CN102676486B - Pectin lyase PCPEL18 derived from phytophthora capsici and encoding gene and application thereof - Google Patents
Pectin lyase PCPEL18 derived from phytophthora capsici and encoding gene and application thereof Download PDFInfo
- Publication number
- CN102676486B CN102676486B CN2012101400394A CN201210140039A CN102676486B CN 102676486 B CN102676486 B CN 102676486B CN 2012101400394 A CN2012101400394 A CN 2012101400394A CN 201210140039 A CN201210140039 A CN 201210140039A CN 102676486 B CN102676486 B CN 102676486B
- Authority
- CN
- China
- Prior art keywords
- sequence
- protein
- pectin lyase
- pcpel18
- nucleic acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P20/00—Technologies relating to chemical industry
- Y02P20/50—Improvements relating to the production of bulk chemicals
- Y02P20/52—Improvements relating to the production of bulk chemicals using catalysts, e.g. selective catalysts
Landscapes
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses pectin lyase PCPEL18 derived from phytophthora capsici and an encoding gene and an application thereof. The pectin lyase PCPEL18 provided by the invention is a protein shown as (a) or (b) or (c), wherein (a) is a protein constituted by an amino acid sequence shown as 23-261 bits of a sequence 2 in a sequence table; (b) is a protein constituted by an amino acid sequence shown as a sequence 2 in the sequence table; and (c) is a protein which obtained by performing substitution and/or deletion and/or addition of one or more amino acid residues on an amino acid sequence shown as a sequence 2 in the sequence table or an amino acid sequence shown as 23-261 bits of the sequence 2, has pectin lyase activity, and is derived from (a). The pectin lyase PCPEL18 has high enzyme activity, has specific activity reaching 24+/-0.2U/mg of protein, and can be applied to food processing such as production of fruit juice and liquor.
Description
Technical field
The present invention relates to a kind of pectin lyase and encoding gene thereof and application, particularly from pectin lyase and encoding gene and the application of phytophthora blight of pepper.
Background technology
Capsicum epidemic disease (Pepper Phytophthora Blight) is a kind of destructive disease that worldwide generally occurs.Cause that this sick cause of disease is Phytophthora capsici Leonian, belong to oomycetes door (Oomycetes), Peronosporales (Peronosporales), pythiaceae (Pythiaceae), phytophthora (Phytophthora).Pathogenic bacteria survives the winter in the residual body of diseased plant, soil with mycelium, chlamydospore and oospore usually, also can survive the winter on other host plant, becomes the Second Year primary source of infection.When condition was suitable, the cause of disease after surviving the winter passed to each position of host with pour water, air-flow etc., causes morbidity, then infects.At morbidity season, general diseased plant rate is 20% left and right, and serious reaches more than 80%.In recent years, along with the continuous cropping plantation of capsicum in each main producing region, disease has the trend that increases the weight of gradually, endangers comparatively remarkable.This pathogenic bacteria also can be infected the crops such as tomato, eggplant, cucumber, watermelon, pumpkin except the harm capsicum, threaten greatly producing.
The multiple important cell wall degrading enzyme of secretion or zymin in pathogenic oomycetes and host's Interaction, wherein three important class cell wall degrading enzymes are following three kinds:
(1) polygalacturonase (polygalacturonase, PG) can decompose the a-1 in galacturonic acid, 4 glycosidic links.
(2) pectin methyl esterase (pectin methylesterase, PME) can impel pectin to take off ester, generates pectic acid.
(3) pectin lyase (pectate lyase, PL) is by β elimination reaction cracking a-1, and 4 glycosidic links produce a two key between the non-reducing end residue C-4 of reaction product and C-5.The pectin of cleavable height esterification can reduce rapidly viscosity.
Above-mentioned three class cell wall degrading enzymes all belong to polygalacturonase.Polygalacturonase refers to the general name of plurality of enzymes that can the decompose pectin material.Pectin substance distributes very extensive at occurring in nature, it is a class complexity in plant materials, and the colloidal property carbohydrate is natural macromolecular compound, and molecular weight is 50000-300000 approximately.It is the important composition composition of plant cell wall, mainly is present in the middle layer of cell walls, primary wall also some, secondary wall seldom has pectin substance to exist.
Worldwide, the pathogenic oomycetes easily causes the disease of various plants, has caused serious loss to agriculture production.The Phytophthora capsici disease is a kind of important oomycetes disease, can cause various plants generation serious plant disease, carry out the albumen of phytophthora blight of pepper (Phytophthora capsici) pectin lyase gene isolation and target gene coding in a deep going way and make and the important practice significance of functional analysis tool, can realize control and the research of the plurality of plant diseases that causes for the pathogenic oomycetes.And pectin lyase can be used for food-processing, and as in the production of fruit juice and wine, pectin lyase can be used for increasing the output of fruit juice, is convenient to pressurization and filters, and can improve the transparency of fruit juice and wine.
Summary of the invention
An object of the present invention is to provide a kind of pectin lyase.
Pectin lyase provided by the present invention, name is called PCPEL18, derives from phytophthora blight of pepper (Phytophthora capsici) SD33, be following a) or b) or protein c):
A) protein that is formed by the aminoacid sequence shown in sequence in sequence table 2 23-261 positions;
B) protein that is formed by the aminoacid sequence shown in sequence in sequence table 2;
C) with the aminoacid sequence shown in the aminoacid sequence shown in sequence in sequence table 2 or sequence 2 23-261 positions through replacement and/or disappearance and/or the interpolation of one or several amino-acid residue and have pectin lyase activity by a) derivative protein.
Wherein, in sequence table, sequence 2 is comprised of 261 amino-acid residues, and the 1-22 amino acids forms signal peptide.A) described protein is the maturation protein of pectin lyase, and b) described protein is the precursor protein of pectin lyase.
Albumen in above-mentioned in order to make (a) is convenient to purifying, label as shown in table 1 on N-terminal that can the protein that the aminoacid sequence shown in sequence 2 forms in by sequence table or C-terminal connect.
The sequence of table 1 label
| Label | Residue | Sequence |
| Poly-Arg | 5-6(is generally 5) | RRRRR |
| Poly-His | 2-10(is generally 6) | HHHHHH |
| |
8 | DYKDDDDK |
| Strep-tag II | 8 | WSHPQFEK |
| c-myc | 10 | EQKLI SEEDL |
PCPEL18 in above-mentioned (c) can first synthesize its encoding gene, then carries out biological expression and obtain.The encoding gene of PCPEL18 in above-mentioned (c) can be by the codon with sequence in sequence table 1 one or several amino-acid residue of disappearance in the DNA sequence dna shown in 5 ' end the 1st to 786 bit base, and/or carry out the missense mutation of one or several base pair, and/or obtain at the encoding sequence that its 5 ' end and/or 3 ' end connects the label shown in table 1.
The nucleic acid molecule of coding pectin lyase PCPEL18 also belongs to protection scope of the present invention.
Wherein, described nucleic acid molecule can be DNA, as cDNA, genomic dna or recombinant DNA; Described nucleic acid molecule can be also RNA, as mRNA or hnRNA etc.
Described nucleic acid molecule specifically can be following 1) or 2) or 3) or 4) shown in gene:
1) its encoding sequence is the DNA molecular of the 67-786 position Nucleotide of sequence 1 in sequence table;
2) its encoding sequence is the DNA molecular of the 1-786 position Nucleotide of sequence 1 in sequence table;
3) under stringent condition with 1) or 2) DNA molecule hybridize that limits and the DNA molecular of the above-mentioned pectin lyase PCPEL18 that encodes;
4) with 1) or 2) DNA molecular that limits has the homology more than 90% and the DNA molecular of the above-mentioned pectin lyase PCPEL18 that encodes.
Above-mentioned stringent condition can be with 6 * SSC, the solution of 0.5%SDS, and hybridization, then use 2 * SSC under 65 ℃, and 0.1%SDS and 1 * SSC, 0.1%SDS respectively wash film once.
Wherein, the sequence 1 in sequence table is comprised of 786 Nucleotide, the protein shown in sequence 2 in the code sequence list.
Following 1) any biomaterial-4) also belongs to protection scope of the present invention:
1) contain the expression cassette of the nucleic acid molecule of coding pectin lyase PCPEL18;
2) contain the recombinant expression vector of the nucleic acid molecule of coding pectin lyase PCPEL18;
3) contain the recombinant microorganism of the nucleic acid molecule of coding pectin lyase PCPEL18;
4) contain the transgenic cell line of the nucleic acid molecule of coding pectin lyase PCPEL18.
In above-mentioned biomaterial, 1) the described expression cassette that contains the nucleic acid molecule of coding pectin lyase PCPEL18, refer to express the DNA of pectin lyase PCPEL18 in host cell, this DNA not only can comprise the promotor that starts pectin lyase PCPEL18 genetic transcription, also can comprise stopping the terminator that pectin lyase PCPEL18 transcribes.Further, the described pectin lyase PCPEL18 expression cassette that contains also can comprise enhancer sequence.2) the described recombinant expression vector that contains the nucleic acid molecule of coding pectin lyase PCPEL18 specifically can be in the multiple clone site of carrier pPIC9K and inserts the recombinant expression vector that pectin lyase PCPEL18 encoding gene obtains.3) described recombinant microorganism specifically can be yeast, bacterium, algae and fungi.Wherein, yeast can come pichia pastoris phaff, as pichia pastoris phaff GS115.4) described transgenic cell line does not comprise the reproductive material of plant.
Another purpose of the present invention is to provide a kind of method for preparing pectin lyase PCPEL18.
The method for preparing pectin lyase PCPEL18 provided by the present invention comprises pectin lyase PCPEL18 encoding gene is expressed the step that obtains pectin lyase in biomass cells; Described biomass cells can be microorganism cells, vegetable cell or non-human animal's cell.
A further object of the present invention is to provide a kind of method for preparing the recombinant microorganism of expressing pectin lyase PCPEL18.
The method of the recombinant microorganism of pectin lyase PCPEL18 is expressed in preparation provided by the present invention, comprises that the encoding gene with pectin lyase PCPEL18 imports the host microorganism cell, obtains expressing the step of the recombinant microorganism of pectin lyase PCPEL18.
Wherein, described recombinant microorganism specifically can be yeast, bacterium, algae and fungi.Wherein, yeast can come pichia pastoris phaff, as pichia pastoris phaff GS115.
The nucleic acid molecule of pectin lyase PCPEL18, coding pectin lyase PCPEL18 or contain the application of biomaterial in depolymerized pectin of the nucleic acid molecule of coding pectin lyase PCPEL18 also belongs to protection scope of the present invention.
The nucleic acid molecule total length of amplification coding pectin lyase PCPEL18 or the primer pair of its arbitrary fragment also belong to protection scope of the present invention.Primer pair as the 67-786 position Nucleotide of extension increasing sequence 1.
Experiment showed, pectin lyase PCPEL18 degradable cell wall of chilli.Pectin lyase PCPEL18 also belongs to protection scope of the present invention at the degrading plant cell walls as the application in the degraded cell wall of chilli.
Pectin lyase PCPEL18 has higher enzymic activity, and it reaches 24 ± 0.2U/mg albumen than vigor, can be used for food-processing, as in the production of fruit juice and wine.
Description of drawings
Fig. 1 is the SDS-PAGE electrophoresis of pPIC9K-PCPEL18m/GS115 expression product.
In left figure, M is the standard protein molecular weight, and 1 is empty carrier pPIC9K/GS115 expression product, and 2-8 is that pPIC9K-PCPEL15m/GS115 was in 1-7 days expression products.In right figure, M is the standard protein molecular weight, and 1 and 2 is PCPEL18 expression and purification albumen.
Fig. 2 is the SDS-PAGE electrophoresis of pPIC9K-PCPEL1mm/GS115 expression product.
In left figure, M is the standard protein molecular weight, and 1 is empty carrier pPIC9K/GS115 expression product, and 2-8 is that pPIC9K-PCPEL1m/GS115 was in 1-7 days expression products.In right figure, M is the standard protein molecular weight, and 1,2 and 3 is PCPEL1 expression and purification albumen.
Fig. 3 is the pectin lyase PCPEL18 inoculation Pepper Leaves electromicroscopic photograph of 168 hours.
In figure, A is that PCPEL18 is to the degradation effect of Pepper Leaves cell walls, shown in the sword head; B be the PCPEL18 of passivation to the Pepper Leaves cell walls without destruction, (positive control) shown in the sword head, C be sterilized water to the Pepper Leaves cell walls without any destruction, (negative control) shown in the sword head.
Fig. 4 is the pectin lyase PCPEL1 inoculation Pepper Leaves electromicroscopic photograph of 168 hours.
In figure, A is that PCPEL1 is to the degradation effect of Pepper Leaves cell walls, shown in the sword head; B be the PCPEL1 of passivation to the Pepper Leaves cell walls without destruction, (positive control) shown in the sword head, C be sterilized water to the Pepper Leaves cell walls without any destruction, (negative control) shown in the sword head.
Embodiment
Following embodiment is convenient to understand better the present invention, but does not limit the present invention.Experimental technique in following embodiment if no special instructions, is ordinary method.
In following embodiment, material used, reagent etc., if no special instructions, all can obtain from commercial channels.
The preparation of embodiment 1, pectin lyase
1. the expression of pectin lyase PCPEL18 and PCPEL1
1.1 the encoding gene of preparation pectin lyase PCPEL18 and PCPEL1
The present inventor is from Phytophthora capsici (P.capsici) SD33(J.Phytopathol 157:585-591,2009) found pectin lyase PCPEL18 and PCPEL1 gene in (Shandong Agricultural University).Wherein, the nucleotide sequence of pectin lyase PCPEL18 gene is as shown in sequence in sequence table 1, and its encoding sequence is the 1-786 position of sequence 1, the protein of encoding sequence 2; The signal peptide that 22 amino-acid residues of 1-66 position coding of sequence 1 form.The PCPEL1 gene nucleotide series is as shown in sequence in sequence table 3, and its encoding sequence is the 1-1233 position of sequence 3; The signal peptide that 21 amino-acid residues of 1-63 position coding of sequence 3 form.
According to pair of primers PCPEL18mF, the PCPEL18mR of the pectin lyase PCPEL18 maturation protein of sequence in the pectin lyase PCPEL18 gene design extension increasing sequence table shown in sequence in sequence table 12 23-261 positions, and introduce respectively EcoR I and AvrII restriction enzyme site at upstream and downstream primer two ends.The sequence of PCPEL18mF and PCPEL18mR amplification is the 67-786 position of sequence 1, and the sequence of PCPEL18mF is: ccg
GaattcCaccaccaccaccaccactccatgcgctctgaggcgg, the sequence of PCPEL18mR is: ggtc
CctaggTtagatgtactggacagtgc.
According to pair of primers Pcpel1mF, the Pcpel1mR of the pectin lyase PCPEL1 maturation protein shown in sequence 3 22-410 amino acids residues in the pectin lyase PCPEL1 gene design extension increasing sequence table shown in sequence in sequence table 3, and introduce respectively EcoP I and Not I restriction enzyme site at upstream and downstream primer two ends.the sequence of Pcpel1mF and Pcpel1mR amplification is the 64-1233 position Nucleotide of sequence 3, the sequence of Pcpel1mF is: 5 '-actcgaattccaccaccaccaccaccacgacgacgacgacaagatcacgatcggtt ctc-3 '), the sequence of Pcpel1mR is: 5 '-acttgcggccgcttattcgaggtcaccaac-3 ' is with Phytophthora capsici (P.capsici) SD33(J.Phytopathol 157:585-591, 2009) cDNA that obtains of total RNA reverse transcription of (Shandong Agricultural University) is template, carry out respectively pcr amplification with above-mentioned primer, after amplified production is reclaimed respectively with pGEM-T Easy Vector(Promega) be connected, and conversion bacillus coli DH 5 alpha, by blue hickie screening, the enzyme of plasmid DNA is cut evaluation and screening and is gone out positive colony, the plasmid that extracts positive colony checks order, the recombinant plasmid called after pGEM-PCPEL18m that will contain the 67-786 position of sequence 1, the recombinant plasmid called after pGEM-PCPEL1m that will contain the 64-1233 position Nucleotide of sequence 3.
2. express pectin lyase PCPEL18 and PCPEL1 in pichia pastoris phaff
2.1 preparation expression vector and engineering bacteria
pGEM-PCPEL18m and pGEM-PCPEL1m are used respectively EcoP I and AvrII double digestion, reclaim respectively Insert Fragment, and with the expression plasmid of yeast pPIC9K(Invitrogen of same double digestion) be connected, transform e. coli jm109, the JM109 that transforms is through the Amp resistance screening, bacterium colony through 37 ℃ shake the training spend the night after the extracting plasmid, recombinant plasmid is cut and is identified with enzyme, the plasmid that extracts positive colony checks order, will be between the EcoP of pPIC9K carrier I and AvrII site the recombinant plasmid called after pPIC9K-PCPEL18m of 67-786 position of directed insertion sequence 1, will be between the EcoP of pPIC9K carrier I and Not I site the recombinant plasmid called after pPIC9K-PCPEL1m of 64-1233 position Nucleotide of directed insertion sequence 3.
PPIC9K, pPIC9K-PCPEL18m and pPIC9K-PCPEL1m are carried out the linearizing enzyme with Sa1 I restriction enzyme (be positioned at HIS4 zone) cut, to obtain GS115His
+Mut
+Phenotypic Change.To reclaim purifying purpose fragment adopts electric shocking method to transform pichia pastoris phaff GS115(Invitrogen) competent cell, screening His
+Mut
+The yeast recon of (being that Histidine utilizes type fast).Take the yeast transformant genomic DNA as template, use AOX1 characteristic primer (5 ' AOX1 Primer:5 '-GACTGGTTCCAATTGACAAGC-3 ' and 3 ' AOX1 primer:5 '-GCAAATGGCATTCTGACATCC-3 ') and said gene Auele Specific Primer to carry out pcr amplification, will obtain about 700bp and be incorporated in the genome of Pichia pastaris GS115 with the AOX1 characteristic primer transformant called after pPIC9K-PCPEL18m/GS115(PCPEL18 gene that the pPIC9K-PCPEL18m conversion pichia pastoris phaff GS115 that obtains about 1200bp obtains that increases with PCPEL18mF and PCPEL18mR amplification).To obtain about 1200bp and obtain with the amplification of AOX1 characteristic primer the transformant called after pPIC9K-PCPEL1m/GS115(PCPEL1 gene that the about pPIC9K-PCPEL1m conversion pichia pastoris phaff GS115 of 1700bp obtains being incorporated in the genome of Pichia pastaris GS115 with PCPEL1mF and PCPEL1mR amplification).To obtain the approximately Recombinant Pichia pastoris called after pPIC9K/GS115(empty carrier contrast of the conversion pPIC9K of 500bp with the amplification of AOX1 characteristic primer).
2.2 the cultivation of Yeast engineering bacteria and the secretion inducing of pectin lyase are expressed
1) difference picking pPIC9K-PCPEL18m/GS115, pPIC9K-PCPEL1m/GS115 and pPIC9K/GS115 bacterium colony, be inoculated in the 250mL shaking flask that contains 25mL BMGY substratum, and 28-30 ℃ of shaking culture (250-300rpm) is to logarithmic phase (OD
600Reach 2-6, approximately 16-18 hour).
2) reclaim yeast cell with the centrifugal 5min of 3000g under room temperature.Supernatant discarded is resuspended in cell in the BMMY substratum of proper volume, to OD
600Value is approximately 100-200mL of 1.0().
3) nutrient solution is placed in the 1L shaking flask, covers two-layer sterile gauze, put in shaking table, 28-30 ℃ is continued to cultivate and begin abduction delivering.
4) abduction delivering initial after, added 100% methyl alcohol to final concentration every 24 hours and be 0.5% and induce to keep.
5) induce after, get inducing culture liquid 1mL in the 1.5mL centrifuge tube, with the centrifugal 2-3min of maximum speed of revolution, get supernatant liquor and carry out SDS-PAGE electrophoresis (albumen of inducing take the plasmid that does not add the methanol induction agent is as contrast) under room temperature.
Electrophoresis result shows pPIC9K-PCPEL18m/GS115 after methanol induction as shown in Fig. 1-2, at the 29.5kDa place, a differential protein band is arranged, and empty carrier contrasts without this band, illustrates that the PCPEL18 gene has carried out effectively expressing in pichia spp; PPIC9K-PCPEL1m/GS115 has a differential protein band at the 66kDa place after methanol induction, empty carrier contrasts without this band, illustrates that the PCPEL1 gene has carried out effectively expressing in pichia spp.
2.3 pectin lyase purifying and enzyme activity determination
Wherein, the purification process of pectin lyase is as follows:
2.3.1 the preparation of protein sample
According in step 2.2 1)-4) method carry out abduction delivering, induce and get inducing culture liquid after 168 hours and carry out as follows the preparation of protein sample.
(1) collect inducing culture liquid, the centrifugal 30min of 6000rpm abandons precipitation, gets supernatant liquor.
(2) supernatant liquor is added (NH according to 60% saturation ratio
4)
2SO
4The precipitated pectin lyase, the centrifugal 30min of 8000rpm, collecting precipitation.
(3) precipitation 8ml Native Binding Buffer(Invitrogen R901-15) after Eddy diffusion, dialysed overnight reject salt ion, the dialysis product is protein sample to be purified.
2.3.2 the purifying of pectin lyase
2.3.2.1Ni-NTA the gel-purified post is prepared
(1) draw the 1.5ml gel resin and be added in 10ml gel-purified Ni-NTA post, the slight centrifugal resin precipitated that makes is flow to end clear liquid to the pillar bottom.
(2) add the 6ml distilled water, the Eddy diffusion resin.
(3) the slight centrifugal resin precipitated that makes to the pillar bottom, is flow to end clear liquid.
(4) add 6ml Native Binding Buffer(Invitrogen R901-15), the Eddy diffusion resin.
(5) continuous repeating step is 3 three times.
(6) continuous repeating step 4-5 is three times.
2.3.2.2 pectin lyase purifying
(1) get soluble proteins 8ml and inject the Ni-NTA post.
(2) the soft stirring suspends resin in protein liquid, and absorption 30-60min removes supernatant.
(3) with 8ml Native Wash Buffer(Invitrogen R901-15) rinse, make resin precipitated to the pillar bottom, remove supernatant.
(4) repeating step is 3 three times.
(5) with 8-12ml Native Elution Buffer(Invitrogen R901-15) eluted protein.
(6) repeating step 5 once, is collected elution samples, gets the 1ml elutriant and carries out the SDS-PAGE analysis.
(7) elutriant is dialysed with distilled water, the ion that desalts obtains the enzyme liquid of pure pectin lyase.
2.3.3 the enzyme activity determination of pectin lyase
Wherein, pectin lyase enzyme analytical procedure alive is as follows:
Enzyme liquid utilizes BCA quantification of protein test kit Determination of Protein content.
Pectin lyase can produce 4 by catalysis pectin, the 5-unsaturated double-bond, cause 235nm place's light absorption value increase, the activity of the method pectin lyase of spectrophotometric determination 235nm place's light absorption value increase is adopted in this experiment: the quality percentage composition of getting the configuration of 2ml damping fluid is 0.5% pectin solution (Solarbio P9135-25g) (0.15M citric acid-phosphoric acid buffer, 0.75mM Ca
2+, pH=6.0) in test tube, 40 ℃ of balance 5min add enzyme liquid 0.5ml to be measured, and 40 ℃ of water-bath 10min add the abundant mixing termination reaction of 0.25ml 50mM HCl, survey 235nm place light absorption value.With heat-inactivated enzyme liquid as blank.Make 235nm place's light absorption value increase by 1.0 needed enzyme amounts as the unit of activity of 1 pectin lyase with the per minute decompose pectin.
Three repetitions are established in experiment.Result shows that the enzyme activity of the pectin lyase PCPEL18 that is expressed by pPIC9K-PCPEL18m/GS115 is 24 ± 0.2U/mg albumen, and the enzyme activity of the pectin lyase PCPEL1 that pPIC9K-PCPEL1m/GS115 expresses is 15 ± 0.2U/mg albumen.There is no pectin lyase activity in the expression product of pPIC9K/GS115.
Pectin lyase PCPEL18 and the PCPEL1 of purifying in embodiment 1 are adopted needle punching inoculation Pepper Leaves.Concrete grammar is as follows: get No. 6 Hot Pepper Seedlings of the interim green pepper of 4-6 leaf, adopt needle punching inoculation Pepper Leaves, the inoculum density of PCPEL18 and PCPEL1 is 700ug/mL.Simultaneously with the PCPEL18 of sterilized water inoculation and passivation and PCPEL1 in contrast.Albumen inoculation Pepper Leaves is during 1-7 days, and interval sampling in 24 hours is once carried out transmission electron microscope observing cell wall degradation situation.Wherein, the PCPEL18 of passivation and PCPEL1 obtain as follows: purifying pectin lyase PCPEL18 and PCPEL1 in embodiment 1 are used for active the detection after hot water boils 5min.
Pectin lyase PCPEL18 inoculation 168 hours the time with the degradable degree to partial rupture of Pepper Leaves cell walls, the PCPEL18 of passivation and sterilized water to the Pepper Leaves cell walls without destruction (Fig. 3); Pectin lyase PCPEL1 is obviously lighter to Pepper Leaves cell wall degradation degree 168 hours the time in inoculation, only the Pepper Leaves cell walls is slightly degraded, the PCPEL1 of passivation and sterilized water to the Pepper Leaves cell walls without destruction (Fig. 4).
Claims (13)
1. albumen, be following a) or b) protein:
A) protein that is formed by the aminoacid sequence shown in sequence in sequence table 2 23-261 positions;
B) protein that is formed by the aminoacid sequence shown in sequence in sequence table 2.
2. the nucleic acid molecule of coding claim 1 described albumen.
3. nucleic acid molecule according to claim 2, it is characterized in that: described nucleic acid molecule is following 1) or 2) shown in gene:
1) its encoding sequence is the DNA molecular of the 67-786 position Nucleotide of sequence 1 in sequence table;
2) its encoding sequence is the DNA molecular of the 1-786 position Nucleotide of sequence 1 in sequence table.
4. the expression cassette that contains claim 2 or 3 described nucleic acid molecule.
5. the recombinant expression vector that contains claim 2 or 3 described nucleic acid molecule.
6. the recombinant microorganism that contains claim 2 or 3 described nucleic acid molecule.
7. the transgenic cell line that contains claim 2 or 3 described nucleic acid molecule.
8. the described method of protein of preparation claim 1, comprise the encoding gene of protein claimed in claim 1 is expressed the step that obtains the described protein of claim 1 in biomass cells; Described biomass cells is microorganism cells, vegetable cell or non-human animal's cell.
9. the method for the recombinant microorganism of the described protein of claim 1 is expressed in preparation, comprises that the encoding gene with protein claimed in claim 1 imports the host microorganism cell, obtains expressing the step of the recombinant microorganism of the described protein of claim 1.
10. protein claimed in claim 1 is as the application in pectin lyase.
11. the described nucleic acid molecule of claim 2 or 3, expression cassette claimed in claim 4, recombinant expression vector claimed in claim 5, recombinant microorganism claimed in claim 6 or transgenic cell claimed in claim 7 tie up to the application in the preparation pectin lyase.
12. the application of protein claimed in claim 1 in the degrading plant cell walls.
13. the application of protein claimed in claim 1 in depolymerized pectin.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012101400394A CN102676486B (en) | 2012-05-08 | 2012-05-08 | Pectin lyase PCPEL18 derived from phytophthora capsici and encoding gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012101400394A CN102676486B (en) | 2012-05-08 | 2012-05-08 | Pectin lyase PCPEL18 derived from phytophthora capsici and encoding gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102676486A CN102676486A (en) | 2012-09-19 |
| CN102676486B true CN102676486B (en) | 2013-06-05 |
Family
ID=46809039
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012101400394A Expired - Fee Related CN102676486B (en) | 2012-05-08 | 2012-05-08 | Pectin lyase PCPEL18 derived from phytophthora capsici and encoding gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102676486B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101638663A (en) * | 2009-09-02 | 2010-02-03 | 山东农业大学 | Phytophthora capsici pectate lyase (PL) Pcpel1 gene, protein preparation method and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101643781A (en) * | 2009-09-10 | 2010-02-10 | 山东农业大学 | Molecule detection technique of cayenne pepper phytophthora capsici pectin lyase (Pcpel) 1 genes |
-
2012
- 2012-05-08 CN CN2012101400394A patent/CN102676486B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101638663A (en) * | 2009-09-02 | 2010-02-03 | 山东农业大学 | Phytophthora capsici pectate lyase (PL) Pcpel1 gene, protein preparation method and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| Tyler,B.M. et al..登录号为EGZ11659.1的氨基酸序列.《Genbank》.2011,全文. |
| 付丽.辣椒疫霉（phytophthora capsici）10个果胶裂解酶基因克隆及pcpel1的功能研究.《中国优秀硕士学位论文全文数据库基础科学辑》.2010,(第3期),全文. * |
| 登录号为EGZ11659.1的氨基酸序列;Tyler,B.M. et al.;《Genbank》;20111003;全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102676486A (en) | 2012-09-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108314714B (en) | Verticillium dahliae secretory protein elicitor VdPE L1 and application thereof | |
| CN101736024B (en) | Thaumatin-like protein gene PpTLP from pyrus pyrifolia nakai with antifungal activity and application | |
| CN106244599B (en) | A kind of 1 family gene PnPR1-2 of Radix Notoginseng pathogenesis-related proteins and application | |
| CN109081865A (en) | Moso bamboo PeVQ28 albumen and its encoding gene and application | |
| CN102876692A (en) | Gene of lygus lucidum polygalacturonase (PG) and application of gene | |
| CN101265476A (en) | Chitinasesn gene by Paecilomyces lilacinus and clone method thereof | |
| CN102676486B (en) | Pectin lyase PCPEL18 derived from phytophthora capsici and encoding gene and application thereof | |
| CN102676487B (en) | Pectate lyase PCPEL15 from phytophthora capsici and coding gene and application of pectate lyase PCPEL15 | |
| CN102676488B (en) | Pectin lyase PCPEL20 derived from phytophthora capsici and encoding gene and application thereof | |
| CN102676489B (en) | Pectate lyase PCPEL16 from phytophthora capsici, and coding gene and application thereof | |
| CN102174547B (en) | Beta-1,3-glucanase gene (i)PpGlu(/i) of Pyrus pyrifolia Nakai and application thereof | |
| CN102649951B (en) | Polygalacturonase PCIPG22 from phytophthora capsici, and coded gene and application thereof | |
| CN103044533B (en) | Protein associated with hexose transport and coding gene and application thereof | |
| CN107365794A (en) | Pseudo-ginseng chitinase gene PnCHI1 application | |
| CN109825456B (en) | Marina marine bacillus E40208a1 and application thereof | |
| CN104878027B (en) | Yangbi bulla walnut ribonuclease gene JsRNase and application | |
| CN104131014B (en) | Lilium regale wilson class sprouts the application of fibroin gene LrGLP1 | |
| CN102649952B (en) | Polygalacturonase PCIPG20 from phytophthora capsici, and coded gene and application thereof | |
| CN104152465A (en) | Lilium regale cytochrome b5 gene LrCyt-b5 and application thereof | |
| CN102649953B (en) | Polygalacturonase PCIPG21 from phytophora capsic, and coding gene and application thereof | |
| CN101497885A (en) | Anti-aphides gene PPA, preparation thereof and protein encoded thereby | |
| CN113913450B (en) | Method for expressing chitosanase by rhodopseudomonas palustris, chitosanase, recombinant plasmid, recombinant bacteria, fermentation bacteria and application | |
| CN103484442B (en) | Nod factor lytic enzyme, its encoding gene and application | |
| CN109694921B (en) | Method for rapidly detecting successful infection of host by arbuscular mycorrhizal fungi | |
| Parlindo et al. | Etiology of white root disease of cashew (Anacardium occidentale L.) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130605 Termination date: 20180508 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |