CN102676525A - Paddy rice miR399d and application thereof - Google Patents
Paddy rice miR399d and application thereof Download PDFInfo
- Publication number
- CN102676525A CN102676525A CN2012101532961A CN201210153296A CN102676525A CN 102676525 A CN102676525 A CN 102676525A CN 2012101532961 A CN2012101532961 A CN 2012101532961A CN 201210153296 A CN201210153296 A CN 201210153296A CN 102676525 A CN102676525 A CN 102676525A
- Authority
- CN
- China
- Prior art keywords
- gene
- osmir399d
- seq
- paddy rice
- mir399d
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of gene engineering, in particular to paddy rice miR399d and application thereof. Functions of a paddy rice miR399d gene are verified through overexpression of transgenic rice plants of the paddy rice miR399d (short for OsmiR399d). The paddy rice miR399d comprises a clone of a paddy rice miR399d precursor gene, construction of an expression carrier containing the gene, a primer sequence, an Osmir399d overexpression plant, response of the gene OsmiR399d on low phosphorus stress and salt stress, and verification of a target gene of the gene OsmiR399d. Semiquantitative and quantitative PCR (Polymerase Chain Reaction) detection results show that the expression of phosphorus deficiency treatment and salt treatment in roots and stem leaves can be improved. The target gene of the OsmiR399d is proved to be OsPHO2 through 5'RACE. The invention also discloses the application of the paddy rice miR399d, which is characterized in that the content of phosphorus in the stem leaves of the transgenic plants can be obviously improved after the gene OsmiR399d is overexpressed in the paddy rice, so that the plants are shown as phosphorus poisoning. The gene OsmiR399d can be used for variety improving of plants.
Description
Technical field
The invention belongs to gene engineering technology field, be specifically related to a kind of paddy rice
MiR399d(be abbreviated as
OsmiR399d) and use.
Background technology
Paddy rice is one of main in the world food crop.China paddy soil region mainly concentrates on Plain, the middle and lower reach of Yangtze River, the Sichuan Basin, the Delta of the Pearl River and Taiwan Province's Western Plains area.Mostly these areas are acid and subacidity soil, and the plain form of phosphorus mainly is a tertiary iron phosphate in the soil, and the tertiary iron phosphate content of rice soil generally can reach the non-50-80% (Chinese soil, 1978) that holds polymorphic segment that closes, and the phosphorus of this kind form is difficult to absorbed by crop.The present situation of rice soil phosphate fertilizer shortage, big limitations rice yield, thereby improve paddy rice phosphorus nutrition characteristic, rice yield is significant for improving.
One type of little RNA of endogenous coding strand (Dreyfuss etc., 2002 that MicroRNA is made up of 19-25 Nucleotide; Gebauer and Hentze, 2004; Ambros, 2004).This type endogenous microRNA is incorporated into flank region or the coding region of target gene mRNA through the base complementrity pair principle, thereby regulates and control target gene expression (Dreyfuss etc., 2002; Gebauer etc., 2004; Ambros etc., 2004).Under the low-phosphorous nutrient, miR399 is proved a large amount of abduction deliverings (Chiou etc., 2006 in Arabidopis thaliana and paddy rice; Bari etc., 2004).This family has 6 (Sunkar etc., 2004 respectively in Arabidopis thaliana and paddy rice; Jones etc., 2004) and 11 copies (Lopez etc., 2004).Report is illustrated in the Arabidopis thaliana miR399 and has participated in the plain shortage reaction of phosphorus.MiR399 acts on ubiquitin binding enzyme (UBC24), and then regulation and control phosphoric acid translocator, and (Fujii etc., 2005 play an important role in the plain running balance of phosphorus; Chiou etc., 2006; Bari etc., 2006).The research of coercing about miRNA399 and phosphorus element at present focuses mostly in Arabidopis thaliana, and for paddy rice, the research of unifacial leaf mode crop is known little about it, so the necessity of further further investigation is arranged.
MiR399Not only relevant with low-phosphorous response, also receive inducing of salt stress.Chip data shows, white poplar and corn after supersalt is handled,
MiR399Up-regulated (Ding etc., 2009; Jia etc., 2009).And in the Arabidopis thaliana
MiR399The salt that is expressed in do not have considerable change (Fujii etc., 2005) before and after handling, explain in the different plant species that the regulation and control of microRNA there are differences.Paddy rice
MiR399Regulated and control by salt stress, also do not report.
This laboratory successfully obtains paddy rice miR399d first through the design primer and (is abbreviated as later on from the fine whole genome sequence of Japan
OsmiR399d) precursor-gene, and it is fine to change it over to Japan, has obtained to cross the expression plant, it is too high to cross in the expression plant phosphorus content, shows phosphorism, explanation
OsmiR399dIn paddy rice phosphorus running balance regulation and control, certain effect is arranged.This laboratory also through sxemiquantitative and quantitative PCR research scarce phosphorus and salt stress right
OsmiR399dThe influence of expressing, the two can both be induced
OsmiR399dThe expression of precursor, explanation
OsmiR399dPossibly not only participate in phosphorus running balance regulation and control, also relevant with the salt stress reaction.
Summary of the invention
The object of the present invention is to provide and a kind ofly clone from the paddy rice kind
OsmiR399dPrecursor-gene and application thereof.Specifically comprise: the microRNA that in paddy rice, expresses,
OsmiR399dThe clone of gene, clone and the required primer sequence of detection expression pattern, the structure of expression vector, the acquisition of transfer-gen plant, the mensuration of phosphorus content is right in the trans-genetic hybrid rice
MiR399dGene is coerced with the expression pattern variation of salt stress processing back at scarce phosphorus and is carried out the used method of Analysis and Identification, and the checking of the target gene of effect.
The present invention at first provides a kind of isolated dna molecular, and this dna molecular is what from paddy rice, clone first
OsmiR399dPrecursor-gene, total length 428bp, its nucleotides sequence classify as shown in the SEQ ID NO.1.
The present invention studies paddy rice
MiR399dAbiotic stress for example lacked phosphorus is coerced, the response of salt stress, show paddy rice
MiR399dAbiotic stress for example lacked phosphorus is coerced, the response of salt stress, induce effect obvious.
The present invention passes through paddy rice
OsmiR399dPrecursor-gene is crossed in paddy rice and is expressed, and obtains transfer-gen plant, and the checking paddy rice
MiR399dFunction.
The present invention is provided for from the fine whole genome sequence of Japan, according to
MiR399dThe amplification of precursor stem ring two ends specific regions design
OsmiR399dThe primer of gene is right:
MiR399d forward: GCAGATCTGTAGGAAGACAAGAGGCAAGT (SEQ ID NO.2)
MiR399d is reverse: GCGGTGACCGGGGCTAAACTCCTAAACA (SEQ ID NO.3)
The present invention is provided for the RealtimePCR detection by quantitative
OsmiR399dThe basis of expressing
OsmiR399dThe primer of precursor stem ring zone design is right:
MiR399d forward: ATCGGTTGGTTATGTGC (SEQ ID NO.4)
MiR399d is reverse: CAGGCCGTTTTGGTGAA (SEQ ID NO.5)
The present invention provides a kind of detection paddy gene
OsmiR399dResponse lacks the method that phosphorus is coerced, and utilizes primer SEQ ID NO.2 and SEQ ID NO.3, and the rice cDNA sample that lacks the phosphorus processing is carried out sxemiquantitative PCR, detects the expression of this gene in cauline leaf; Sample is that the RNA of paddy rice is through gained cDNA behind the rt; Its step is following:
(a) extraction lacks total RNA of the over-ground part of phosphorus processing and normal cultured paddy rice;
(b) utilize the reverse transcription test kit that total RNA reverse transcription is become cDNA;
(c) utilize primer that SEQ ID NO.2 and SEQ ID NO.3 are carried out sxemiquantitative PCR detection.
The result shows:
OsmiR399dThe precursor of gene receives and lacks inducing that phosphorus coerces.
The present invention provides a kind of detection paddy gene
OsmiR399dThe method of response salt stress, its step is following:
(a) extract that salt is handled and the normal cultured paddy rice over-ground part and total RNA of root;
(b) utilize the reverse transcription test kit that total RNA reverse transcription is become cDNA;
(c) utilize primer that SEQ ID NO.4 and SEQ ID NO.5 are carried out quantitative PCR detection.
The result shows:
OsmiR399dThe precursor of gene receives inducing of salt stress.
The present invention provides a kind of method of the miRNA of checking target gene, 5 ' RACE, and its step is following:
(a) extract
OsmiR399dCross and express total RNA that strain is a blade;
(b) add top connection at mRNA 5 ' end;
(c) reverse transcription becomes cDNA;
(d) with gene specific primer and joint primer, amplifying target genes, 5 ' terminal sequence of acquisition goal gene.
The result shows:
OsPHO25 ' end with
OsmiR399dMature sequence is complementary, is
OsmiR399dTarget gene.
The present invention also provides a kind of method of measuring phosphorus content in the rice leaf, and its step is following:
(a) fresh blade of paddy rice and root liquid nitrogen grinding add and contain 10mM Tris, 1mM EDTA, 100mM NaCl, 1mM beta-mercaptoethanol, 1mM PMSF, the extracting solution of pH8.0.
(b) 100 μ l samples add 900 μ l 1%HAc, 42 ℃ of insulation 30min.
(c) the centrifugal 5min of 13000g.
(d) getting 300 μ l supernatants adds 700 μ l and contains 0.35% NH
4M
OO
4, 0.86N H
2SO
4, 1.4% xitix detection liquid, 42 ℃ the insulation 30min.
(e) the 820nm place surveys absorbancy.
The present invention also comprises having
OsmiR399dThe paddy rice transfer-gen plant of precursor-gene.The transfer-gen plant phenotype is obvious, is mainly the jaundice of limb edge, wilts, and shows as phosphorism (Fig. 8).
Description of drawings
Japan is fine to be lacked under the situation of processing 14d in stem, the leaf with phosphorus in that phosphorus is sufficient Fig. 1 for sxemiquantitative PCR detects
OsmiR399dPrecursor,
OsPHO2With
OsIPS1The expression of (for writing a Chinese character in simplified form of phosphate starvation induced gene phosphorus starvation induced genes).
Fig. 2 detects in Japanese fine that different concns NaCl handles for Realtime PCR
MiR399dThe expression of precursor.Wherein, a is among the shoot
MiR399dThe expression of precursor.CK is contrast, the concentration of the NaCl that digitized representation is handled.The gene expression amount account form: 40-Δ Ct, Δ Ct is
MiR399dThe Ct value of precursor-gene and internal control gene actin poor, unit is cycle; B is among the root
MiR399dThe expression of precursor.CK is contrast, the concentration of the NaCl that digitized representation is handled.The gene expression amount account form: 40-Δ Ct, Δ Ct is
MiR399dThe Ct value of precursor-gene and internal control gene actin poor, unit is cycle.
Fig. 3 handles in different time Japanese fine for Realtime PCR detects 200mM NaCl
MiR399dThe expression of precursor.Wherein, a is among the shoot
MiR399dThe expression of precursor.CK is contrast, digitized representation treatment time.The gene expression amount account form: 40-Δ Ct, Δ Ct is
MiR399dThe Ct value of precursor-gene and internal control gene actin poor, unit is cycle.B is among the root
MiR399dThe expression of precursor.CK is contrast, digitized representation treatment time.The gene expression amount account form: 40-Δ Ct, Δ Ct is
MiR399dThe Ct value of precursor-gene and internal control gene actin poor, unit is cycle.
Fig. 4 is for changeing
OsmiR399dPlant
HYGIdentify.Wherein, WT is a wild-type, and 1-8 is a transfer-gen plant.
Fig. 5 changes for extracting
OsmiR399dT
0For the RNA of plant, rt becomes cDNA, carries out quantitative PCR, detects
OsmiR399dThe expression of precursor.399d-1 ~ 399d-5 is
OsmiR399dCross 5 strain systems of expressing.
Fig. 6 is 5 ' RACE checking
OsPHO2Whether be
OsmiR399Target gene.Wherein, the position of arrow indication is that 5 ' RACE amplifies
OsPHO25 ' end.
Fig. 7 is WT and commentaries on classics
OsmiR399dPlant in the mensuration of phosphorus content.Wherein, WT is a wild-type, and L7, L9, L12 are
OsmiR399dCross 3 strain systems of expressing, CK is contrast, and P lacks phosphorus to handle, and s represents over-ground part, and r represents root.
Fig. 8 is for changeing
OsmiR399dThe phosphorism phenotype.Wherein, the left side is a wild-type, and the right does
OsmiR399dCross expression strain system.
Embodiment
Further explain the present invention below in conjunction with the practical implementation instance.Should be understood that these instances only are not used in restriction scope of the present invention to be used to the present invention is described.Unreceipted concrete experimental technique in the following instance all can carry out according to ordinary method.Clone like the Sambrook equimolecular: condition described in the laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989), or according to the operation instruction of making production firm.
Embodiment 1Paddy rice
MiR399dThe clone
Rice varieties Nipponbare (
Oryza sativaJaponica) (SPX-250-GB, Shanghai, China) the middle cultivation: growth conditions is photoperiod 16h/8h (L/D), 28 ℃ at incubator.
2. extracting genome DNA.Get the 0.05g leaflet tablet, add the extraction damping fluid of 65 ℃ of preheatings of 500 μ l, fast mixing; 65 ℃ of water-bath 20min (during be inverted mixing 1-2 time) are cooled to room temperature; Add 500 μ l chloroforms: primary isoamyl alcohol (24:1), soft mixing leaves standstill 1-2min; 12000rpm, the centrifugal 10min of room temperature, supernatant is transferred to new pipe; Add isopyknic chloroform: primary isoamyl alcohol (24:1), soft mixing leaves standstill 1-2min; The same centrifugal, supernatant is transferred to new pipe; Add 1/10 volume 3M NaAC (pH5.2), 2 times of absolute ethyl alcohols (20 ℃) that volume is ice-cold, soft mixing ,-20 ℃ leave standstill 40min; The same centrifugal, abandon supernatant, deposition is with 70% ethanol (4 ℃ of precoolings) washing 2 times; The room temperature airing, 25 μ lTE (containing 1% (V/V) RNA enzyme) are dissolution precipitation fully; 65 ℃ of water-bath digestion RNA 1h; Get 5 μ l and be used for the detection of 0.8% agarose gel electrophoresis.
3. the clone of gene.According to known
OsmiR399dThe sequence at precursor-gene stem ring two ends, the design paddy rice
MiR399Primer such as SEQ ID NO.2 and SEQ ID NO.3.The rice genome sequence is carried out the specific PCR amplification, obtain full length gene, concrete sequence information is referring to SEQ ID NO.1.
Embodiment 2The relation that the expression of miR399d and scarce phosphorus are handled
The Japanese fine seedling of 20d after scarce phosphorus is handled 14d, extracts the stem of rice plant, total RNA of leaf respectively, reverse transcription.To (SEQ ID NO.2 and SEQ ID NO.3), carry out sxemiquantitative PCR with special primer.
OsmiR399dPrecursor receive phosphorus starvation induced, and
OsmiR399dHigh expression level cause
OsPHO2The decline of mRNA level (Fig. 1).
(1) pre-under the different salt concentration of treatment
OsmiR399dExpression
The seedling of Japan fine cultivation 20d, respectively with 50,100,150,200mM NaCl handles 24h, shoot, root extract RNA respectively, rt becomes cDNA, with special primer sequence such as SEQ ID NO.4 and and SEQ ID NO.5, carry out real-time RT-PCR detection
MiR399dThe expression of precursor.Result's demonstration, among the Shoot,
MiR399dExpression begin to raise with the increase of NaCl concentration, reach the highest at 150mM, during 200mM, reduce slightly that (Fig. 2 a).Among the Root,
MiR399dThe expression of precursor is with the increase of concentration rise (Fig. 2 b).
(2) under the same salt concentration of treatment, the expression of different treatment time pre-miR399d
The seedling of Japan fine cultivation 20d; After 200mM NaCl handled 0h, 2h, 4h, 8h, 16h, 24h, shoot, root extracted RNA respectively, and rt becomes cDNA; Utilize special primer sequence such as SEQ ID NO.4 and SEQ ID NO.5, carry out realtimePCR and detect among shoot, the root
MiR399dThe expression of precursor.Result's demonstration, among the Shoot,
MiR399dThe rising 4h of expression elder generation after constant basically (Fig. 3 a); Among the root,
MiR399dThe highest in the 2h expression, expression amount decline (Fig. 3 b) subsequently.
Embodiment 4 OsmiR399dExpression vector establishment, transgenic
1, will
OsmiR399d5 ' the end and the 3 ' end of sequence add respectively
BglThe II restriction site with
BstpThe I restriction enzyme site.Be connected into plant expression vector pCAMBIA1304 with justice then.
2, change recombinant vectors over to Agrobacterium EHA105 with freeze-thaw method, infect Japanese fine callus, obtain transfer-gen plant through after screening, breaking up, take root.
Embodiment 5Transgenic plant
OsmiR399dEvaluation
Get wild-type and T
0Fresh blade for transfer-gen plant is a sample, and the extracting genomic dna carries out specific PCR with the Totomycin primer, detects the existence of hygromycin gene, and transgenic success (Fig. 4) is described.
Get wild-type and T
0Fresh leaves for transfer-gen plant is a sample, carries out the RNA extracting, and reverse transcription obtains cDNA, with SEQ ID NO.4 and with SEQ ID NO.5 be that primer is right
OsmiR399dCarry out quantitative PCR, checking is changeed
OsmiR399dIn the plant
OsmiR399dExpression amount.The result shows, in these 5 strain systems
MiR399dThe expression of precursor all increases (Fig. 5) greatly.
Embodiment 6Checking
OsPHO2With
OsmiR399dRelation
Get T
0Fresh leaves for transfer-gen plant is a sample, carries out the RNA extracting, adds top connection with the RNA ligase enzyme at mRNA 5 ' end, and reverse transcription obtains cDNA, with
OsPHO2Gene specific reverse primer and joint primer carry out pcr amplification, the order-checking of the sequence of acquisition, the sequence of finding its 5 ' end fracture position just with
OsmiR399dMature sequence complementary (Fig. 6), explanation
OsPHO2Be
OsmiR399dTarget gene.
Embodiment 7The wild-type Japan of cultivating 20d is warm and fine
OsmiR399dCross expression strain system, lack phosphorus and handle 14d, get fresh over-ground part and root, liquid nitrogen grinding is extracted phosphorus, detects the content (Fig. 7) of phosphorus.In the transfer-gen plant, the over-ground part phosphorus content is apparently higher than wild-type, in the root then a little less than wild-type.
Embodiment 8Phenotype is observed (Fig. 8).
OsmiR399dCross and express the phenomenon that strain system shows phosphorism, the blade edge jaundice is wilted.
Reference:
1.?Bari,?R.?et?al.?(2006)?PHO2,?microRNA399,?and?PHR1?define?a?phosphate-signaling?pathway?in?plants.?Plant?Physiol.?141,?988–999
2.?Chiou,?T.J.?et?al.?(2006)?Regulation?of?phosphate?homeostasis?by?microRNA?in?
Arabidopsis.?Plant?Cell?18,?412–421
3.?Ding?D?et?al.(2009)?Differential?expression?of?miRNAs?in?response?to?salt?stress?in?maize?roots.?Annals?of?Botany.?103,?29–38
4.?Dreyfuss,?G.?et?al.?(2002)?Messenger?RNA?binding?proteins?and?the?messages?they?carry.?Nat.?Rev.?Mol.?Cell?Biol.?3,?195–205
5.?Fujii,?H.?Chiou?T.J.,?Lin?S.I.,?Aung?K.,?Zhu?J.K.?(2005)?A?miRNA?involved?in?phosphate-starvation?response?in?
Arabidopsis.?Curr.?Biol.?15,?2038–2043
6.?Jia?X.Y?et?al.(2009)?Differential?and?dynamic?regulation?of?miR398?in?response?to?ABA?and?salt?stress?in?
Populus?tremula?and?
Arabidopsis?thaliana.?Plant?Molecular?Biology.?71,51–59
7.?Jones-Rhoades,?M.W.?and?Bartel,?D.P.?(2004)?Computational?identification?of?plant?microRNAs?and?their?targets,?including?a?stress-induced?miRNA.?Mol.?Cell?14,?787–799
8.?Lopez?de?Heredia,?M.?and?Jansen,?R.P.?(2004)?mRNA?localization?and?the?cytoskeleton.?Curr.?Opin.?Cell?Biol.?16,?80–85
9.?Sunkar,?R.?and?Zhu,?J-K.?(2004)?Novel?and?stress-regulated?microRNAs?and?other?small?RNAs?from?
Arabidopsis.?Plant?Cell?16,?2001–2019。
< 110>Fudan University
< 120>paddy rice miR399d and application thereof
<130> 001
<160> 5
<170> PatentIn?version?3.3
<210> 1
<211> 428
<212> DNA
<213>
<400> 1
gtaggaagac?aagaggcaag?tcttctaagt?ctttgtgatg?cattcgtagg?tgtgtgagtg 60
tgagcgtgga?tgtgagagag?gtgcaagaac?tagttgaaga?cagtagtagg?cagctctcct 120
ctggcaggtg?cattctaggt?gattttgtaa?ttgtatatgc?atccaaggta?tatacagtcc 180
ggccatggtg?ctacattgca?atcatccata?tgtgattgca?ttgtgtatat?atatacatgg 240
tggcctttga?tagaccatca?tatatcggtt?ggttatgtgc?atgtatgtat?ataccagctg 300
ctactagctt?tgatcgatcg?ccatgtagcg?attgaattca?ccaaaacggc?ctgccaaagg 360
agagttgccc?tgcgactgtc?tttaactcga?agtaatttag?atagtgtttt?gtttaggagt 420
ttagcccc 428
<210> 2
<211> 29
<212> DNA
<213>
<400> 2
gcagatctgt?aggaagacaa?gaggcaagt 29
<210> 3
<211> 28
<212> DNA
<213>
<400> 3
gcggtgaccg?gggctaaact?cctaaaca 28
<210> 4
<211> 17
<212> DNA
<213>
<400> 4
atcggttggt?tatgtgc 17
<210> 5
<211> 17
<212> DNA
<213>
<400> 5
caggccgttt?tggtgaa 17
Claims (9)
1. an isolated dna molecular is characterized in that, for what from paddy rice, clone
OsmiR399dPrecursor-gene, total length 428bp, its nucleotides sequence classify SEQ ID NO.1 as.
2. contain the transgenic rice plant of dna molecular according to claim 1 in a genome.
3. a pair ofly be used for transferring rice genome
MiR399dThe primer of precursor-gene is characterized in that, according to the said gene stem of claim 1 ring two ends zone design, sequence is shown in SEQ ID NO.2 and SEQ ID NO.3.
4. a pair of RealtimePCR detection by quantitative paddy rice
MiR399dThe primer that precursor-gene is expressed is characterized in that according to the said gene stem of claim 1 ring zone design, sequence is shown in SEQ ID NO.4 and SEQ ID NO.5.
5. one kind is detected paddy gene
OsmiR399dResponse lacks the method that phosphorus is coerced, and it is characterized in that utilizing primer SEQ ID NO.2 and SEQ ID NO.3, and the rice cDNA sample that lacks the phosphorus processing is carried out sxemiquantitative PCR, detects the expression of this gene in cauline leaf; Sample is that the RNA of paddy rice is through gained cDNA behind the rt; Its step is following:
(a) extract the total RNA that lacks phosphorus processing and normal cultured paddy rice;
(b) utilize the reverse transcription test kit that total RNA reverse transcription is become cDNA;
(c) utilize primer to SEQ ID NO.2 and SEQ ID NO.3, carry out sxemiquantitative PCR and detect.
6. one kind is detected paddy gene
OsmiR399dThe method of response salt stress; It is characterized in that paddy rice that salt is handled extracts total RNA of root and cauline leaf respectively; Utilize the reverse transcription test kit that total RNA reverse transcription is become cDNA; Utilize primer that SEQ ID NO.4 and SEQ ID NO.5 are carried out quantitative PCR to the cDNA sample, detect the expression of this gene in root and cauline leaf, the result shows:
OsmiR399dThe precursor of gene receives inducing of salt stress.
7. method of verifying the miRNA target gene, 5 ' RACE is characterized in that adding top connection at mRNA 5 ' end, and reverse transcription becomes cDNA, with gene specific primer and joint primer, amplifying target genes, 5 ' terminal sequence of acquisition goal gene, result's demonstration:
OsPHO25 ' end with
OsmiR399dMature sequence is complementary, is
OsmiR399dTarget gene.
8. method of measuring phosphorus content in the rice leaf; It is characterized in that extracting the titanium pigment in root and the cauline leaf, utilize phosphorus and ammonium molybdate to form complex compound, be reduced into molybdenum blue by xitix then; According to the principle that absorption peak is arranged at 820nm, measure the phosphorus content in root and the cauline leaf.
9. gene as claimed in claim 1
OsmiR399dApplication in plant species improvement.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012101532961A CN102676525A (en) | 2012-05-17 | 2012-05-17 | Paddy rice miR399d and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012101532961A CN102676525A (en) | 2012-05-17 | 2012-05-17 | Paddy rice miR399d and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102676525A true CN102676525A (en) | 2012-09-19 |
Family
ID=46809078
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012101532961A Pending CN102676525A (en) | 2012-05-17 | 2012-05-17 | Paddy rice miR399d and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102676525A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103060459A (en) * | 2013-01-17 | 2013-04-24 | 中国检验检疫科学研究院 | Primer, probe, kit and method for detecting #8 Kefeng transgenic rice strain |
| WO2015152471A1 (en) * | 2014-03-31 | 2015-10-08 | 서울대학교산학협력단 | Rice-derived mir399f precursor dna for increasing plant resistance to drought stress, and use thereof |
| CN105039337A (en) * | 2015-08-31 | 2015-11-11 | 安徽农业大学 | 5'RACE RNA adapter sequence and kit for amplifying terminal of miRNA sheared target gene cDNA 5' |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101203611A (en) * | 2005-04-19 | 2008-06-18 | 巴斯福植物科学有限公司 | Improved methods controlling gene expression |
| CN102002502A (en) * | 2010-08-25 | 2011-04-06 | 华中农业大学 | Gene for improving phosphorus absorption efficiency of paddy rice and application |
-
2012
- 2012-05-17 CN CN2012101532961A patent/CN102676525A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101203611A (en) * | 2005-04-19 | 2008-06-18 | 巴斯福植物科学有限公司 | Improved methods controlling gene expression |
| CN102002502A (en) * | 2010-08-25 | 2011-04-06 | 华中农业大学 | Gene for improving phosphorus absorption efficiency of paddy rice and application |
Non-Patent Citations (4)
| Title |
|---|
| BO,S.等: "GenBank:HM139961.1", 《GENBANK》 * |
| LIN S. I. ET AL.: "Regulatory Network of MicroRNA399 and PHO2 by Systemic Signaling", 《PLANT PHYSIOL》 * |
| ZHOU J. ET AL.: "OsPHR2 Is Involved in Phosphate-Starvation Signaling and Excessive Phosphate Accumulation in Shoots of Plants", 《PLANT PHYSIOL》 * |
| 沈丹: "水稻microRNA遗传多态性及进化选择分析", 《中国优秀硕士学位论文全文数据库》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103060459A (en) * | 2013-01-17 | 2013-04-24 | 中国检验检疫科学研究院 | Primer, probe, kit and method for detecting #8 Kefeng transgenic rice strain |
| WO2015152471A1 (en) * | 2014-03-31 | 2015-10-08 | 서울대학교산학협력단 | Rice-derived mir399f precursor dna for increasing plant resistance to drought stress, and use thereof |
| CN105039337A (en) * | 2015-08-31 | 2015-11-11 | 安徽农业大学 | 5'RACE RNA adapter sequence and kit for amplifying terminal of miRNA sheared target gene cDNA 5' |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhang et al. | The long non-coding RNA lncRNA973 is involved in cotton response to salt stress | |
| Wang et al. | MicroRNA167-directed regulation of the auxin response factors GmARF8a and GmARF8b is required for soybean nodulation and lateral root development | |
| Wang et al. | Soybean miR172c targets the repressive AP2 transcription factor NNC1 to activate ENOD40 expression and regulate nodule initiation | |
| Lu et al. | The role of peu-miR164 and its target PeNAC genes in response to abiotic stress in Populus euphratica | |
| Garneau et al. | Function of pea amino acid permease AAP6 in nodule nitrogen metabolism and export, and plant nutrition | |
| Wang et al. | miR477 targets the phenylalanine ammonia-lyase gene and enhances the susceptibility of the tea plant (Camellia sinensis) to disease during Pseudopestalotiopsis species infection | |
| CN104480118B (en) | LRR-RLK (leucine-rich repeat receptor-like kinase) gene in arachis hypogaea.L and application thereof to bacterial wilt resistance of tobaccos | |
| Gupta et al. | A molecular insight into the early events of Chickpea (Cicer arietinum) and Fusarium oxysporum f. sp. ciceri (Race 1) interaction through cDNA-AFLP analysis | |
| Liang et al. | Characterization of two putative protein phosphatase genes and their involvement in phosphorus efficiency in Phaseolus vulgaris F | |
| CN105838726B (en) | A kind of Salt Tolerance Gene in Alfalfa gene M sCDPK and its coding albumen and application | |
| CN109439671A (en) | It is a kind of to wheat low-temperature resistance, arid, ABA and relevant gene with high salt and its application | |
| CN117904143B (en) | Upland cotton GhDIR gene, coded protein and expression vector and application thereof | |
| CN102676525A (en) | Paddy rice miR399d and application thereof | |
| CN103215278B (en) | Clone of anthurium MYB transcription factor AN2-like gene and expression vector construction | |
| CN103451225B (en) | Application of rice WRKY transcription factor gene OsWRKY21 in cultivation of resistant varieties of plants | |
| CN103102400B (en) | Soybean transcription active protein GmPHD6, and coding gene and application thereof | |
| CN101979543B (en) | Method for cloning piricula oryzae gene of rice | |
| CN103667476A (en) | Detection method for trans-Cry1Ab insect-resistant gene rice line mfb-MH3301 | |
| Li et al. | GmPHR1, a novel homolog of the AtPHR1 transcription factor, plays a role in plant tolerance to phosphate starvation | |
| CN102234328A (en) | Plant low phosphorus stress tolerance correlated protein AtLPT2, its coding gene and application | |
| CN102134569A (en) | Maize MAPK gene promoter and application thereof | |
| Xia et al. | X oo-responsive transcriptome reveals the role of the circular RNA133 in disease resistance by regulating expression of OsARAB in rice | |
| CN104531719B (en) | Rice disease-resistant gene OsSeh1 as well as cloning method, functional identification method and application of rice disease-resistant gene OsSeh1 | |
| CN110684797B (en) | VIGS vector based on TCV with simultaneous silencing of 2 endogenous genes | |
| CN104140462A (en) | Plant salt tolerance related protein GhSnRK2-6, and coding gene and applications thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20120919 |