CN102675459B - Preparation method of THP protein monoclonal antibody - Google Patents

Abstract

The invention relates to a preparation method of THP protein monoclonal antibody, which comprises the steps of: step 1, preparing THPP of THP protein fragment; step 2, using the THPP to enable a mouse to have immunity; step 3, screening a hybridoma cell strain; and step 4, preparing the antibody.

Description

The preparation method of THP protein monoclonal antibody

Technical field:

The present invention relates to medical field, particularly field of immunology, be specifically related to the preparation of THP protein monoclonal antibody.

Background technology:

THP albumen is a kind of glycoprotein, and in urine, content is very abundant, and be also the main moiety of urinary cast, it is synthesized and secretion by kidney medullary loop ascending branch heavy wall section and distal convoluted tubule epithelial cell simultaneously.Nineteen fifty Tamm and Horsfall utilizes salting-out process to be isolated purifying, therefore also known as THP, the excretion of normal people THP every day is 20 ~ 200mg.Now proved that red corpuscle that renal glomerulus originates is when by uriniferous tubules medullary loop, erythrocyte surface can adhere to THP, therefore, contributes to judging Source of Hematuria by the THP albumen on specific detection urine erythrocyte surface.In addition, by detecting the change of THP protein content in serum and urine, generation and the development of various diseases can be pointed out.Ephrosis (chronic nephropathy, renal insufficiency, uremia) patient is subject to different pathogeny and infringement in various degree, the synthesis minimizing of THP due to its nephridial tissue, causes THP content in urine and blood to decline, is directly proportional to blood urea nitrogen, increasing of creatinine.In the diseases such as urinary tract obstruction, renal transplantation rejection and ephritis, all find that THP deposits in renal interstitial, this is because THP is from caused by blocking or spill crack that injury of renal tubular causes.In addition, THP albumen is present in the core of urinary system calculus, plays a part very important to the generation of calculus, development.In the purifying urine such as Zhang Weisu, THP albumen prepares the monoclonal antibody of THP as immunogen, but because urinary fractions is complicated, purification ratio is more difficult, existing inward THP monoclonal antibody, but because price is abnormal expensive, be not suitable for scientific effort and Clinical practice.This research and establishment expression vector of people THP protein 36 7-431aa fragment, 367-431aa fragment is that in THP albumen, dominant antigen determines Su site fragment, and in intestinal bacteria, carry out high expression by the method for gene recombination, purifying obtains expressing protein.Design expression system time, express recombinant protein N end band have 6 histidine-tagged, be convenient to the purifying of target protein.The antigen protein obtained by genetically engineered has that purity is high, stable in properties, be convenient to the advantages such as repeatedly a large amount of productions.In addition, escherichia expression system is current most widely used expression system, has heterogenous expression level high, simple to operate, the advantage that result is stable.In order to study structure function and the clinical application of THP further, our expression and purification has the fragment of immunogenic THP albumen, immune mouse has prepared the THP monoclonal antibody of high titre, after qualification, there is good immunologic function, for the research and development of scientific experiment and the detection kit are laid a good foundation.

Summary of the invention:

The present invention relates to a kind of preparation method of THP protein monoclonal antibody, the method comprises the following steps:

Step 1, the preparation of THP protein fragments THPP;

Step 2, uses THPP immune mouse;

Step 3, screening hybridoma cell strain;

Step 4; Prepared by antibody.

Wherein, step 1, the preparation of THP protein fragments THPP; Method is as follows:

1) synthetic primer: introduce BamH1, NotI restriction enzyme site respectively at upstream and downstream primer.

367-431aa-upstream primer: concrete sequence is as follows:

5’AATGGGTCGCGGATCCTCGGGCTTCAATGACAGAGACAACC3’

367-431aa-downstream primer: concrete sequence is as follows:

5’TGCTCGAGTGCGGCCGCCATGTCCAGGGGGTAGGAGCAT3’

2) extract people's normal kidney tissue mRNA, and with it for template carries out reverse transcription PCR, synthesis cDNA first chain, then as template, carries out pcr amplification,

3), after the PCR primer increased is purified, by PCR primer 367-431aa DNA object fragment through BamH1 and NotI double digestion, and connect under the effect of T DNA ligase with same double digestion, linearizing pET28a,

4) connect product conversion and enter competence bacteria BL21, select positive colony, extract plasmid, order-checking after double digestion qualification.By clone's extracting plasmid correct for order-checking, and proceed to BL21 bacterial strain, IPTG abduction delivering, the expression of SDS-PAGE electrophoresis monitoring target protein.The target protein of expressing, after Ni column purification, obtains having immunogenic target protein THPP.

Step 2, uses THPP immune mouse; Method is as follows:

THPP is the female Balb/c mouse in 6 week age of immunogen immune;

Step 3, screening hybridoma cell strain; Method is as follows:

Antagonistic Serum is tired high mouse, carries out one-shot immunity, and positive cell strain goes out the hybridoma cell strain of stably excreting antibody through dilution clone optimal screening.

Step 4; Prepared by antibody; Method is as follows:

Get Balb/c mouse, intraperitoneal inoculation hybridoma, gather ascites after 7 ~ 10 days, by ascites sample upper prop, wash-out, collects elution peak, purifiedly obtains antibody.

Particularly preferred, method of the present invention is as follows:

Step 1, the preparation of THP protein fragments THPP; Method is as follows:

Synthetic primer, introduces BamH1, NotI restriction enzyme site respectively at upstream and downstream primer, and concrete sequence is as follows:

367-431aa-upstream primer:

5’AATGGGTCGCGGATCCTCGGGCTTCAATGACAGAGACAACC3’

367-431aa-downstream primer:

5’TGCTCGAGTGCGGCCGCCATGTCCAGGGGGTAGGAGCAT3’

Extract people's normal kidney tissue mRNA, and with it for template carries out reverse transcription PCR, synthesis cDNA first chain, then as template, carry out pcr amplification, after the PCR primer of amplification is purified, by the PCR primer 367-431aa DNA object fragment after reclaiming through BamH1 and NotI double digestion, and connect under the effect of T DNA ligase with same double digestion, linearizing pET28a, connect product conversion and enter competence bacteria BL21.Select positive colony, extract plasmid, order-checking after double digestion qualification; By clone's extracting plasmid correct for order-checking, and proceed to BL21 bacterial strain, IPTG abduction delivering, the expression of SDS-PAGE electrophoresis monitoring target protein.The target protein of expressing, after Ni column purification, obtains having immunogenic target protein THPP;

Step 2, uses THPP immune mouse; Method is as follows:

With the female Balb/c mouse of the restructuring THP Fragment Protein of purifying for 6 week age of immunogen immune, low dosage long-range immunization is adopted to carry out immunity, method is: subcutaneous multi-point injection, 40ug THPP/ only, immunity 4 times altogether, initial immunity adds Freund's complete adjuvant (0.1ml/ only), and rear three booster immunizations add Freund's incomplete adjuvant (0.1ml/ only), and the immunization interval time is 30 days; The 10th day after third time booster immunization, carry out tail vein get blood to mouse, measure with indirect elisa method and tire, wherein, the natural THP concentration of bag quilt is 2ug/ml;

Step 3, screening hybridoma cell strain; Method is as follows:

Antagonistic Serum is tired and is reached 1 × 10 ⁵above mouse, carries out one-shot immunity, and namely every mouse adopts 10ulTHPP+90ul physiological saline to carry out abdominal injection, and after 3 days, extracting spleen cell carries out cytogamy, cultivates with complete 1640 Screening of Medias of HAT; Using natural THP albumen as antigen coated enzyme mark 96 orifice plate, indirect elisa method detects Hybridoma Cell Culture supernatant, positive cell strain goes out the hybridoma cell strain of stably excreting antibody through 3 limited dilution cloning optimal screening, and (this cell strain has been deposited in China General Microbiological culture presevation administrative center, be numbered CGMCC6040, preservation date on 04 24th, 2012, Classification And Nomenclature: Tamm-horsfall protein monoclonal antibody hybridoma cell strain, No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, address).

Step 4; Prepared by antibody; Method is as follows:

Choose Balb/c mouse in 10 week age, before inoculating cell 7 ~ 14 days, abdominal injection whiteruss 0.5ml/ only in advance.With physiological saline adjustment hybridoma cell strain concentration to 2.0 × 10 ⁶individual/ml, intraperitoneal inoculation hybridoma, inoculating cell is 1.0 × 10 ⁶individual/only, gather ascites after 7 ~ 10 days; Balance protein G affinity column with 0.01M, pH7.2PBS steady to baseline, by ascites sample upper prop, collect stream and wear liquid; Stream is worn liquid upper prop again, continue balance steady to baseline; Add 0.1M glycine buffer wash-out, collect elution peak, SDS-PAGE detects purity; With the elution peak that 0.01M, pH7.2PBS dialysis is collected, purifiedly obtain antibody.

The present invention is also, provides a kind of monoclonal antibody prepared by preparation method of the present invention.

Monoclonal antibody of the present invention can be used in medical product, as medicine, and implant, diagnostic reagent, detection reagent etc.

The present invention preferably provides a kind of diagnostic reagent or detection reagent, containing monoclonal antibody of the present invention in this reagent.

The monoclonal antibody that the invention reside in the application of the invention to detect THP protein content in serum and urine, to carry out Diagnosis and Treat to relative disease.

Accompanying drawing illustrates:

Fig. 1 object fragment PCR electrophorogram,

M:DM2000 DNAmarker is 2000bp, 1000bp, 750bp, 500bp, 250bp, 100bp from top to bottom successively;

M：DNA marker；1，2：PCR product

Fig. 2 THPP protein expression, purifying SDS-PAGE electrophoresis

Albumen Marker is followed successively by from top to bottom: 14.4,20,27,35,45,66,90KD

M)Protein marker；1：Expression of THPP；2：purifed THPP

The Western blot of Fig. 3 mAb analyzes

M：Protein marker；1，2，3：THP

Immunohistochemical methods qualification (X400) of Fig. 4 THP protein antibodies

1)Negtive control；2)THP distribute in human kidney issue

Embodiment:

Further illustrate the present invention by the following examples, but not as limitation of the present invention.

Embodiment 1

1 materials and methods

1.1 bacterial strains, cell strain and animal

Competent cell BL21, expression vector PET28a provided by Military Medical Science Institute nine.Balb/C mouse: purchased from Beijing laboratory animal company limited of dimension tonneau China.Sp2/0 is Beijing CoWin Bioscience Co., Ltd.'s product.

1.2 toolenzyme and reagent

Trizon total serum IgE (Invitrogen company), HiFi-MMLV cDNA first chain synthetic agent box; 5 × In-Fusion HD Enzyme PreMix (clontech); Restriction enzyme BamH1, NotI (MBI); Plasmid Mini Kit, DNA product reclaim test kit, Ni-Agarose His label protein purification kit all purchased from TaKaRa company.Primer synthesis and goal gene sequencing are that promise match genome research center, Beijing completes; The sheep anti mouse two of horseradish peroxidase resists by health for ShiJi Co., Ltd provides.Natural THP sterling is purchased from R & D company.

The molecular cloning of 1.3 people THP protein fragments, prokaryotic expression and purifying

According to the nucleotide sequence of GeneBank database people THP, utilize Bioedit software to carry out homology comparison to sequence, determine conserved sequence, then combine the research of its antigen decision Su epi-position, determine research fragment and synthetic primer.Introduce BamH1, NotI restriction enzyme site respectively at upstream and downstream primer, concrete sequence is as follows: 367-431aa-upstream primer:

5’AATGGGTCGCGGATCCTCGGGCTTCAATGACAGAGACAACC3’

367-431aa-downstream primer:

5’TGCTCGAGTGCGGCCGCCATGTCCAGGGGGTAGGAGCAT3’

Extract people's normal kidney tissue mRNA, and with it for template carries out reverse transcription PCR, synthesis cDNA first chain, then as template, carry out pcr amplification, after the PCR primer of amplification is purified, by the PCR primer 367-431aa DNA object fragment after reclaiming through BamH1 and NotI double digestion, and connect under the effect of T DNA ligase with same double digestion, linearizing pET28a, connect product conversion and enter competence bacteria BL21.Select positive colony, extract plasmid, order-checking after double digestion qualification.By clone's extracting plasmid correct for order-checking, and proceed to BL21 bacterial strain, IPTG abduction delivering, the expression of SDS-PAGE electrophoresis monitoring target protein.The target protein of expressing, after Ni column purification, obtains having immunogenic target protein THP fragment (called after THPP).

DNA sequencing sequence following (for the purpose of subscript part, fragment, consistent with THP367-431aa sequence)

TGAGGGTAAATTTCCCTCCTAGAATATTTTTGTTTACTTTAAGAAGGAGATATACCATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCATATGGCTAGCATGACTGGTGGACAGCAAATGGGTCGCGGATCC TCGGGCTTCAATGACAG AGACAACCGGGACTGGGTGTCTGTAGTGACCCCAGCCCGGGATGGCCCCTGTGG GACAGTGTTGACGAGGAATGAAACCCATGCCACTTACAGCAACACCCTCTACCTG GCAGATGAGATCATCATCCGTGACCTCAACATCAAAATCAACTTTGCATGCTCCTA CCCCCTGGACATGGCGGCCGCACTCGAGCACCACCACCACCACCACTGAGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATCCGGATTGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTC

CCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTAGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAATATGTATCCGCTCATGAATTTAATTCTTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATTATCAAGATTATCAAT

1.4 animal immune

With the female Balb/c mouse of the restructuring THP Fragment Protein of purifying for 6 week age of immunogen immune, low dosage long-range immunization is adopted to carry out immunity, method is: subcutaneous multi-point injection, 40ug THPP/ only, immunity 4 times altogether, initial immunity adds Freund's complete adjuvant (0.1ml/ only), and rear three booster immunizations add Freund's incomplete adjuvant (0.1ml/ only), and the immunization interval time is 30 days.The 10th day after third time booster immunization, carry out tail vein get blood to mouse, measure with indirect elisa method and tire, wherein, the natural THP concentration of bag quilt is 2ug/ml.

The foundation of 1.5 hybridoma cell strains

Antagonistic Serum is tired and is reached 1 × 10 ⁵above mouse, carries out one-shot immunity, and namely every mouse adopts 10ulTHPP+90ul physiological saline to carry out abdominal injection, and after 3 days, extracting spleen cell carries out cytogamy, cultivates with complete 1640 Screening of Medias of HAT.Using natural THP albumen as antigen coated enzyme mark 96 orifice plate, indirect elisa method detects Hybridoma Cell Culture supernatant, positive cell strain goes out the hybridoma cell strain of stably excreting antibody through 3 limited dilution cloning optimal screening, and (this cell strain has been deposited in China General Microbiological culture presevation administrative center, be numbered CGMCC6040, preservation date on 04 24th, 2012, Classification And Nomenclature: Tamm-horsfall protein monoclonal antibody hybridoma cell strain, No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, address).

1.6 antibody preparation and purifying

Choose Balb/c mouse in 10 week age, before inoculating cell 7 ~ 14 days, abdominal injection whiteruss 0.5ml/ only in advance.With physiological saline adjustment hybridoma cell strain concentration to 2.0 × 10 ⁶individual/ml, intraperitoneal inoculation hybridoma, inoculating cell is 1.0 × 10 ⁶individual/only, gather ascites after 7 ~ 10 days.Balance protein G affinity column with 0.01M, pH7.2PBS steady to baseline, by ascites sample upper prop, collect stream and wear liquid; Stream is worn liquid upper prop again, continue balance steady to baseline; Add 0.1M glycine buffer wash-out, collect elution peak, SDS-PAGE detects purity; With the elution peak that 0.01M, pH7.2PBS dialysis is collected, the antibody after purifying is made to be kept at 0.01M, in pH7.2PBS environment.

The mensuration of the tiring of 1.7 antibody, Subclass Antibodies subclass

Measure test kit specification sheets according to Sigma subclass to complete.The mensuration of antibody titer adopts indirect ElISA method: first with natural THP albumen bag by enzyme-linked reaction plate, 2ug/ hole, the bag that spends the night, by afterwards, adds 150ul/ hole confining liquid, and 37 DEG C after 2 hours, are washed 3 times, put 4 DEG C of Refrigerator stores for subsequent use.Antibody dilution is become: 1: 500; 1: 1000; 1: 3000; 1: 9000; 1: 27000; 1: 81000; 1: 240000; 1: 720000,1: 2160000; Hatch 30min for 1: 6480000,37 DEG C, wash plate 4 times, pat dry; Do negative control with Normal Mouse Serum (before immunity), the sheep anti-mouse igg getting horseradish enzyme labelling is special by after 1: 5000 times of dilution, and 100ul/ hole, hatches 20 to 30min for 37 DEG C, washs 4 times.Dilution 20 × TMB to 1 × TMB, adds by 100ul/ hole, 37 DEG C of colour developing 15-30min.Add stop buffer (2M H2SO4) 50ul/ hole.Each hole OD value is measured, judged result with 450nm Single wavelength.

1.8 Western blot detect the specificity of monoclonal antibody

Natural THP protein SDS-PAGE electrophoresis, turn the fine film of nitric acid, 2% bovine serum albumin 4 DEG C is closed and is spent the night; The THP monoclonal antibody of diluting with 1: 1,000 37 DEG C hatches 2h, adds the sheep anti-mouse igg antibody of (1: 8000) horseradish peroxidase-labeled of TBST dilution, hatches 2h for 30 DEG C; Wash 3 times (5min/ time) with TBST after above step completes.Film is put into freshly prepared diamino aniline (DAB) substrate solution to develop the color, distilled water wash color development stopping is reacted, observations.

1.9 immunohistochemical methods detect the specificity of monoclonal antibody

Tissue sample is fixed through 4% paraformaldehyde, paraffin embedding, slice thickness 3-4um, conventional dimethylbenzene dewaxing, serum drips the dilution of anti-THP monoclonal antibody (1: 1000) after closing, incubated at room 2h, drips Biotinylated goat anti-mouse IgG, then drips ABC (1: 100), 37 DEG C, DAB develops the color, and Hematorylin redyes 1min, conventional dehydration, transparent neutral rubber seal sheet.The primary antibodie of recessive contrast adds common mice serum.Result judges: positive findings is visible cell core under microscope, it is light yellow to occur in kytoplasm or on cytolemma, brown color and brownish black particle, distributes in lumps.

2 results

The molecular cloning of 2.1 people THP protein fragments albumen and the structure of recombinant plasmid are with the kidney RNA extracted for template, and reverse transcription PCR obtains goal gene fragment, and clip size is about 200bp (Fig. 1).Insert expression vector pET28a, obtain recombinant plasmid, called after pET28a/THPP, get the cloning and sequencing that PCR qualification is positive, it is completely the same that the sequencing results and GeneBank announce.

The expression and purification of 2.2 people THP protein fragments

Recombinant plasmid pET28a-THPP transformation of E. coli DL21, through IPTG abduction delivering, carrying out ultrasonic bacteria breaking, centrifugally obtains inclusion body, and compare with empty bacterium, recombinant bacterium has good expression.Carrying out purifying through Ni post, obtaining the purity of target protein for being about 95%.The results are shown in Figure 2

The tiring of 2.3 antibody, subclass builds together stably excreting antibody cell strain 9 strain through 3-5 time cloning.Obtain through Protein G affinity chromatography column purification the THP monoclonal antibody that purity is greater than 90%, antibody titer is 10 ⁶~ 10 ⁸, obtain 9 strain cells wherein 8 strain cell subsets be IgG1+kappa, 1 strain cell subsets is IgG2a+kappa, to its further Western blot and immunohistochemical methods qualification.

2.4THP monoclonal antibody Western blot identifies that we detect natural THP albumen by the monoclonal antibody of preparation, and result shows, and have at relative molecular weight 94KD place and significantly identify band, antibody can identify natural THP albumen, the results are shown in Figure 3.

2.5 application of THP monoclonal antibody in immunohistochemical analysis

Carry out the immunoenzymology detection of nephridial tissue further with the antibody of preparation, Fig. 4 result shows, and THP monoclonal antibody well identifies the natural THP albumen of distal convoluted renal tubule in immunohistochemical staining.In normal kidney tissue, THP albumen is mainly distributed in kidney distal tubule and collecting tubule.

Reference

[1]Parsons CL，Stein P，Zupkas P，et al.Defective Tamm-Horsfall protein in patients with interstitial cystitis[J].J Urol，2007，178(6)：2665-2670.

[2]Akiyama A，Stein PC，Houshiar A，Parsons CL.Urothelial cytoprotective activity of Tamm-Horsfall protein isolated from the urine of healthy subjects and patients with interstitial cystitis[J].Int J Urol，2000，7(5)：176-183.

[3]Fukuzaki A，Kaneto H，Ikeda S，Orikasa S.Determining the origin of hematuria by immunocytochemical staining of erythrocytes in urine for Tamm-Horsfall protein[J].J Urol，1996，155(1)：248-251.

[4]Janssens PM，Kornaat N，Tieleman R，Monnens LA，Willems JL.Localizing the site of hematuria by immunocytochemical staining of erythrocytes in urine[J].Clin Chem，1992，38(2)：216-222.

[5]Mo L，Huang HY，Zhu XH，Shapiro E，HastyDL，Wu XR：Tamm-Horsfall protein is a critical renal defense factor protecting against calcium oxalate crystal formation[J].Kidney Int 2004，66：1159-1166.

[6] Uromucoid monoclonal antibody preparation and clinical application thereof. Shanghai Journal of Immunology, 1991,11 (4): 208-211

Claims (1)

1. a hybridoma cell strain, its preserving number is: CGMCC No.6040.