CN102653795A - Primers and method for distinguishing Thai marble goby fries from local marble goby fries - Google Patents
Primers and method for distinguishing Thai marble goby fries from local marble goby fries Download PDFInfo
- Publication number
- CN102653795A CN102653795A CN2012101581953A CN201210158195A CN102653795A CN 102653795 A CN102653795 A CN 102653795A CN 2012101581953 A CN2012101581953 A CN 2012101581953A CN 201210158195 A CN201210158195 A CN 201210158195A CN 102653795 A CN102653795 A CN 102653795A
- Authority
- CN
- China
- Prior art keywords
- primer
- fries
- local
- dna
- primers
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the field of DNA markers in the field of aquaculture science and in particular relates to primers and a method for distinguishing Thai marble goby (oxyeleotrismarmoratus) fries from local marble goby (odontobutispotamophila) fries by adopting microsatellite markers. A pair of primer sequences is shown in SEQIDNo.8 and SEQIDNo.9. The method comprises the following steps of: carrying out PCR (polymerase chain reaction) amplification on the samples to be distinguished by utilizing primers; and then detecting the PCR products by using 1% of agarose gel electrophoresis and carrying out EB (ethidium bromide) staining, wherein the samples with 250bp stripes are Thai marble goby and the samples with 300bp stripes are local marble goby. The method has the following beneficial effects: the microsatellite markers obtained by the method can carry out stable amplification in oxyeleotrismarmoratus and odontobutispotamophila and have stable results and clear stripes; and the method is simple and convenient to operate and is low in cost and strong in practicability.
Description
Technical field
The invention belongs to the application of Aquaculture Science field dna marker technology in production practice, be specifically related to use microsatellite marker Thailand bamboo shoot shell fish (clouding Oxyeleotris marmoratus
Oxyeleotris marmoratus) and local bamboo shoot shell fish (rivers and creeks Odontobutis obscura
Odontobutis potamophila) fry differentiates.
Background technology
The clouding Oxyeleotris marmoratus (
Oxyeleotris marmoratus) popular name Thailand bamboo shoot shell fish (Marble goby), belong to Perciformes (Pereifomes) 、 Yellowfin goby suborder (Gobioidei), Eleotridae (Eleotridae), Oxyeleotris marmoratus belong to (
Oxyeleotris), be the famous and precious fresh water fingerling that build is maximum in the Eleotridae fish, growth is the fastest.The clouding Oxyeleotris marmoratus is to originate in countries in Southeast Asia such as Thailand, Vietnam, Malaysia, also is simultaneously one of improved seeds of these country's foreign exchange earnings.Because characteristics such as this fishing gear has that decorative pattern is beautiful, delicious flavour, mouthfeel are soft, and is nutritious receive China coastal cities and Hong Kong, Macao, Taiwan human consumer's welcome deeply.China has become the geographic important freshwater aquiculture object of coastal areas of southern China at present since last century, the eighties was introduced a fine variety from South East Asia.In recent years, along with the expansion of the scale of breed, the reduction of the cost of surviving the winter and the maturation of cultural technique, the breed of this fish is just risen on province, the middle and lower reach of Yangtze River and other places, and the trend that enlarges and northwards extend is year by year arranged.
The rivers and creeks Odontobutis obscura (
Odontobutis potamophila), be under the jurisdiction of Perciformes (Perciformes) 、 Yellowfin goby suborder (Gobioidei), Eleotridae (Odontobutidae), Odontobutis (
Odontobutis), popular name sleeper fish also is called local bamboo shoot shell fish by the people on ground such as Jiangsu, is a kind of comparatively famous and precious small-sized economic fish.It mainly is distributed in the Changjiang river, downstream and riverine each tributary, Min River water system, Qiantang River water system, accidental the Yellow River water system.The rivers and creeks Odontobutis obscura receives liking of ground people such as Jiangsu and Zhejiang Provinces, Shanghai, Fujian deeply because of thorn between its fine and tender taste, delicious flavour, flesh is few.Simultaneously, this fish also is to have one of fish species of good development prospect in Jiangsu Province's characteristic water industry.
Because clouding Oxyeleotris marmoratus and rivers and creeks Odontobutis obscura differ from one another, and market demand grows with each passing day, so the breed scale of the two kinds of fishes in ground such as Jiangsu is also enlarging year by year, the seed demand is significantly increase thereupon also, but the consequent is the source problem that comes of seed.Because clouding Oxyeleotris marmoratus and rivers and creeks Odontobutis obscura are very high in fry stage similarity, with the naked eye also be difficult to its resolution is come even culture veteran fisherman.So under the trend of economic interests, dragons and fishes jumbled together in domestic bamboo shoot shell fry kind market.The clouding Oxyeleotris marmoratus be China from country in Southeast Asia's introduced variety, though individual big, tolerance to cold is far away from the rivers and creeks Odontobutis obscura; And be lower than in water temperature under the field conditions of 10 degree and be difficult to survival, the rivers and creeks Odontobutis obscura is then mostly to be wild, domesticly then need tame it; And maximum individuality is merely about 200g; At present, this fish in the THE LOWER YANGTZE VALLEY province manual scale breed successfully, and cultured area constantly enlarges.If the culturist gets kind wrong accidentally, certainly will cause post-processed improper, thus, the financial loss that the raiser is caused is with inestimable.Therefore, have a extensive future but under the miscellaneous background of fry market, press for and a kind of two kinds of bamboo shoot shell fish fries are differentiated the technology that comes, avoid culturing error and occur in the source in breed.
Microsatellite DNA in the genome is with the heredity of Mendelian's mode; Being codominance expresses; And have simultaneously distribute wide, genetic information content is high and be convenient to advantage such as PCR detections, has been widely used in the research of aspects such as the evaluation of fish sibship, analysis of genetic diversity, genetic linkage map structure and phyletic evolution.Research shows, little satellite flanking sequence between kind and have between the genus of nearer sibship quite conservatively, and has the part microsatellite locus between sibship taxonomical group far away, certain conservative property to be arranged also in genome in belonging to.The nearly edge species that the conservative property of little satellite flanking sequence makes the micro-satellite primers in a certain species, developed be applied to be correlated with become possibility.
Summary of the invention
The present invention provides the discrimination method of a kind of Thailand bamboo shoot shell fish and local bamboo shoot shell fish fry.Fast two kinds of fries are distinguished by molecule means (1 pair of micro-satellite primers), avoid because seed is chosen and improperly brings financial loss to the raiser.
Ultimate principle of the present invention is: (1) is with efficient enrichment with magnetic bead method mass development clouding Oxyeleotris marmoratus micro-satellite primers; (2) from the exploitation primer, be chosen at the several amplifications that micro-satellite primers are used for rivers and creeks Odontobutis obscura colony that to stablize amplification in the clouding Oxyeleotris marmoratus colony and not have polymorphum; (3) filter out in rivers and creeks Odontobutis obscura colony and also can obviously increase, but the amplified band position obviously is different from the micro-satellite primers of clouding Oxyeleotris marmoratus, is used for the discriminating of clouding Oxyeleotris marmoratus and rivers and creeks Odontobutis obscura fry.
The present invention filters out the primer that a pair of kind is used for Thailand bamboo shoot shell fish and the discriminating of local bamboo shoot shell fish fry, called after H228, and primer sequence is following:
F：TCCAATCAGGCAGTAAGCAG（SEQ?ID?No.8）
；
R：GGGACATCAGGACCAACTCT（SEQ?ID?No.9）
。
Method with above-mentioned H228 primer discriminating Thailand bamboo shoot shell fish and local bamboo shoot shell fish fry comprises the following steps:
(1) with the H228 primer sample to be identified is increased, obtain the PCR product;
(2) with 1% agarose gel electrophoresis the PCR product is detected, EB dyeing, the 250bp size strip be Thailand bamboo shoot shell fish, the 300bp size strip be local bamboo shoot shell fish;
H228 primer of the present invention obtains according to following steps: 1. the extraction of genomic dna (clouding Oxyeleotris marmoratus colony, rivers and creeks Odontobutis obscura colony); 2. the enrichment with magnetic bead method is screened the little point of the little satellite of clouding Oxyeleotris marmoratus; 3. screening is the singlet site in clouding Oxyeleotris marmoratus colony; 4. expand rivers and creeks Odontobutis obscura colony with singlet site primer; 5. filter out 1 pair and all can stablize amplification two colonies, and the visibly different primer of clip size, be used for the discriminating of clouding Oxyeleotris marmoratus and rivers and creeks Odontobutis obscura fry.
Said step 1, the extraction of genomic dna comprises: tail fin 0.1 ~ 0.2g of clip experiment fish, take conventional phenol-chlorine method to extract genomic dna; The nucleic acid-protein determinator is measured its purity and concentration, and agarose gel electrophoresis detects the DNA integrity.
Said step 2, the little point of the enrichment with magnetic bead method screening little satellite of clouding Oxyeleotris marmoratus: with clouding Oxyeleotris marmoratus genomic dna warp
Bsp143The I restriction enzyme carries out enzyme and cuts the back jointing, carries out enrichment with magnetic bead behind the pcr amplification, and enriched product checks order to positive colony after cloning.
Said step 3; Screening is the singlet site in clouding Oxyeleotris marmoratus colony: the sequence that contains the little point of little satellite in to sequencing result is carried out design of primers; Pcr amplification is carried out in the synthetic back of primer in clouding Oxyeleotris marmoratus colony; Amplified production is selected and is only amplified a clear band through the screening of 6% polyacrylamide gel electrophoresis, promptly presents the micro-satellite primers of singlet.
Said step 4, expand rivers and creeks Odontobutis obscura colony with singlet site primer: the primer with screening carries out pcr amplification to rivers and creeks Odontobutis obscura colony, in the amplification procedure, annealing temperature, MgCl
2Condition such as concentration and the amplification of clouding Oxyeleotris marmoratus colony are identical.
Said step 5; Filter out two colonies and all can stablize amplification; And the visibly different primer of clip size; Be used for the discriminating of clouding Oxyeleotris marmoratus and rivers and creeks Odontobutis obscura fry: detect clouding Oxyeleotris marmoratus colony and rivers and creeks Odontobutis obscura colony pcr amplification product simultaneously with 1% agarose gel electrophoresis, filter out the micro-satellite primers that to differentiate clouding Oxyeleotris marmoratus colony and rivers and creeks Odontobutis obscura colony.
The micro-satellite primers H228 that the present invention obtained (51 ℃ of annealing temperatures) all can stablize amplification in clouding Oxyeleotris marmoratus crowd He in the rivers and creeks Odontobutis obscura colony, the result is stable; Band is clear; Only need just can see notable difference with the detection of 1% agarose gel electrophoresis, and simple to operation, cost is low; Practical strong, helpful to breeding production.
Description of drawings
Fig. 1: the partial results that H13 increases in clouding Oxyeleotris marmoratus colony (polyacrylamide gel electrophoresis screening singlet primer)
Fig. 2: the amplification (agarose gel electrophoresis screening diagnostic primers) of H228 microsatellite marker in part clouding Oxyeleotris marmoratus colony and rivers and creeks Odontobutis obscura colony.
Embodiment
1. the extraction of genomic dna (clouding Oxyeleotris marmoratus colony, rivers and creeks Odontobutis obscura colony):
1) gets the tail fin 0.1 ~ 0.3g that tests fish and add 450 μ L DNA extraction buffer (10 mmol/L Tris-HCl; 5 mmol/L EDTA; 75 mmol/L NaCl); Add SDS and Proteinase K to final concentration behind the mixing successively and be respectively 0.5% and 200 μ g/mL, spend the night in 55 ℃ of water-bath digestion then.
2) add the saturated phenol of equal-volume, phenol/chloroform/primary isoamyl alcohol (25:24:1), each extracting of chloroform/primary isoamyl alcohol (24:1) once.After each extracting all softly mixed 10 minutes, 4 ℃, centrifugal 20 minutes of 12000rpm got supernatant.
3) the gained supernatant is added the absolute ethyl alcohol deposition of 2 times of volumes of 2.5 mol/L NaCl (final concentration is 0.2 mol/L) and precooling, 12000rpm got deposition in centrifugal 20 minutes; With seasoning at room temperature after the 70% ethanol rinsing 2 times, treat to be dissolved among the TE of 200 μ L after the ethanol volatilization, place 4 ℃ of refrigerators subsequent use.On the nucleic acid-protein determinator, measure its purity and concentration, agarose gel electrophoresis detects.
2. the enrichment with magnetic bead method is screened the little point of the little satellite of clouding Oxyeleotris marmoratus:
1) with clouding Oxyeleotris marmoratus genomic dna warp
Bsp143Four kinds of sticking end limit property restriction endonucleases of I carry out the single endonuclease digestion reaction.Filter out the enzyme that endonuclease bamhi mainly is distributed in the 400-1200bp scope and cut system.Enzyme is cut system: genomic dna 8 μ g, 10 * buffer, 4 μ L, restriction endonuclease 5U, TV 40 μ L.Reaction conditions is: 37 ℃ of water bath with thermostatic control 5h, enzyme cut and finish 20 minutes termination reactions of back 65 ℃ of water-baths.Get 5 μ L enzymes and cut the detection of product sepharose.Use the AxyPrep dna gel recovery test kit recovery enzyme of Axygen company to cut product.
2) the DNA two ends of reclaiming are connected phosphorylated linker Linker A, joint sequence is:
Linker?A 5’-GCGGTACCCGGGAAGCTTGG-3’（SEQ?ID?No.1）
3’-CGCCATGGGCCCTTCGAACCCTAG-p-5’?（SEQ?ID?No.2）
Joint long-chain sticking terminal (5 ' end) band phosphate radical.Get enzyme and cut back recovery DNA 14 μ L, add Linker A (100 μ M) 2 μ L, connect buffer 2 μ L, the T4 ligase enzyme, TV 20 μ L, 16 ℃ of connections are spent the night.Connect product and reclaim, remove unnecessary joint, use 40 μ L elutriant wash-outs, get 5 μ L electrophoresis detection through AxyPrep DNA test kit.
3) remaining elutriant is used for Pre-PCR, makes 10 pipe PCR altogether, adds 10 * Taq buffer, 2 μ L in each reaction tubes, dNTP (2mM) 1 μ L, MgCl
2(25mM) 1.5 μ L, primer Primer I (10 μ M) 1 μ L, Taq enzyme 1U, template DNA 3.5 μ L, TV are 20 μ L.The sequence of Primer I is: 5 '-GCGGTACCCGGGAAGCTTGG-3 ' (SEQ ID No.3).The PCR reaction is 12 circulations, and each circulation comprises: 94 ℃ of sex change 30s, and 63 ℃ of annealing 30s, 72 ℃ are extended 60s.The preparatory PCR product agarose electrophoresis that takes a morsel after reaction finishes detects.Remain about 200 μ L reaction solutions and reclaim through AxyPrep DNA test kit, wash-out is in the elutriant of 40 μ L.
4) biotinylated probes and library hybridization, Streptomycin sulphate enrichment with magnetic bead and Post-PCR: get the DNA elutriant of whole 40 μ L, add ddH
2O 460 μ L place 95 ℃ of water-bath sex change 5 minutes with reaction tubes; Biotinylated probes Biotin (CA) 3 μ L with 50 μ M add in another EP pipe simultaneously; And (8.8g NaCl, 4.4g Trisodium Citrate are configured to 100mL solution to add 20 * SSC; Regulate pH 7.2 back sterilizations) 13 μ L; 68 ℃ of preheatings add the dna solution of accomplishing denaturing step and continue 68 ℃ of insulation hybridization 10 minutes, place the room temperature cooling afterwards.The sequence of biotinylated probes Biotin (CA) is following:
Biotin-5’-ATAGAATATCACACACACACACACACACACACACACACACA-3’?（SEQ?ID?No.4）
(Promega) carries out the fragment enrichment with magnetic bead, needs washing before magnetic bead uses: flick the pipe end, the suspension magnetic bead utilizes magnet stand Separation Stand to collect, and abandons solution; In pipe, add 300 μ L, 0.5 * SSC, flick pipe end mixing, magnet stand is abandoned solution (washing 3 times) after collecting; It is for use to add 100 μ L, 0.5 * SSC and resuspended magnetic bead.In the magnetic bead pipe that washing finishes, add the good dna solution of full dose hybridization, put upside down mixing once in every 1-2 minute, mixing 5-10 time; Utilize magnet stand to collect magnetic bead; Sucking-off solution is retained (prevent that the magnetic bead inefficacy from causing the failure of an experiment, retain solution and magnetic bead reaction newly like available this of Post-PCR reaction failure), uses 300 μ L0.1 * SSC to wash magnetic bead; Wash 4 times, exhaust solution for the last time as far as possible; Add 100 μ L ddH
2O, resuspended magnetic bead, 95 ℃ of water-baths 5 minutes utilize magnet stand to collect magnetic bead, change dna solution over to new pipe; Utilize vacuum-drying appearance or baking oven that 100 μ LDNA liquid are concentrated into about 20 μ L.
Post-PCR makes 5 pipes altogether, adds 10 * Taq buffer, 2 μ L in each reaction tubes, dNTP (2mM) 1 μ L, MgCl
2(25mM) 1.5 μ L, primer Primer I (10 μ M) 1 μ L, Taq enzyme 1U, template DNA 4 μ L, TV are 20 μ L.The PCR reaction is 12 circulations, and each circulation comprises: 94 ℃ of sex change 30s, and 63 ℃ of annealing 30s, 72 ℃ are extended 60s.The agarose electrophoresis that takes a morsel the PCR reaction solution detects, and all the other reclaim through AxyPrep DNA test kit, and wash-out is in the elutriant of 40 μ L and use the nucleic acid-protein appearance to measure DNA concentration.
3. screening is the singlet site in clouding Oxyeleotris marmoratus colony:
1) according to the concentration of gained DNA, the ratio of regulating foreign DNA and T carrier: carrier DNA is 1:2-10 with the ratio scope of inserting the fragment mole number.Linked system is: foreign DNA 1-4 μ L, and T carrier (0.03pmol) 1 μ L connects buffer 5 μ L, TV 10 μ L, 16 ℃ of connections are spent the night.
2) full dose 10 μ L are connected liquid and add in the 100 μ L DH5a competent cells, placed on ice 30 minutes; Placed on ice immediately 1 minute behind 42 ℃ of heat shock 60s; Add 900 μ L LB substratum, 37 ℃ of 100rpm concussions were cultivated 60 minutes; Get 100 μ L bacterium liquid evenly be layered on contain X-gal (40 μ L, 20mg/mL), IPTG (7 μ L, 200mg/mL), on the 90mL agar plate of Amp (final concentration 60 μ g/mL), treat that liquid is absorbed by agar plate fully after, cultivated 12-15 hour for 37 ℃; The single white colony of picking is inoculated in 500 μ L and contains in the LB liquid nutrient medium of 60 μ g/mL Amp 220rpm shaking culture 3 hours.
3) use M13 and RV-M primer to be bacterium liquid PCR, whether the bacterial detection clone contains the insertion fragment, and reaction conditions is 10 * Taq buffer, 1 μ L, dNTP (2mM) 0.5 μ L, MgCl
2(25mM) 0.8 μ L, primer+(10 μ M) 0.3 μ L, primer-(10 μ M) 0.3 μ L, Taq enzyme 0.5U, bacterium liquid 0.5 μ L, TV are 10 μ L.The PCR reaction is 25 circulations, and each circulation comprises: 94 ℃ of sex change 30s, and 56 ℃ of annealing 30s, 72 ℃ are extended 60s.Agarose gel electrophoresis detects, and chooses the positive colony of amplified fragments 400-1200bp scope and does the secondary PCR screening.
M13：?5’-CGCCAGGGTTTTCCCAGTCACGAC-3’?（SEQ?ID?No.5）
RV-M：5’-GAGCGGATAACAATTTCACACAGG-3’?（SEQ?ID?No.6）
4) postsearch screening adopt in M13, the RV-M primer one with the PrimerII-CA primer that partners, two combination: M13+PrimerII-CA altogether, RV-M+PrimerII-CA.Reaction conditions is 10 * Taq buffer, 1 μ L, dNTP (2mM) 0.5 μ L, MgCl
2(25mM) 0.8 μ L, primer+(10 μ M) 0.3 μ L, primer-(10 μ M) 0.3 μ L, Taq enzyme 0.5U, bacterium liquid 0.5 μ L, TV are 10 μ L.The PCR reaction is 25 circulations, and each circulation comprises: 94 ℃ of sex change 30s, and 56 ℃ of annealing 30s, 72 ℃ are extended 60s.Agarose gel electrophoresis detects, and chooses the corresponding bacterium liquid that amplified fragments occurs and send biotech firm's order-checking.
PrimerII-CA：5’-CACACACACACACACACACACACA-3’?（SEQ?ID?No.7）
5) contain the sequences Design primer of microsatellite locus with 5.0 couples of Primer, primer is synthetic by Shanghai Jierui Biology Engineering Co., Ltd.Be used for clouding Oxyeleotris marmoratus colony pcr amplification after primer is synthetic.System is: 10 * Taq buffer, 2 μ L, dNTP (2mM) 2 μ L, MgCl
2(25mM) 1.5 μ L, primer+(10 μ M) 1 μ L, primer-(10 μ M) 1 μ L, Taq enzyme 1U, template DNA 1 μ L adds the sterilization distilled water and supplies 20 μ L systems.The PCR program is 94 ℃ of preparatory sex change 5min, 94 ℃ of sex change 30sec, and annealing 30sec, 72 ℃ are extended 30sec, react 30 circulations, and last 7 ℃ are extended 5min.
6) PCR amplified production warp 8% polyacrylamide gel electrophoresis, power 80W, electrophoresis 1.5h, cma staining, camera is taken pictures, filters out in clouding Oxyeleotris marmoratus colony, to be the many of singlet to micro-satellite primers, be example with H13, effect is as shown in Figure 1.
4. expand rivers and creeks Odontobutis obscura colony with singlet site primer:
Use the micro-satellite primers that screens of step Odontobutis obscura colony in rivers and creeks is carried out pcr amplification, reaction conditions and system and identical in clouding Oxyeleotris marmoratus colony, promptly system is: 10 * Taq buffer, 2 μ L, dNTP (2mM) 2 μ L, MgCl
2(25mM) 1.5 μ L, primer+(10 μ M) 1 μ L, primer-(10 μ M) 1 μ L, Taq enzyme 1U, template DNA 1 μ L adds the sterilization distilled water and supplies 20 μ L systems.The PCR program is 94 ℃ of preparatory sex change 5min, 94 ℃ of sex change 30sec, and annealing 30sec, 72 ℃ are extended 30sec, react 30 circulations, and last 7 ℃ are extended 5min.Though little satellite flanking sequence has suitable conservative property, because not belonging to, rivers and creeks Odontobutis obscura and clouding Oxyeleotris marmoratus do not belong to fish together, still have the part primer in rivers and creeks Odontobutis obscura colony, to increase.
5. filter out 1 pair and all can stablize amplification two colonies, and the visibly different primer of clip size, be used for the discriminating of clouding Oxyeleotris marmoratus and rivers and creeks Odontobutis obscura fry: will all have stable amplification PCR products to detect two colonies with 1% agarose gel electrophoresis; EB dyeing; It is clear to filter out band, and the position is obviously different, can be used in a pair of micro-satellite primers of the discriminating of clouding Oxyeleotris marmoratus and rivers and creeks Odontobutis obscura fry; Called after H228, primer sequence is shown in SEQ ID No.8 and SEQ ID No.9.The amplification of H228 microsatellite marker in clouding Oxyeleotris marmoratus colony and rivers and creeks Odontobutis obscura colony as
Fig. 2,What 250bp was big or small is Thailand bamboo shoot shell fish, and what 300bp was big or small is local bamboo shoot shell fish.
SEQUENCE?LISTING
< 110>Nanjing Normal University
< 120>diagnostic primers and the method for a kind of Thailand bamboo shoot shell fish and local bamboo shoot shell fish fry
<130>
<160> 9
<170> PatentIn?version?3.3
<210> 1
<211> 20
<212> DNA
< 213>artificial sequence
<400> 1
gcggtacccg?ggaagcttgg 20
<210> 2
<211> 24
<212> DNA
< 213>artificial sequence
<400> 2
cgccatgggc?ccttcgaacc?ctag 24
<210> 3
<211> 20
<212> DNA
< 213>artificial sequence
<400> 3
gcggtacccg?ggaagcttgg 20
<210> 4
<211> 41
<212> DNA
< 213>artificial sequence
<400> 4
atagaatatc?acacacacac?acacacacac?acacacacac?a 41
<210> 5
<211> 24
<212> DNA
< 213>artificial sequence
<400> 5
cgccagggtt?ttcccagtca?cgac 24
<210> 6
<211> 24
<212> DNA
< 213>artificial sequence
<400> 6
gagcggataa?caatttcaca?cagg 24
<210> 7
<211> 24
<212> DNA
< 213>artificial sequence
<400> 7
cacacacaca?cacacacaca?caca 24
<210> 8
<211> 20
<212> DNA
< 213>artificial sequence
<400> 8
tccaatcagg?cagtaagcag 20
<210> 9
<211> 20
<212> DNA
< 213>artificial sequence
<400> 9
gggacatcag?gaccaactct 20
Claims (2)
1. one kind is used for the primer that Thailand bamboo shoot shell fish and local bamboo shoot shell fish fry are differentiated, it is characterized in that said primer sequence is following:
F：TCCAATCAGGCAGTAAGCAG；
R：GGGACATCAGGACCAACTCT。
2. the discrimination method of a Thailand bamboo shoot shell fish and local bamboo shoot shell fish fry is characterized in that, comprises the following steps:
(1) with the said primer of claim 1 sample to be identified is increased, obtain the PCR product;
(2) with 1% agarose gel electrophoresis the PCR product is detected, EB dyeing, the 250bp size strip be Thailand bamboo shoot shell fish, the 300bp size strip be local bamboo shoot shell fish.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201210158195 CN102653795B (en) | 2012-05-21 | 2012-05-21 | Primers and method for distinguishing Thai marble goby fries from local marble goby fries |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201210158195 CN102653795B (en) | 2012-05-21 | 2012-05-21 | Primers and method for distinguishing Thai marble goby fries from local marble goby fries |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102653795A true CN102653795A (en) | 2012-09-05 |
| CN102653795B CN102653795B (en) | 2013-10-09 |
Family
ID=46729524
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201210158195 Expired - Fee Related CN102653795B (en) | 2012-05-21 | 2012-05-21 | Primers and method for distinguishing Thai marble goby fries from local marble goby fries |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102653795B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103667499A (en) * | 2013-12-26 | 2014-03-26 | 南京师范大学 | Primer and method for identifying odontobutis potamophila, o. yaluensis and o. sinensis |
| CN104531847A (en) * | 2014-12-10 | 2015-04-22 | 南京师范大学 | Microsatellite marker method for identifying wild odontobutis potamophila population of minjiang river basin |
| CN112391481A (en) * | 2020-11-18 | 2021-02-23 | 中国水产科学研究院珠江水产研究所 | SNPs for identifying fish species of oxyeleotris obscura, AS-PCR primer group based on SNPs, and detection method and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102134586A (en) * | 2010-01-22 | 2011-07-27 | 海南大学 | High-efficiency screening method for microsatellite marker of Marbled Sand Goby and application of same |
| CN102134604A (en) * | 2010-12-30 | 2011-07-27 | 厦门大学 | Marker and method for identifying single nucleotide polymorphism of bostrichthys sinensis group |
-
2012
- 2012-05-21 CN CN 201210158195 patent/CN102653795B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102134586A (en) * | 2010-01-22 | 2011-07-27 | 海南大学 | High-efficiency screening method for microsatellite marker of Marbled Sand Goby and application of same |
| CN102134604A (en) * | 2010-12-30 | 2011-07-27 | 厦门大学 | Marker and method for identifying single nucleotide polymorphism of bostrichthys sinensis group |
Non-Patent Citations (1)
| Title |
|---|
| 李妍等: "河川沙塘鳢的ISSR分析", 《安徽农业科学》, vol. 38, no. 2, 31 December 2010 (2010-12-31), pages 606 - 608 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103667499A (en) * | 2013-12-26 | 2014-03-26 | 南京师范大学 | Primer and method for identifying odontobutis potamophila, o. yaluensis and o. sinensis |
| CN104531847A (en) * | 2014-12-10 | 2015-04-22 | 南京师范大学 | Microsatellite marker method for identifying wild odontobutis potamophila population of minjiang river basin |
| CN112391481A (en) * | 2020-11-18 | 2021-02-23 | 中国水产科学研究院珠江水产研究所 | SNPs for identifying fish species of oxyeleotris obscura, AS-PCR primer group based on SNPs, and detection method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102653795B (en) | 2013-10-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102533727B (en) | Preparation method of developing Phaseolus vulgaris SSR primers by magnetic bead enrichment | |
| CN102134586A (en) | High-efficiency screening method for microsatellite marker of Marbled Sand Goby and application of same | |
| CN113930525B (en) | Specific sequence for snakehead sex identification and application | |
| CN101418347A (en) | Yellow catfish sex chromosome specific molecular markers and genetic sex identification method | |
| CN110331228B (en) | Internal reference gene of glehnia littoralis and screening method and application thereof | |
| CN100396794C (en) | Determination primer and method for yellow croaker in different population | |
| CN110066880A (en) | A kind of method of four large Chinese carp fish product of fast qualitative detection | |
| CN102653795B (en) | Primers and method for distinguishing Thai marble goby fries from local marble goby fries | |
| CN101974523B (en) | Primer, probe, kit and method for real-time fluorescence PCR identification of shark's fin | |
| CN102604963B (en) | Separation, cloning and application of Poncirus trifoliata EARLYFLOWERING 5 (PtELF5) gene | |
| CN103361340B (en) | Bay scallop thermostable related heat shock protein 70 gene marker and assistant breeding method thereof | |
| CN106916884A (en) | A kind of bolti salt tolerant related molecular marker SSR450 and its application | |
| KR100769358B1 (en) | Method for Genetically Discriminating a Korean Native Porphyra yezoensis Ueda and a Primer Set for the Method | |
| CN108220456B (en) | EST-SSR primer and identification method for identifying crassostrea hongkongensis, crassostrea sikamea and first filial generation thereof | |
| CN115948577A (en) | Breeding method of high-temperature-resistant sea cucumbers | |
| CN102094069A (en) | Discriminating method of inherited characteristics of Kyrgyzstan cichlidae and application thereof | |
| CN113604587B (en) | Molecular marker T5198 for rapidly identifying low-temperature tolerant variety of penaeus japonicus and application thereof | |
| CN101906479B (en) | Method for detecting body size of cattle by using ZBTB38 gene | |
| CN103710427A (en) | Single nucleotide polymorphism, detection method and application of chicken gene | |
| CN109825599B (en) | Method for identifying individual genetic background of hybrid of mytilus coruscus and Mediterranean mussel | |
| CN108893555B (en) | A method of based on InDel molecular markers for identification hot pepper male sterile three series mating cenospecies authenticity and purity | |
| CN102776284B (en) | The diagnostic primers of Dai-ju stock Pseudosciaena crocea and Fujian-East Guangdong race large yellow croaker and discrimination method thereof | |
| CN102758021B (en) | Recombination activating gene (RAG) 2 molecular marker restriction fragment length polymorphism (RFLP) identifying method for aquaculture of catfish hybrids | |
| CN106282379B (en) | Hybridize the CH of Pelteobagrus fulvidraco4Digestion identification method | |
| CN105294845A (en) | Barley leaf rust resistant protein as well as coding gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20131009 Termination date: 20200521 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |