suitable promoter in the expression vector, and is synthetic to instruct mRNA.Expression vector also comprises ribosome bind site and the transcription terminator that translation initiation is used.
In addition; Expression vector preferably comprises one or more selected markers; To be provided for selecting the phenotypic character of transformed host cells; Cultivate dihyrofolate reductase, neomycin resistance and the green fluorescent protein (GFP) of usefulness like eukaryotic, or be used for colibacillary tetracycline or amicillin resistance.
Comprise the carrier of above-mentioned suitable dna sequence dna and suitable promoter or control sequence, can be used to transform appropriate host cell, so that it can marking protein.
Host cell can be a prokaryotic, like bacterial cell; Or eukaryotic such as low, like yeast cells; Or higher eucaryotic cells, like mammalian cell.Representative example has: Escherichia coli, the bacterial cell of streptomyces; Fungal cell such as yeast; Vegetable cell; Insect cell; Zooblast etc.
Can carry out with routine techniques well known to those skilled in the art with the recombinant DNA transformed host cell.When the host was prokaryotes such as Escherichia coli, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results
2Method is handled, and used step is well-known in this area.Another kind method is to use MgCl
2If desired, transforming also the method for available electroporation carries out.When the host is an eucaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, conventional mechanical method such as microinjection, electroporation, liposome packing etc.
The transformant that obtains can be cultivated with conventional method, expresses the polypeptide of coded by said gene of the present invention.According to used host cell, used nutrient culture media can be selected from various conventional nutrient culture media in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promoter of selection with suitable method (like temperature transition or chemical induction), cell is cultivated a period of time again.
The extracellular can expressed or be secreted into to recombinant polypeptide in the above methods in cell or on cell membrane.If desired, can utilize its physics, the separating through various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.The example of these methods includes, but are not limited to: conventional renaturation handles, with protein precipitant handle (salt analysis method), centrifugal, the broken bacterium of infiltration, ultraly handle, ultra centrifugal, sieve chromatography (gel filtration), adsorption chromatography, ion-exchange chromatography, high performance liquid chroma-tography (HPLC) is technological with other various LCs and the combination of these methods.
Specific antibody
In the present invention, term " antibody of the present invention " and " specific antibody of anti-ANGPTL4 " interchangeable use.
The present invention comprises that also people ANGPTL4 polypeptide is had specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody.Here, " specificity " is meant that antibody capable is incorporated into people ANGPTL4 gene outcome or fragment.Preferably, refer to that those can combine with people ANGPTL4 gene outcome or fragment but nonrecognition and be incorporated into the antibody of other irrelevant antigen molecule.Antibody comprises that those can combine and suppress the molecule of people ANGPTL4 albumen among the present invention, comprises that also those do not influence the antibody of people ANGPTL4 protein function.The present invention also comprise those can with the antibody of modifying or combining without the people ANGPTL4 gene outcome of modified forms.
The present invention not only comprises complete monoclonal or polyclonal antibody, but also comprises having immunocompetent antibody fragment, like Fab ' or (Fab)
2Fragment; Heavy chain of antibody; Light chain of antibody; Genetically engineered strand Fv molecule (people such as Ladner, United States Patent(USP) No. 4,946,778); Or chimeric antibody, as have the murine antibody binding specificity but still keep antibody from people's antibody moiety.
Antibody of the present invention can prepare through the known various technology of those skilled in that art.For example, the people ANGPTL4 gene outcome of purifying or its have antigenic fragment, can be applied to animal to induce the generation of polyclonal antibody.Similarly, cell with antigenic fragment of expressing human ANGPTL4 albumen or its can be used to immune animal and produces antibody.Antibody of the present invention also can be monoclonal antibody.This type of monoclonal antibody can utilize hybridoma technology prepare (see people such as Kohler,
Nature256; 495,1975; People such as Kohler,
Eur.J.Immunol.6:511,1976; People such as Kohler,
Eur.J.Immunol.6:292,1976; People such as Hammerling,
In Monoclonal Antibodies And T Cell Hybridomas, Elsevier, N.Y., 1981).Antibody of the present invention comprises the antibody that can block people ANGPTL4 protein function and the antibody that does not influence people ANGPTL4 protein function.Each antibody-like of the present invention can utilize the fragment or the functional areas of people ANGPTL4 gene outcome, obtains through the routine immunization technology.These fragments or functional areas can utilize recombinant methods or utilize Peptide synthesizer synthetic.The antibody that combines with the unmodified form of people ANGPTL4 gene outcome can use the gene outcome of producing in the prokaryotic (for example E.Coli) to come immune animal and produce; The antibody that combines with the posttranslational modification form (like the albumen or the polypeptide of glycosylation or phosphorylation) can use the gene outcome that produces in the eukaryotic (for example yeast or insect cell) to come immune animal and obtain.
The antibody of anti-people ANGPTL4 albumen can be used in the immunohistochemistry technology, detects the people ANGPTL4 albumen in the sample (especially serum sample).
Detection method
Utilize ANGPTL4 to be present in the serum, and with hepatoma Metastasis closely related these characteristics, the present invention also provides method, especially the serology detection method that detects or judge hepatoma Metastasis.
In a preference of the present invention, the present invention provides a kind of ELISA method and time resolution immunofluorescence technique (TRFIA) that detects serum ANGPTL4.
Detection kit
The present invention also provides a kind of kit that detects hepatoma Metastasis, and it contains immunoglobulin (Ig) or the immune conjugate of anti-ANGPTL4 of the present invention, or its active fragment.
People's liver cancer serum of the present invention is learned diagnostic kit, has accomplished experiment examples up to a hundred, and positive rate is about 55%.
With the object of the serodiagnosis kit test positive of people's hepatoma Metastasis of the present invention, the probability of its hepatoma Metastasis is apparently higher than normal population or general liver cancer patient.
Pharmaceutical composition
The present invention also provides a kind of pharmaceutical composition, and it contains the antagonist of above-mentioned ANGPTL4, and pharmaceutically acceptable carrier.Described pharmaceutical composition can be used for suppressing the transfer of HCC.
In the present invention, described antagonist comprises siRNA, antisense RNA, antibody or its combination to ANGPTL4.In addition, described antagonist also comprises the micromolecular compound that can reduce ANGPTL4 expression or activity.
Usually, but these materials are formulated in nontoxic, inertia with pharmaceutically acceptable aqueous carrier medium in, wherein pH is about 5-8 usually, preferably pH is about 6-8, although the pH value can be with being changed to some extent by preparation Substance Properties and illness to be treated.The pharmaceutical composition for preparing can carry out administration through conventional route, comprising (but being not limited to): in the peritonaeum, intravenous or topical.
Pharmaceutical composition of the present invention can directly be used to suppress the transfer of HCC.In addition, also can with other tumor therapeutic agent couplings.
Pharmaceutical composition of the present invention contains above-mentioned ANGPTL4 antagonist and the pharmaceutically acceptable carrier or the excipient of the present invention of safe and effective amount.This type carrier comprises (but being not limited to): salt solution, damping fluid, glucose, water, glycerine, ethanol and combination thereof.Pharmaceutical preparation should be complementary with administering mode.Pharmaceutical composition of the present invention can be made into the injection form, for example prepares through conventional method with the physiological saline or the WS that contains glucose and other assistant agents.Pharmaceutical composition such as injection, solution should be made under aseptic condition.The dosage of active component is the treatment effective dose, for example every day about 1 microgram/kg body weight-Yue 5 mg/kg body weight.In addition, polypeptide of the present invention also can use with the other treatment agent.
When making pharmaceutical composition; Be that ANGPTL4 antagonist of the present invention with safe and effective amount is applied to mammal; Wherein this safe and effective amount is usually at least about 10 micrograms/kg body weight; And in most of the cases be no more than about 8 mg/kg body weight, preferably this dosage is about 10 micrograms/kg body weight-Yue 1 mg/kg body weight.Certainly, concrete dosage is factor such as considered method of administration, patient health situation also, and these all are within the skilled practitioners skill.
Suppress or promote the method and composition of the migration of HCC
The present invention also provides ANGPTL4 activator and the purposes in promoting the HCC migration thereof, especially promotes the promoter of HCC migration or the purposes of composition in preparation.In the present invention, with the ANGPTL4 activator or contain the composition of this activator, can promote HCC in external or body, to move.
In a preference, a kind of method of external promotion HCC migration is provided, comprise step: in the presence of ANGPTL4 albumen or its activator, cultivate HCC.
The present invention also provides ANGPTL4 antagonist and the purposes in suppressing the HCC migration thereof, especially suppresses the suppressant of HCC migration or the purposes of composition in preparation.In the present invention, with the ANGPTL4 antagonist or contain the composition of this antagonist, can suppress HCC and in external or body, move.
In a preference, a kind of method of vitro inhibition HCC migration is provided, comprise step: in the presence of the ANGPTL4 antagonist, cultivate HCC.
Major advantage of the present invention comprises:
(1) method that detects and judge hepatoma Metastasis through blood serum designated object is provided first, has helped early detection or auxiliary detection hepatoma Metastasis, thereby help to make a definite diagnosis as early as possible and take the corresponding treatment measure.
(2) the serum detection method is more convenient fast, accepts for patient more easily.
(3) be convenient to dynamically supervise HCC patient's disease progression.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in the restriction scope of the present invention.The experimental technique of unreceipted actual conditions in the following example; Usually according to normal condition; People such as Sambrook for example; Molecular cloning: the condition described in the laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989), or the condition of advising according to manufacturer.Unless otherwise indicated, otherwise number percent and umber are percentage by weight and parts by weight.
Experimental technique
SDS-PAGE electrophoresis and Western immunoblotting assay
Lysis and protein electrophoresis: ice-cold PBS washing cultured cell, after the collection it is suspended in cracking in the RIPA damping fluid (available from Pierce company) that contains protease inhibitor cocktail (cocktail), cracking process carried out on ice 30 minutes.Under 4 ℃ of conditions 12,000r/min collects supernatant after centrifugal 10 minutes, adopts conventional BCA method protein quantification then.Sample quantitatively and 5 * sample-loading buffer be mixed to be incorporated in the 95-100 ℃ of water-bath sex change 5 minutes.Protein electrophoresis carries out in SDS-polyacrylamide gel (PAGE) and buffer system, and sample is pressed appearance on the 30-60 μ g/ hole, 80/120V constant voltage electrophoresis.
Western blotting: after electrophoresis finishes, adopt wet commentaries on classics method that albumen is transferred on the nitrocellulose filter.Change the film condition: 220mA constant current effect 30 minutes.After the end film rinsing in PBST (0.1% Tween 20) is once immersed in the 5% skimmed milk power confining liquid room temperature sealing 1 hour.Then film is immersed anti-with the debita spissitudo of confining liquid dilution, 4 ℃ of incubated overnight.Wash film three time with PBST next day, each 10 minutes.With peroxidase coupling two anti-reactions of confining liquid dilution, incubated at room is washed film three times with PBST after 1 hour more afterwards.The luminous development of target protein band utilizes SuperSignal chemical illuminating reagent (available from Pierce company) to carry out.
All Western immunoblot experiments all with β-actin as confidential reference items.
Real-time quantitative PCR detects
Reverse transcription: use PrimeScript
TMRT reagent Kit (Takara company) disposes mixed liquor: 5 * PrimeScript Buffer (for Real Time), 2 μ l in 200 μ l microcentrifugal tubes; PrimeScript RT Enzyme Mix I 0.5 μ l; Oligo dT Primer (50 μ M) 0.5 μ l; Random 6 mers (100 μ M) 0.5 μ l; Total RNA 500ng; DEPC water is supplied 10 μ l.37 ℃ were reacted 15 minutes, handled for 5 seconds for 85 ℃, ice bath cooling then.Wherein, total RNA uses the conventional method extracting.
Quantitative PCR: 1: 50 diluted for use of cDNA reactant liquor that reverse transcription is obtained.PCR is reflected in the 20 μ l systems and carries out: 2 μ l cDNA dilutions (being equivalent to the initial RNA amount of 50ng); Each 0.4 μ l of upstream and downstream primer; 2 * SYBR Premix Ex Taq
TMSolutions (Takara company) 10 μ l; Sterile purified water 7.2 μ l.PCR is reflected on the ABI 7300 quantitative PCR appearance and carries out, and reaction conditions is a two-step approach pcr amplification standard program: 95 ℃ of the first steps, 30 seconds, 1 circulation; 95 ℃ of second steps, 5 seconds, 60 ℃, 31 seconds, 40 circulations.The gene expression dose that reaction records uses endogenous glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene as the reference markization.
Collecting of conditionality supernatant of culture medium
With growth conditions good cell digestion counting, every kind of cell all is connected in the Tissue Culture Dish of 10cm with the same cell number.The degrees of fusion that reached approximately about 90% by second day changes the DMEM that contains 0.02%FBS.At 37 ℃, 5%CO
2With cultivation under the saturated humidity condition 24 hours, collect supernatant of culture medium, 3000r/min is centrifugal subsequent use under 4 ℃ of conditions.If be used for the sample of Western blot experiment, mix to be incorporated in the 95-100 ℃ of water-bath sex change 5 minutes with 5 * sample-loading buffer.
The ELISA of secreted ANGPTL4 albumen detects
The concentration determination of sANGPTL4 is all carried out according to the ELISA Development System of R&D company
instructions in cell culture medium supernatant and the nude mice serum, and method is following:
1) in the PBS that does not contain any albumen, dilutes capture antibody (concentration is 0.8 μ g/ml), the 100 μ l/ holes of the capture antibody after this dilution are joined in the ELISA Plate.
2) ELISA Plate is sealed avoided evaporating, spend the night in incubated at room.
3) blot the liquid in each hole and add 400 μ l washing lotions washings, repeat 3 times.Final step is shifted out liquid in the plate and ELISA Plate is adsorbed on clean paper handkerchief.
4) add 300 μ l/ hole confining liquid shroudings, incubated at room 1 hour.
5) repeating step 3.
6) every hole adds 100 μ the l suitably standard items and the sample of dilution, beats ELISA Plate gently 1 minute.Stick the shrouding film, incubated at room 2 hours.The dilutability of sample is 1: 10 or 1: 50 in this research.
7) repeating step 3.
8) every hole adds 100 μ l detection antibody (concentration is 400ng/ml), sticks new shrouding film, incubated at room 2 hours.
9) repeating step 3.
10) every hole adds 100 μ l streptavidin (Streptavidin)-HRP.
11) repeating step 3.
12) every hole adds 100 μ l substrates (TMB liquid substrate system, Sigma Aldrich company), and lucifuge was carried out chromogenic reaction in incubated at room 5-30 minute.
13) every hole adds 50 μ l stop buffer (2N H
2SO
4), the ELISA Plate that vibrates is gently guaranteed abundant mixing.
14) in 30 minutes, on ELIASA, adopt the 450nm wavelength that the result is carried out interpretation.
15) data analysis and calculating.
The structure of recombinant expression carrier pWPXL-ANGPTL4
Use liver cell eDNA to be template, the complete full length sequence of design and synthetic primer amplification people ANGPTL4, and hold at 5 ' end and 3 ' and to introduce the PmeI/NdeI restriction enzyme site respectively.Through conventional PCR method amplification ANGPTL4 ORFs.With cutting with the PmeI/NdeI enzyme behind the amplification PCR amplified fragments purifying, is connected with the same pWPXL carrier of cutting through the PmeI/NdeI enzyme (can available from Addgene company), 16 ℃ of connections are spent the night, and obtain pWPXL-ANGPTL4, and cut through enzyme and to check and sequence verification.
The structure of pLVTHM-shANGPTL4 (being used for producing in vivo the siRNA interference fragment)
Use the fragment of the effective ANGPTL4 of the interference expression of method screening of siRNA.According to the ordered sequence that filters out, the single stranded DNA that synthesizing ribonucleotide sequence is following:
5 '-cgcgtccccgaggcagagtggactatttttcaagagaaaatagtccactctgcctc tttttggaaat-3 ' (SEQ ID N0.:1; Wherein the 6-28 position is for disturbing the ordered sequence of ANGPTL4), 5 '-cgatttccaaaaagaggcagagtggactattttctcttgaaaaatagtccactctg cctcgggga-3 ' (SEQ ID N0.:2)
The structure cloning process is following:
1) annealing: above-mentioned oligonucleotides strand is dissolved in deionized water respectively, to concentration be 10pM.Complementary oligonucleotides is respectively got 2 μ l, adds 48 μ l annealing buffers (100mM potassium acetate, the HEPES of 30mM pH7.4,2mM magnesium acetate).Hatched 4 minutes for 95 ℃, hatched 10 minutes 4 ℃ of coolings for 70 ℃.
2) phosphorylation: get the oligonucleotides that 5 μ l have annealed, add 12 μ l water, 2 μ l T4 ligase damping fluids (containing 1mM ATP), 1 μ l calf intestine alkaline phosphatase (CIP) was hatched 30 minutes for 37 ℃, hatched 10 minutes fire extinguishing CIP for 70 ℃ then.
3) connect: be connected with the pLVTHM carrier of cutting through the MluI/ClaI enzyme (can available from Addgene company), 16 ℃ of connections are spent the night.
The conversion of competence bacterium
By conventional method, transform with conventional Escherichia coli HB101 competence bacterium.Institute's DCRP is taken out the kit extracting for a short time with plasmid, and enzyme is cut evaluation and whether inserted exogenous fragment.For there being the clone who inserts exogenous fragment to check order.
Packaging virus
The slow virus packaging system that uses among the present invention is three pUC pUCs available from Addgene company, comprises pWPXL/pLVTHM (carrying genes of interest or interference fragment), psPAX2 and pMD2.G.The HEK-293T cell (ATCC:CRL-11268) that growth conditions is good is connected in the Tissue Culture Dish of 10cm, and the degrees of fusion that reached approximately more than 95% by second day carries out transfection.Transfection reagent is 1: 1: 1 with the mol ratio of the consumption of Lipofectamine 2000, three plasmids, and total amount is 24.6 μ g.Operating process is with reference to the operation instructions of Lipofectamine 2000: with pWPXL/pLVTHM or the corresponding pWPXL-ANGPTL4/pLVTHM-shRNA of 12 μ g; 9 μ g psPAX2 and 3.6 μ gpMD2.G mix with the Opti-MEM of 1.5ml; The Lipofectamine 2000 of 60 μ l mixes with the Opti-MEM of 1.5ml, and room temperature was placed 5 minutes; Above two kinds of mixed liquors are softly mixed, and incubated at room 20 minutes forms transfection composite; Mixed liquor is joined in the HEK-293T cell that has connected, add DMEM again to cumulative volume 10ml; The DMEM that 10ml contains 10%FBS is changed in transfection after 6 hours, stop transfection; Observe fluorescence after 24 hours, transfection efficiency will reach more than 90%; Collected nutrient solution in 60 hours, 3000r/min is centrifugal under 4 ℃ of conditions, the membrane filtration of 0.4 μ m, and the filtrating packing ,-70 ℃ are frozen subsequent use.
The virus infections of tumour cell
The tumour cell that growth conditions is good is connected to 6 orifice plates, reaches the degrees of fusion of 60-70% approximately, and infects in second day.With the DMEM that contains 10%FBS with the dilution in 1: 4 of viral liquid, in dilution, add polybrene to final concentration be 10 μ g/ml; Dilution is added in the cell, cultivates the DMEM that changes 10%FBS after 6 hours.Can observe fluorescence in 24 hours.
Stride the migration of vascular endothelial cells experiment
Used tumour cell is by plasmid pLGS mark, and this plasmid is the two target plasmids of luciferase and GFP, is the dna fragmentation that contains luciferase and two genes of GFP is formed through the BamHI/XhoI restriction enzyme site pWPXL carrier of packing into).People's endothelium HUVEC cell (ATCC:CRL-1730) of the routine that the phase of taking the logarithm grows inserts Trans-well cell (3 * 10
4Cell, 100 μ l DMEM nutrient culture media), be cultured to Fusion of Cells (about 24h); Inoculation is suspended from 1 * 10 of 100 μ l DMEM
5Tumour cell, following chamber adds the DMEM that contains 10%FBS, and repeat in three holes; After 20 hours, cell is with 4% formalin fixed; The cell in the cell outside is wiped off, under inverted fluorescence microscope, observed, 6 visuals field are clapped in choosing at random, count and analyze.
The experiment of ANGPTL4 antibody treatment
The inoculation of HUVEV cell is the same.During the inoculated tumour cell, in the suspension of tumour cell, add the anti-ANGPTL4 antibody of rabbit (can be available from Santa Cruz, M-200, sc-66807), to final concentration be 40 μ g/ml; Control group adds the rabbit igg control antibodies that is not directed against ANGPTL4 of same concentrations; All the other steps are the same.
The conditionality nutrient culture media is handled experiment
The inoculation of HUVEV cell is the same.During the inoculated tumour cell, with 100 μ l conditionality nutrient culture media resuspended 1 * 10
5Tumour cell, all the other steps are the same.
The cellular immunity chemical analysis
Cell inoculation is being coated with on the sterilization microslide of poly-D-lysine, cultivates 24 hours; Cultivate and finish back removal nutrient culture media, in PBS, softly embathe microslide; With at room temperature fixing 20 minutes of 4% neutral paraformaldehyde, use SuperBlocking confining liquid (can available from Pierce company) closing cell 30 minutes then.Section is spent the night with an anti-reaction under 4 ℃ of conditions; In PBS, washed next day three times totally 15 minutes; Add two and resist, incubated at room 1 hour, DAB colour developing then; Adopt haematoxylin to redye then, the air-dry back of rinsing neutral gum mounting, coloration result is just being put observation under the optical microscope.
The test of Mouse Liver in-situ inoculating
Get the growth conditions good cell, every part 1 * 10
6Cell is made into mixed liquor 40 μ l suspension cells with serum-free DMEM and Matrigel geometric ratio, places on ice; 28 nude mices are divided into experimental group and control group, and 14 every group, the intraperitoneal anesthesia of 30.5% (wt) yellow Jackets, the prominent transection mouse peritoneal down of sword shape is hauled out with two medical cotton sticks gently, appears liver; In left liver leaf essence, inject cell, pull out behind the pin with dried cotton swab hemostasis by compression; Sew up the abdominal cavity; Observed once in 3 days, 6 all no pains are sacrificed nude mice behind the inoculating cell, gather serum, liver and lung; Serum is used for ELISA and detects; Liver, lung tissue are done routine pathology and are learned inspection, and routine paraffin wax section, haematoxylin/Yihong (HE) dyeing are shifted and the lung metastatic nodules in the microscopically statistics Mouse Liver.
The mouse tail vein inoculation test
The institute of the interior injection of time nude mice abdominal cavity on every Wendesdays collects and contains ANGPTL4 conditionality nutrient culture media or corresponding contrast.After one week, get the good MHCC-97L cell of growth conditions, every part 4 * 10
6Cell, with serum-free DMEM 300ul suspension cell, tail intravenous inoculation cell continues the interior injecting condition property nutrient culture media of time nude mice abdominal cavity on every Wendesdays afterwards, keeps for 8 weeks.No pain is sacrificed animal used as test, gathers liver and lung tissue.
Data processing
Experiment obtains data and puts in order and statistical study by conventional method.Continuous data is represented with the form of mean+SD, adopts Student ' s t-test to analyze its statistical significance; Grouped data adopts the Chi-square check.The probability P that statistical test obtains＜0.05 thinks to have statistical significance.
Embodiment 1
1.ANGPTL4 high expressed in the SMMC-7721 of high metastatic potential
Adopt quantifying PCR method and Western blot to detect the expression of ANGPTL4 mRNA and albumen in the multiple SMMC-7721 commonly used.
The result is shown in Fig. 1 a and 1c.ANGPTL4 is at people's high metastatic potential hepatic cell line MHCC-LM3, MHCC-97, and the expression of MHCC-97L and MHCC-97H is higher relatively; And in the metastatic SMMC-7721 of other non-height HepG2, Hep3B, Huh-7; SMMC-7721, FOCUS and PLC/PRF/5 are low to express.
Whether in view of ANGPTL4 is a secreted protein, it is consistent with the expression of cell own also to utilize the ELISA method to detect secreted ANGPTL4 protein level.
The result shows that the secretion level of secreted sANGPTL4 in the cell culture medium supernatant is consistent (Fig. 1 b) with the trend of Western trace testing result.
The above results shows that ANGPTL4 is at people's metastatic potential hepatic cell line MHCC-LM3, and is higher relatively with the expression of secretion in the MHCC-97, the born of the same parents of MHCC-97L and MHCC-97H, and the expression of prompting ANGPTL4 and the metastatic potential of HCC are closely related.
Embodiment 2
What exogenous expression ANGPTL4 promoted HCC strides migration of vascular endothelial cells (trans-endothelial migration)
In the present embodiment; According to the expression of ANGPTL4 at each SMMC-7721; Choose low HCC Huh7 and the SMMC-7721 that expresses of ANGPTL4; Utilize slow virus carrier to make up ANGPTL4 and stablize overexpressing cell system, called after Huh7-lenti-ANGPTL4 and SMMC-7721-lenti-ANGPTL4 contrast called after Huh7-lenti-control and SMMC-7721-lenti-control accordingly respectively.
Adopt respectively quantitative PCR and Western blot to detect to stablize the expression of ANGPTL4 in the overexpressing cell system that (Fig. 2 a b), confirmed expression ANGPTL4 success at ANGPTL4.
Be the expression of checking secreted ANGPTL4 albumen, adopt simultaneously ELISA and Western blot method detected ANGPTL4 stablize sANGPTL4 albumen in the cell culture medium supernatant that overexpressing cell is level (Fig. 2 a, c).The result shows that the expression of sANGPTL4 among Huh7-lenti-ANGPTL4 and the SMMC-7721-lenti-ANGPTL4 is significantly higher than corresponding control group.
Huh7-lenti-ANGPTL4 and SMMC-7721-lenti-ANGPTL4 cell have been carried out striding the migration of vascular endothelial cells experiment, detected and respectively organize the quantity that cell cross is crossed the vascular endothelial cell layer.The result shows that Huh7-lenti-ANGPTL4 compares with control group separately with SMMC-7721-lenti-ANGPTL4 and has stronger transfer ability, have significant difference (P＜0.001) (Fig. 2 d, e).This shows, in two kinds of HCC Huh7 of low transfer ability and SMMC-7721, mistake is expressed the transfer ability that ANGPTL4 has significantly strengthened HCC.
Embodiment 3
Exogenous expression ANGPTL4 promotes to shift in the liver of SMMC-7721 cell in nude mouse and lung shifts
Experiment in vitro has confirmed that ANGPTL4 can promote the migration of vascular endothelial cells of striding of HCC, and present embodiment has further been studied the influence that ANGPTL4 shifts HCC in vivo.
Method is following: in-situ inoculating SMMC-7721-lenti-ANGPTL4 cell and corresponding control group SMMC-7721-lenti-control cell in nude mouse, postoperative 6 all no pains are sacrificed animal used as test, gather serum, liver and lung tissue.Liver and lung tissue are carried out the routine pathology histological examination, and the tubercle number of interior transfer of liver and lung transfer takes place in statistical experiment group and nude mice of control group.
The result shows, though all nude mices of experimental group and control group all take place to shift in the liver, experimental group has 6 nude mices can detect lung to shift, even a plurality of METs are arranged, and control group all do not observe lung shift (table 1, Fig. 3).Further the difference of interior transfer of liver and lung transfer takes place in statistical study experimental group and control group, finds that MET number (59) apparently higher than control group (33) (P=0.016) in the experimental group liver; The routine number of experimental group lung metastasis and lung MET number (17) have been compared notable difference (P=0.038) (Fig. 3) with control group (0).
These results show, ANGPTL4 can obviously promote to shift and the lung transfer in the liver of SMMC-7721 cell in nude mouse.
Shift in the table 1. nude mice liver and lung transfer table of induction
Adopt the ELISA method to detect sANGPTL4 level in the nude mice serum; SANGPTL4 level in the discovery experimental group nude mice serum is apparently higher than control group (P＜0.01); The mean value of experimental group is that (average ± SD), scope is from 87-325ng/ml for 181 ± 81ng/ml; Control group is that (average ± SD), scope is from 25-36ng/ml (Fig. 4) for 30 ± 5ng/ml.Being illustrated in the interior SMMC-7721-lenti-ANGPTL4 cell of nude mouse can effectively secrete ANGPTL4 in blood, thereby influences people sANGPTL4 level in the nude mice serum.This results suggest, there are certain correlativity in ANGPTL4 level and hepatoma Metastasis in the serum.
Embodiment 4
The expression of interference ANGPTL4 can suppress the migration of vascular endothelial cells of striding of MHCC-97L cell
Proving that exogenous expression ANGPTL4 can promote striding on the basis of shifting in migration of vascular endothelial cells and the nude mouse of SMMC-7721, present embodiment is further verified the effect of ANGPTL4 in striding migration of vascular endothelial cells of endogenous expression.
At relative high expressed ANGPTL4 and have in the MHCC-97L cell of SMMC-7721 of high metastatic potential, adopt the method for shRNA to disturb and reduced the expression of ANGPTL4.Compare with control group, disturb ANGPTL4 expression back MHCC-97L to stride the migration of vascular endothelial cells ability and obviously reduce, (Fig. 5 a) to have significant difference (P＜0.01).
The antibody of secreted protein can this protein induced function of antagonism.Therefore, in striding the migration of vascular endothelial cells experiment, commercially available ANGPTL4 antibody is joined in the nutrient solution of MHCC-97L cell, detect its influence MHCC-97L cell cross migration of vascular endothelial cells ability.
The result shows, is consistent with in the MHCC-97L cell, disturbing the effect of ANGPTL4, can significantly reduce MHCC-97L cell cross migration of vascular endothelial cells ability (P＜0.001) (Fig. 5 b) after the ANGPTL4 antibody treatment.
Above experimental result shows, no matter is to reduce endogenous ANGPTL4 expression or add ectogenic anti-ANGPTL4 antibody, has all reduced the transfer ability of HCC.
Secreted ANGPTL4 albumen promotes the migration of vascular endothelial cells of striding of HCC
ANGPTL4 is a secreted protein, and previous experiments result shows that the ANGPTL4 of HCC oneself expression can effectively be secreted in the supernatant of culture medium, and can significantly reduce MHCC-97L cell cross migration of vascular endothelial cells ability after the ANGPTL4 antibody treatment.Therefore, in the present embodiment, (Condition medium, CM) supernatant is handled the low HCC of expressing of ANGPTL4 to collection condition property nutrient culture media, detects secreted ANGPTL4 albumen is striden migration of vascular endothelial cells to HCC influence.Used supernatant of culture medium derives from and stablized the clone COS7 that expresses ANGPTL4 in this experiment, is abbreviated as COS7-lenti-ANGPTL4, selects the COS7 cell can get rid of the influence of other secreted factors of tumour cell.
At first verified the expression of ANGPTL4 in COS7-lenti-ANGPTL4 and cellular control unit thereof; Compare with control group; ANGPTL4 is no matter be in cell pyrolysis liquid or in the medium supernatant, and the expression among the COS7-lenti-ANGPTL4 increases significantly that (Fig. 6 a).
When striding the migration of vascular endothelial cells experiment; Handle Huh7 and SMMC-7721 cell respectively with the conditionality supernatant of culture medium; The result finds; Compare with control group, the conditionality supernatant of culture medium that contains ANGPTL4 can obviously promote Huh7 and SMMC-7721 cell stride migration of vascular endothelial cells (Fig. 6 b, c).Even this prompting HCC is not expressed itself or the low ANGPTL4 that expresses, when it is in the environment that contains higher concentration ANGPTL4, the ability of striding migration of vascular endothelial cells of HCC also can strengthen.
Embodiment 6
Secreted ANGPTL4 albumen promotes the lung of HCC in nude mouse to shift
Experiment in vitro has confirmed that secreted ANGPTL4 albumen can promote the migration of vascular endothelial cells of striding of HCC, and present embodiment adopts tail intravenous inoculation method, has further studied the influence that secreted ANGPTL4 albumen shifts HCC in nude mouse.Injecting condition property nutrient culture media in the inferior on every Wendesdays nude mice abdominal cavity, a week back tail intravenous inoculation MHCC-97L cell continues the interior injecting condition property nutrient culture media of time nude mice abdominal cavity on every Wendesdays afterwards, keeps for 8 weeks.No pain is sacrificed animal used as test, gathers liver and lung tissue.
Liver and lung tissue are carried out the routine pathology histological examination, and the tubercle number of interior transfer of liver and lung transfer takes place in statistical experiment group and nude mice of control group.
The result shows, 1 nude mice liver metastasis of experimental group, and control group does not detect hepatic metastases; Experimental group has 7 nude mices can detect lung to shift, and control group only observe a routine lung shift (table 2, Fig. 7).This explanation, secreted ANGPTL4 albumen promote obviously that in nude mouse the lung of MHCC-97L cell shifts.
Hepatic metastases of table 2. nude mice and lung shift table of induction
*: mouse number/total mice order that transfer takes place.
Embodiment 7
ANGPTL4 concentration and liver cancer patient take place to shift in the liver closely related in the serum
Present embodiment adopts the specific monoclonal antibody of anti-ANGPTL4, has detected the concentration of ANGPTL4 in 463 routine liver cancer patients and the 90 routine normal healthy controls group serum through ELISA method (double antibodies sandwich method).
The concentration that the result is illustrated in ANGPTL4 in the HCC serum is 115.0 ± 117.0ng/ml (average ± SD); The concentration of ANGPTL4 is 55.6 ± 30.9ng/ml (average ± SD) in the normal healthy controls group serum.(Fig. 8 a) apparently higher than control group serum (P＜0.05) for ANGPTL4 concentration in the liver cancer patient blood serum.
Show that for further analysis of the HCC patient who detects (145.8 ± 16.3ng/ml) apparently higher than the patient of not taking place to shift in the liver (106.5 ± 6.8ng/ml) (P＜0.05) (Fig. 8 b) with the liver cancer patient blood serum ANGPTL4 concentration that shifts in the liver.
This prompting, serum ANGPTL4 concentration is higher than 130ng/ml, and the probability of this this object generation hepatoma Metastasis of prompting significantly rises.
Embodiment 8
The relation of serum ANGPTL4 concentration and each item clinical indices
For further exploring the relation of serum ANGPTL4 concentration and each item clinical indices; The cut-off value of having set ANGPTL4 according to ROC curve (Fig. 9) is 93.5ng/ml; Its susceptibility and specificity are respectively 44.7% and 87.4%, and positive rate is about 55% (80/144).The clinicopathological parameters of including statistical study in mainly contains in patient's sex, age, serum alpha-fetoprotein, HBsAg, tumour size, Edmondson histological grade, the liver and shifts and the cirrhosis that occurs together.Statistic analysis result shows that serum ANGPTL4 concentration and liver cancer patient occur together, and liver is interior to shift indexs closely related (table 3) such as the Edmondson histological grade and the cirrhosis that occurs together.
In conjunction with above-mentioned experiment in vivo and vitro research, can reach a conclusion, secreted ANGPTL4 plays an important role in the hepatoma Metastasis process, can be used as the mark of hepatoma Metastasis.
The correlation analysis of table 3 serum ANGPTL4 concentration and liver cancer patient clinicopathological parameters
The P value is represented the x between serum ANGPTL4 and the clinicopathologia index
2Check, AFP, alpha-fetoprotein .* refers to P＜.05.
Embodiment 9
Detect the kit of liver cancer/hepatoma Metastasis
Preparation one is used for the kit that serology detects liver cancer/hepatoma Metastasis, and said kit comprises:
(a) container, and be positioned at the following antibody of the specificity of container to ANGPTL4: the anti-ANGPTL4 antibody of rabbit (can be available from Santa Cruz, M-200 or Invitrogen company); With
(b) and label or instructions, said label or instructions indicate that said kit is used for detecting or diagnosing liver cancer shifts.
Use above-mentioned detection kit, detected the content of ANGPTL4 in the unknown serum sample (120 examples, wherein 90 examples are HCC patient's sample) through the ELISA standard measure.
The result shows that when positive threshold value was got 93.5ng/ml, evaluating 49 routine samples was that ANGPTL4 is positive, and positive rate is slightly larger than about 50%;
When the positive threshold value of transfer was got 130ng/ml, it was high hepatoma Metastasis probability that 15 routine evaluating samples are arranged.Through check, confirm to have among this 15 routine patient 11 examples to have hepatoma Metastasis (comprising that lung shifts).
All documents in that the present invention mentions are all quoted as a reference in this application, are just quoted such as a reference separately as each piece document.Should be understood that in addition after having read above-mentioned teachings of the present invention, those skilled in the art can do various changes or modification to the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Claims (10)
1. the purposes of PP1158 4 (ANGPTL4 albumen) or its specific antibody is characterized in that, (a) is used to prepare the diagnostic reagent or the kit that detect hepatoma Metastasis; (b) be used to prepare diagnostic reagent or the kit that serum detects liver cancer.
2. purposes as claimed in claim 1 is characterized in that, described ANGPTL4 albumen or its specific antibody coupling have or have a detectable label.
3. purposes as claimed in claim 3 is characterized in that, said detectable label is selected from down group: chromophore, chemiluminescent groups, fluorophore, isotope or enzyme.
4. purposes as claimed in claim 1 is characterized in that said diagnostic reagent is a monoclonal antibody.
5. purposes as claimed in claim 1 is characterized in that, described detection hepatoma Metastasis is that serum detects.
6. a diagnostic kit that is used to detect hepatoma Metastasis is characterized in that, described kit contains a container, contains ANGPTL4 albumen or its specific antibody in the said container; And label or instructions, said label or instructions indicate said kit and are used for detection or diagnosing liver cancer transfer.
7. kit as claimed in claim 6 is characterized in that, described ANGPTL4 albumen or its specific antibody coupling have or have a detectable label.
8. the purposes of a PP1158 4 (ANGPTL4 albumen) is characterized in that, it is used as the mark that serum detects hepatoma Metastasis.
9. the purposes of the antagonist of a PP1158 4 (ANGPTL4 albumen) is characterized in that, is used to prepare the medicine that suppresses the HCC transfer.
10. purposes as claimed in claim 9 is characterized in that, described antagonist comprises siRNA, antisense RNA, antibody or its combination to ANGPTL4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110068042.5A CN102692500B (en) | 2011-03-21 | 2011-03-21 | ANGPTL4 as a marker of liver cancer metastasis by serological detection and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110068042.5A CN102692500B (en) | 2011-03-21 | 2011-03-21 | ANGPTL4 as a marker of liver cancer metastasis by serological detection and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102692500A true CN102692500A (en) | 2012-09-26 |
| CN102692500B CN102692500B (en) | 2015-06-10 |
Family
ID=46858095
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110068042.5A Active CN102692500B (en) | 2011-03-21 | 2011-03-21 | ANGPTL4 as a marker of liver cancer metastasis by serological detection and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102692500B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105021827A (en) * | 2015-07-17 | 2015-11-04 | 北京大学第一医院 | Application of substance for detecting content of serum angiopoetin-like protein 2 in preparation of product for detecting hepatitis and fibrosis degree |
| WO2017011929A1 (en) * | 2015-07-17 | 2017-01-26 | 北京大学第一医院 | Use of substance detecting content of angiopoietin-like protein 2 in serum for preparing products for detecting inflammation and degree of fibrosis of liver |
| CN106706930A (en) * | 2017-02-28 | 2017-05-24 | 申冬昌 | Kit for detecting Parkinson's disease |
| CN107148428A (en) * | 2014-08-07 | 2017-09-08 | 诺华股份有限公司 | The antibody of PP1158 4 and application method |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1586902A2 (en) * | 2004-03-30 | 2005-10-19 | F.Hoffmann-La Roche Ag | ANGPTL4/FIAF as marker for PPARdelta modulation |
| CN1952129A (en) * | 2005-10-20 | 2007-04-25 | 上海市肿瘤研究所 | ANGPTL4 deletion mutant and application thereof |
| CN101080419A (en) * | 2004-07-20 | 2007-11-28 | 健泰科生物技术公司 | Compositions and methods of using angiopoietin-like 4 protein |
-
2011
- 2011-03-21 CN CN201110068042.5A patent/CN102692500B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1586902A2 (en) * | 2004-03-30 | 2005-10-19 | F.Hoffmann-La Roche Ag | ANGPTL4/FIAF as marker for PPARdelta modulation |
| CN101080419A (en) * | 2004-07-20 | 2007-11-28 | 健泰科生物技术公司 | Compositions and methods of using angiopoietin-like 4 protein |
| CN1952129A (en) * | 2005-10-20 | 2007-04-25 | 上海市肿瘤研究所 | ANGPTL4 deletion mutant and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| JEROME VERINE 等: "Determination of Angptl4 mRNA as a Diagnostic Marker of Primary and Metastatic Clear Cell Renal-Cell Carcinoma", 《PLOS ONE》 * |
| 崔宏 等: "ANGPTL4的研究进展", 《中国实用神经疾病杂志》 * |
| 曾一元 等: "ANGPTL4基因对不同肝癌细胞株生长的影响", 《肿瘤》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107148428A (en) * | 2014-08-07 | 2017-09-08 | 诺华股份有限公司 | The antibody of PP1158 4 and application method |
| CN107148428B (en) * | 2014-08-07 | 2021-03-09 | 诺华股份有限公司 | Angiopoietin-like protein 4 antibodies and methods of use |
| CN105021827A (en) * | 2015-07-17 | 2015-11-04 | 北京大学第一医院 | Application of substance for detecting content of serum angiopoetin-like protein 2 in preparation of product for detecting hepatitis and fibrosis degree |
| WO2017011929A1 (en) * | 2015-07-17 | 2017-01-26 | 北京大学第一医院 | Use of substance detecting content of angiopoietin-like protein 2 in serum for preparing products for detecting inflammation and degree of fibrosis of liver |
| CN106706930A (en) * | 2017-02-28 | 2017-05-24 | 申冬昌 | Kit for detecting Parkinson's disease |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102692500B (en) | 2015-06-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101416058B (en) | Wnt proteins and detection and treatment of cancer | |
| CN102732608B (en) | Marker for diagnosing liver cancer and application thereof | |
| WO2014031174A1 (en) | Antibodies and vaccines for use in treating ror1 cancers and inhibiting metastasis | |
| CN102483414B (en) | Cadherin-17 as diagnostic marker and therapeutic target for liver cancer | |
| CN102875681A (en) | Anti-alpha v beta 6 antibodies and uses thereof | |
| CN102251013A (en) | Antibody and antigen for recognizing tumor initiator cell and application thereof | |
| CN101622273A (en) | The method for cancer that treatment, diagnosis or detection are relevant with the LIV-1 overexpression | |
| CN102692500B (en) | ANGPTL4 as a marker of liver cancer metastasis by serological detection and application thereof | |
| CN101290318B (en) | ELISA reagent kit for diagnosing liver cancer | |
| JP2002540814A (en) | Methods for diagnosis and treatment of metastatic prostate tumor | |
| Riedel et al. | Urothelial umbrella cells of human ureter are heterogeneous with respect to their uroplakin composition: different degrees of urothelial maturity in ureter and bladder? | |
| CN102276721B (en) | Monoclonal antibody for serological diagnosis of liver cancer and application thereof | |
| US10828377B2 (en) | Method for determining presence or absence of suffering from malignant lymphoma or leukemia, and agent for treatment and/or prevention of leukemia | |
| CN103969452B (en) | The classification diagnosis kit of BAY 43-9006 personalized treatment liver cancer | |
| CN106701902B (en) | Application of FOXR2 gene and expression product in diagnosis and treatment of liver cancer | |
| CN103966334A (en) | Application of CSF2RB (Colony Stimulating Factor2Receptor, Beta) gene in prostatic cancer bone metastasis | |
| CN103937871B (en) | The application of SRRP35 gene and expression product in cancer diagnosis and treatment | |
| RU2013104137A (en) | BARD1 ISOFORMS IN LUNG AND COLORECTAL CANCER AND THEIR APPLICATION | |
| WO2016065877A1 (en) | Use of cd166 as a serum marker for diagnosis of liver cancer and kit therefor | |
| CN104630338B (en) | Application of RRM2B gene or protein thereof in liver cancer metastasis | |
| CN102181400A (en) | Hybridoma cell strain and anti-HCCLM-6 (Human Hepatoma Cell Line) cell secretory protein monoclonal antibody | |
| CN102692496A (en) | ANGPTL4 as marker of hypoxia detection and application thereof | |
| KR20210122813A (en) | Antibodies and functional fragments thereof | |
| CN101998992A (en) | Methods involving MS4A12 and agents targeting MS4A12 for therapy, diagnosis and testing | |
| CN106701904B (en) | Application of ACSL4 gene and expression product in diagnosis and treatment of gastric cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |