CN102676663B

CN102676663B - Nucleic acid detection kit for detecting BRCA1mRNA

Info

Publication number: CN102676663B
Application number: CN 201210130104
Authority: CN
Inventors: 方国伟; 周晓犊; 王淑一
Original assignee: HANGZHOU ADICON CLINICAL LABORATORY CENTER Co Ltd
Current assignee: HANGZHOU ADICON CLINICAL LABORATORY CENTER Co Ltd
Priority date: 2012-04-27
Filing date: 2012-04-27
Publication date: 2013-09-25
Anticipated expiration: 2032-04-27
Also published as: CN103451282B; CN103451282A; CN102676663A

Abstract

The invention discloses a nucleic acid detection kit for detecting BRCA1mRNA. The nucleic acid detection kit contains an erythrocyte lysing solution, an RNA extracting solution, a detection system polymerase chain reaction (PCR) reaction solution, a positive control substance and a negative control substance and is characterized in that the detection system PCR reaction solution contains a PCR buffer solution, diethyl-nitrophenyl thiophosphate (dNTP), Mg<2+>, sense/anti-sense primer BRCA1-F/BCA1-R and a probe BRCA1-Probe for detecting and sense/anti-sense primer Actin-F/Actin-R and a probe Actin-Probe, wherein BRCA1-F:CAGCTACCCTTCCATCATAAGTGA; BRCA1-R:GGCCATGTATATGCGAATCTTTTT; BRCA1-Probe:FAM-TTCTGCCCTTGAGGACCTGCGAAAT-TAMRA; Actin-F:TGAGCGAGGCTACAGCTT; Actin-R:TCCTTGATGTCGCGCACGATTT; andActin-Probe: FAM- ACCACCACGGCCGAGCGG-TAMRA.

Description

Kit for detecting nucleic acid for detection of BRCA1mRNA

Technical field

The invention belongs to life science and biological technical field, particularly a kind of gene detecting kit adopts the probe for real-time fluorescence quantitative PCR technique, can the BRCA1 expression level in the human breast cancer be detected, can effectively save detection time, improve accuracy of detection.

Background technology

Mammary cancer has become the second largest reason of cancer mortality as women's kinds of tumor.Its diagnosis mainly is based upon on the imaging examination basis, lack laboratory specific diagnosis index, bring difficulty to early diagnosis, fail to pinpoint a disease in diagnosis easily or mistaken diagnosis, and excision is mammary cancer first-selection methods for the treatment of, but postoperative influences form, attractive in appearance not good, the patient is caused bigger puzzlement, the therefore psychological shade of generation of part patient is more arranged, have a strong impact on their quality of life.Think that at present mammary cancer should take the complex therapy of several different methods combination, the thorough cleaning of primary lesion is the key of breast cancer treatment more.Early diagnosis also seems particularly important in addition, early finds it is the key of striving for its good prognosis.

Mammary cancer 1 gene (breast cancel susceptibility genel, BRCA1) be first found familial breast cancer cancer suppressor gene in the world, be positioned No. 17 karyomit(e)s long-armed on, by comprising 22 codings exons and 2 non-coding exons.Discover that at present it is one of main mechanism of platinum-based chemotherapy resistance generation that DNA repairs.Clinical application shows that there is significant individual difference in the curative effect of platinum medicine, and part patient benefits, and part patient's resistance also toxic side effect occurs.A large amount of clinical studyes are verified: the BRCA1 mrna expression is closely related in the curative effect of platinum medicine and the tumor tissues, and namely the patient that the BRCA1 gene expression dose is low is to the platinum medicine sensitivity, otherwise the high patient of expression level shows resistance.Yet anti-microtubule based chemotherapy medicine is to act on the cell microtubule, form by influencing spindle body, thereby the inhibition cell mitogen.The efficient low and big problem of side effect appears treating in this class medicine often, and has significant individual difference.Vast amount of clinical shows that the mRNA expression level of BRCA1 gene is closely related in the curative effect of anti-microtubule medicine and the tumor tissues, and namely the patient that the BRCA1 gene expression dose is high resists microtubule class medicaments insensitive, otherwise the low patient of expression level shows resistance.Thereby the BRCA1 expression level has very important directive function for the medication in later stage.

In actual applications, the method of expressing for detection of BRCA1 is mainly immunohistochemical methods, although this method is comparatively directly perceived, but process of the test is too loaded down with trivial details, the reagent type that needs is various, and test-results needs veteran expert to come interpretation, and there is bigger subjectivity in sentence read result, has limited the application of this method to a certain extent.Exactly because there are these problems in the immunohistochemical methods method, just impel us to explore new method and detect the BRCA1 expression level.

The real-time fluorescence quantitative PCR method has higher sensitivity and specificity, and can carry out real-time online to PCR and detect, the initial content of reaction BRCA1 in tissue, and test has been saved a large amount of detection times, has also avoided the generation of carryover contamination.Common method has SYBR GreenI dye method, two probe hybridization methods and Taqman technology etc.Wherein SYBR GreenI is owing to be non-saturable dye, and specificity must be judged its specificity by observing solubility curve not as two probe hybridization methods and Taqman method; And two probe method hybrid method cost is comparatively expensive.Therefore the present invention adopts the real-time fluorescence PCR technology to be applied to the BRCA1 gene test in conjunction with the Taqman probe method.

Summary of the invention

In view of the deficiency that detects BRCA1 in the prior art, the present invention has designed detection confidential reference items/goal gene with primer, probe sequence, detects the BRCA1 gene with fluorescent quantitative PCR technique.By adjusting primer concentration and probe concentration and the ratio of two genes, optimize reaction system and the reaction conditions of PCR, developed a kind of kit for detecting nucleic acid for detection of BRCA1mRNA.

For detection of the kit for detecting nucleic acid of BRCA1mRNA, comprise erythrocyte cracked liquid, RNA extracting solution, detection architecture PCR reaction solution, positive reference substance and negative control product; It is characterized in that:

Detection architecture PCR reaction solution comprises PCR damping fluid, d NTP, Mg ²⁺, detect use downstream primer BRCA1-F/BRCA1-R and probe BRCA1-Probe, with reference to using downstream primer Actin-F/Actin-R probe Actin-Probe; Wherein,

BRCA1-F：CAGCTACCCTTCCATCATAAGTGA

BRCA1-R：GGCCATGTATATGCGAATCTTTTT

BRCA1-Probe：FAM-TTCTGCCCTTGAGGACCTGCGAAAT-TAMRA

Actin-F：TGAGCGAGGCTACAGCTT

Actin-R：TCCTTGATGTCGCGCACGATTT

Actin-Probe：FAM-ACCACCACGGCCGAGCGG-TAMRA。

Further, detecting the ratio of using downstream primer and probe is preferably: the mol ratio of BRCA1-F: BRCA1-R: BRCA1-Probe is 2: 2: 1.

Be preferably with reference to the ratio of using downstream primer and probe: the mol ratio of Actin-F: Actin-R: Actin-Probe is 2: 2: 1.

Described positive reference substance is for containing the genomic solution of BRCA1; Described negative control product are the genomic solution of no BRCA1.

The RNA extracting solution can substitute with commerical prod QIAGEN RNeasy FFPE Kit paraffin RNA extraction agent box.

Use test kit of the present invention, the real-time fluorescence PCR technology in conjunction with adopting the Tapman probe, can be detected BRCA1mRNA, the accuracy of detection height, and also simple to operate, can reduce the detection cost, save detection time.Utilize two calibration curve methods, detected result is compared with normal people's expression level (0.75), whether can weigh the interior BRCA1 gene expression dose of testee's body normal, this method is a kind of novel method that is used for evaluate patient BRCA1 expression level, also helps patient's anaphase scheme determination.Substituted original simple individual detection owing to introduced " normal people ", not only can detect BRCA1 gene expression amount in testee's body, can also compare with normal level simultaneously, instruct the later stage medication, can be used for auxiliary early diagnosis, early prevention and the high risk population's of mammary cancer screening clinically.

Description of drawings

Fig. 1 is the positive test symbol synoptic diagram;

Fig. 2 is the negative result synoptic diagram.

Embodiment

Embodiment 1

Kit for detecting nucleic acid for detection of BRCA1mRNA of the present invention comprises:

Erythrocyte cracked liquid;

RNA extracting solution: QIAGEN RNeasy FFPE Kit.

Detection architecture PCR reaction solution: THUNDERBIRD Probe qPCR Mix (2 *) (comprises PCR damping fluid, d NTP, Mg ²⁺), each 0.8uM of BRCA1 primer, BRCA1-probe (probe) 0.4uM; Each 0.8uM of Actin primer, Actin-probe (probe) 0.4uM; Wherein,

BRCA1-F：CAGCTACCCTTCCATCATAAGTGA，

BRCA1-R：GGCCATGTATATGCGAATCTTTTT，

BRCA1-Probe：FAM-TTCTGCCCTTGAGGACCTGCGAAAT-TAMRA，

Actin-F：TGAGCGAGGCTACAGCTT，

Actin-R：TCCTTGATGTCGCGCACGATTT，

Actin-Probe：FAM-ACCACCACGGCCGAGCGG-TAMRA；

Positive reference substance: contain BRCA1 genome solution;

Negative control product: do not contain BRCA1 genome solution.

Embodiment 2

The using method of test kit of the present invention:

(1) organizes RNA in the extracting paraffin section: cut tissue or paraffin sheet sample (scrapes) in the 1.5ml centrifuge tube; Add 1ml transparency of organization liquid, the centrifugal 1min of 13000rpm behind the vibration mixing; The centrifugal 1min of 13000rpm behind the removal supernatant adding 500ml transparency of organization liquid vibration mixing; Remove supernatant, the centrifugal 1min of 13000rpm behind the adding 1ml dehydrated alcohol vibration mixing; Spend metal bath 10min (uncapping) as for 37 behind the removal supernatant, until liquid dried; With reference to QIAGEN RNeasy FFPE Kit paraffin RNA extraction agent box specification sheets, extract sample rna.

(2) with reference to the Rever Tra Ace qPCR RT Kit test kit specification sheets of TOYOBO company, RNA is reversed to cDNA.

(3) reagent configuration: by detecting each X ul of people's umber configuration detection system PCR reaction solution, everyone part 23ul packing:

X=23ul reaction solution * (8 parts of confidential reference items (typical curve)+8 part goal gene (typical curve)+n part sample+1 part of positive control+1 part negative control+1 part of blank).

(4) application of sample: add 2ulcDNA in the detection architecture PCR reaction solution; Positive control and negative control directly add 2ul positive reference substance and negative control product; Blank adds 2ul physiological saline or does not add any material.

(5) detect: detect and carry out at the real-time fluorescence PCR instrument, available instrument comprises ABI7300,7500 (U.S. Applied Biosystems companies) etc.Reaction conditions: 95 ℃ of pre-sex change 1min; 95 ℃ of 15s, 40 circulations of 58 ℃ of 35sec, fluorescent signal is gathered when 58 ℃ of 35sec.

(6) result judges: threshold line is adjusted to background signal and negative the amplification more than the line, and system calculates copy number automatically according to typical curve and CT value.Calculate according to following formula:

1) control group is the normal people, and the ratio of its goal gene/house-keeping gene is stabilized in about 0.75 through the test of great amount of samples.

2) F value＞1.5, it is higher to be judged as expression amount; F value＜0.5, it is on the low side to be judged as expression amount; 0.5＜F＜1.5 are judged as normal.

3) positive judging criterion:, Ct＜36, positive; 35≤Ct≤38 are the doubtful positive, need checking again; Ct＞38, negative.

Embodiment 3

Adopt nucleic acid detection method of the present invention to detect clinical samples

Fetch and deliver patient with breast cancer's's (adopting two-tube fluorescent quantitative PCR technique) of inspection paraffin section sample 20 examples, press embodiment 2 described methods and extract geneome RNA, reagent preparation and detection.

Every part of sample adds 2ul in the detection architecture PCR reaction solution.Do the positive simultaneously, feminine gender, blank, each portion of the typical curve of internal control gene/goal gene.The fluorescent PCR instrument in 96 holes can detect 20 duplicate samples simultaneously, and each sample repeats a positive control, a negative control and a blank 2 times.Only be 100 minutes detection time.

Experimental result is compared with reporting the result of PCR group, determines the accuracy rate of sample detection.Part positive findings such as following table:

Sample	The confidential reference items expression amount	The BRCA1 expression amount	Ratio	Ratio with the normal people	Expression level
						3108	89.02	220.05	2.47	3.30	High

3101	3.09	9.68	3.13	4.18	High
						11713	20.14	13.19	0.65	0.87	Normally
3110	23.25	39.94	1.72	2.29	High
						3301	5.61	＜1	0.00	0.00	Negative
3325	37.15	33.8	0.91	1.21	Normally
						3531	2.56	12.86	5.02	6.70	High
3106	5.73	12.74	2.22	2.96	High
						3518	19.73	17.51	0.89	1.18	Normally
3321	78.06	167.35	2.14	2.86	High
						3312	53.27	54.02	1.01	1.35	Normally
3320	12.43	6.9	0.56	0.74	Normally
						21258	36.15	55.9	1.55	2.06	High
3304	67.17	144.67	2.15	2.87	High
						3502	20.32	197.07	9.70	12.93	High
3302	69.38	377.12	5.44	7.25	High
						522695	52.38	834.07	15.92	21.23	High
522664	3.15E-01	Do not detect	0.00	0.00	Negative
						3322	7.73	8.68	1.12	1.50	Normally
3329	39.31	13.23	0.34	0.45	Low

Table 1 is this result of experiment

As can be seen from the above table, have 11 examples to be high expression level in the 20 routine samples, 6 examples are normal expression, and 1 example is expressed for low, and 2 examples are negative.Exactly because introduced normal people's numerical value as reference, finally can estimate testee's BRCA1 expression level, thereby instruct anaphase and medication.This method is accuracy height as a result not only, and for clinical certain directive significance is arranged.

Embodiment 4 clinical samples detect

Get clinical sample to be checked 1 and sample 2, press embodiment 2 described methods and extract genome, reagent preparation and detection.

Every duplicate samples adds 2ul in the detection architecture PCR reaction solution.Do the positive simultaneously, feminine gender, each portion of blank.Detect with the fluorescent PCR instrument, the time is 100 minutes.

The detected result figure of sample 1 as shown in Figure 1, the amplified signal of internal control gene actin shows that tested sample genome extracts successfully, detected result is effective, amplified signal is arranged before CT value＜36 of sample 1, so sample 1 is positive.

The detected result figure of sample 2 as shown in Figure 2, the amplified signal of internal control gene actin shows that tested sample genome extracts successfully, detected result is effective, does not have amplified signal after CT value＞38 of sample 2, so sample 2 is negative.

SEQUENCE LISTING

＜110〉Hangzhou Ai Dikang medical test center company limited

＜120〉for detection of the kit for detecting nucleic acid of BRCA1mRNA

<130>

<160> 6

<170> PatentIn version 3.3

<210> 1

<211> 24

<212> DNA

＜213〉artificial sequence

<400> 1

cagctaccct tccatcataa gtga 24

<210> 2

<211> 24

<212> DNA

＜213〉artificial sequence

<400> 2

ggccatgtat atgcgaatct tttt 24

<210> 3

<211> 25

<212> DNA

＜213〉artificial sequence

<400> 3

ttctgccctt gaggacctgc gaaat 25

<210> 4

<211> 18

<212> DNA

＜213〉artificial sequence

<400> 4

tgagcgaggc tacagctt 18

<210> 5

<211> 22

<212> DNA

＜213〉artificial sequence

<400> 5

tccttgatgt cgcgcacgat tt 22

<210> 6

<211> 18

<212> DNA

＜213〉artificial sequence

<400> 6

accaccacgg ccgagcgg 18

Claims

1. for detection of the kit for detecting nucleic acid of BRCA1mRNA, comprise erythrocyte cracked liquid, RNA extracting solution, detection architecture PCR reaction solution, positive reference substance and negative control product; It is characterized in that:

Detection architecture PCR reaction solution comprises PCR damping fluid, d NTP, Mg ²⁺, detect use downstream primer BRCA1-F/BRCA1-R and probe BRCA1-Probe, with reference to using downstream primer Actin-F/ Actin-R and probe Actin-Probe; Wherein,

BRCA1-F：CAGCTACCCTTCCATCATAAGTGA

BRCA1-R：GGCCATGTATATGCGAATCTTTTT

BRCA1-Probe：FAM-TTCTGCCCTTGAGGACCTGCGAAAT-TAMRA

Actin-F：TGAGCGAGGCTACAGCTT

Actin-R：TCCTTGATGTCGCGCACGATTT

Actin-Probe：FAM-ACCACCACGGCCGAGCGG-TAMRA。

2. kit for detecting nucleic acid as claimed in claim 1, the mol ratio that it is characterized in that BRCA1-F ︰ BRCA1-R ︰ BRCA1-Probe is 2 ︰, 2 ︰ 1.

3. kit for detecting nucleic acid as claimed in claim 1, the mol ratio that it is characterized in that Actin-F ︰ Actin-R ︰ Actin-Probe is 2 ︰, 2 ︰ 1.

4. kit for detecting nucleic acid as claimed in claim 1 is characterized in that described positive reference substance is for containing the genomic solution of BRCA1; Described negative control product are the genomic solution of no BRCA1.