CN102628048A - Preparation and application of conotoxin Lt7b of Conus littertus Linnaeus of South China sea - Google Patents

Abstract

The present invention relates to a preparation method and application of conotoxin gene Lt7.2 of Conus littertus Linnaeus of South China sea and polypeptide Lt7b encoded thereby. Through construction of a cDNA library, a conotoxin gene Lt7.2 is cloned by the invention from poison canal tissue of the Conus littertus Linnaeus of South China sea. The invention provides a preparation method of polypeptide. The conotoxin gene Lt7.2 and a vector pTRX are connected to get the recombinant expression vector pTRX-Lt7.2; the recombinant expression vector pTRX-Lt7.2 is transformed into host bacteria and expresses in the host bacteria stably and efficiently; and expression product recombinant fusion protein is separated and purified to obtain an objective protein polypeptide Lt7b. The polypeptide Lt7b provided by the invention has effects of neurotransmitter blocking transport and central analgesia and can be used for preparing tool medicine for the neurobiological research and analgesic drugs.

Description

Preparation and the application of South China Sea signal conotoxin Lt7b

Technical field

The present invention relates to a peptide species and coding gene sequence thereof, its preparation method and application.Belong to biological field.

Background technology

Cone shell (Cone snails); Be commonly called as and be " cone shell ", it is under the jurisdiction of Mollusca (Mollusca), Gastropoda (Gastropoda), Probranchia (Prosobranchia), Caenogastropoda (Neogastropoda), Conidae (Conidae), Conus (Conus) on taxonomy.Cone shell species existing on the earth have kind more than 700 approximately, mainly are distributed in the warm torrid zone or marine site, subtropics, and are wherein maximum with India-Pacific region and Eastern Pacific-western Atlantic zone.Cone shell generally lives in the seabed of rock, karang, sand and argillo arenaceous.The minority species can be perched the ballow at tens meters rice surplus 200.Daytime or ebb back are perched under marine alga or in the coral hole, go out night to look for food, and spring and summer are its main nursery stage.China has found to have approximately more than 80 kind of cone shell now, mainly is distributed in the Nansha Islands, the Xisha Islands, Hainan Island and surrounding waters, Taiwan, and minority is distributed in Guangdong, ALONG GUANGXI COAST.

Cone shell can be divided into three major types by its feeding habits: ichthyophagy cone shell (piscivorous), food spiral shell cone shell (molluscivorous) and carnivorism cone shell (vermivorous).Wherein entomophagy cone shell most species accounts for about 70% of whole cone shell kinds, though and ichthyophagy property cone shell to account for the cone shell sum less, toxicity is the strongest, the cone shell of the report incident that causes death is that such cone shell is caused basically up to now.

The venom of cone shell is the primary armament of its predation, defence and competition.Venom is produced by the epithelial cell secretion of cone shell poison pipe, and is stored in the terminal poison bubble of poison pipe.The main active ingredient of venom is the mixing toxin polypeptide of the cocktail appearance of complicacy, i.e. conotoxin (conotoxin).Approximately contain 100-1000 kind composition in the venom of every kind of cone shell individuality, the overwhelming majority wherein all is a conotoxin.

Research in recent decades shows, conotoxin mainly acts on the acceptor of various ionic channels and neurotransmitter/kassinin kinin on the cytolemma, and has very strong BA.Conotoxin has following characteristics: molecular mass is little, is rich in disulfide linkage; Leading peptide high conservative and mature peptide has variety; Action target spot is wide and have a height tissue selectivity.Conotoxin often is used as classification and the evaluation that probe is used for the type and the hypotype of various ionic channels and acceptor, and also the utmost point is expected to directly to be developed to medicine or is used for the research and development of new drug as lead compound.

At present, the conotoxin of clear and definite function has only accounted for the very little part in whole toxin storehouse both at home and abroad, and still the physiological function to them has had understanding comparatively clearly.Conotoxin disulfide linkage skeleton and structure different have determined the difference of they functional target sites, and clearly target position mainly comprises the ionic channel of part gate, valtage-gated ionic channel and the acceptor of G albumen coupling.

Nineteen seventies, the laboratory early start of the professor B.M.Olivera of Univ Utah USA to the comprehensive systematic study work of conotoxin.Conotoxin can be divided into different superfamilies and framework types according to its constructional feature (the disulfide linkage skeleton of the signal peptide district of N end high conservative and C end in the precursor peptide).So far having obtained isolating conotoxin has thousands of kinds, and tens of kinds of conotoxins have been applied for USP.They are with a wide range of applications in analgesia, ischemic protection, epilepsy therapy, some medical diagnosis on disease and acceptor research, the clinical study of entering that has or by the FDA official approval for the treatment new drug, as specific diagnostic reagent and anodyne.Conotoxin ω-MVIIA (SNXIII, the trade(brand)name: Ziconotide) of developing at present, by Elan company; Because of it directly acts on the N-type calcium channel that is distributed in nervous tissue; Need not second messenger or albumen, habituation has not become the medicine of new generation of treating intractable neuralgia; Passed through the III clinical trial phase, formally by FDA approval listing.And another compd A M336 effect that is derived from omega-conotoxin CVID is similar to Ziconotide; Because of its selectivity to the N-calcium channel stronger; Spinoff is lower, has ratified to get into clinical experimental stage as the medicine of the serious anti-morphineation chronic pain of antagonism.In addition, Conantokin-G is as the antagonist of nmda receptor high selectivity, and is effective to the epilepsy that is difficult to treat, and also accomplished the I clinical trial phase.

On the other hand; Conotoxin is as the fabulous probe or the instrument of research ionic channel and membrane receptor; Become the tool master of valtage-gated type calcium channel (VSCCs) and N type acetylcholine receptor passages such as (nAChRs), acceptor evaluation and diagnosis, obtained in the neuropharmacology field using widely.

Summary of the invention

The purpose of this invention is to provide a kind of South China Sea signal conotoxin gene Lt7.2, its gene order is shown in sequence in the sequence table 1.

Second purpose of the present invention provides above-mentioned signal conotoxin gene Lt7.2 encoded polypeptides Lt7b, and its aminoacid sequence is shown in sequence in the sequence table 2.

The 3rd purpose of the present invention provides a kind of recombinant expression vector pTRX-Lt7.2.

The 4th purpose of the present invention provides a kind of polypeptide expression method, from the several aspects of expression, separation and purifying original expression of polypeptides method improved.

The 5th purpose of the present invention is to provide the application of above-mentioned conotoxin polypeptide Lt7b in neurobiology research and analgesic exploitation.

The conus that the present invention uses picks up from Sanya, Chinese Hainan Province.

The present invention separates obtaining South China Sea signal conotoxin gene Lt7.2 through the method for construction cDNA library and order-checking from South China Sea conus poison pipe.

The present invention provides a kind of recombinant expression vector pTRX-Lt7.2, and is synthetic in the following manner:

At first, the cDNA sequence of signal conotoxin gene Lt7.2 is divided into two pairs of complementary sequences as the template fundamental chain, holds the restriction enzyme site that adds restriction enzyme Kpn I and Not I respectively with 3 ' at 5 ' end of this fundamental chain gene; In addition; The recognition site that has added the EK enzyme at 5 ' end; And also having added two terminator codons (TAA) at 3 ' end, above-mentioned these two pairs of primers are divided into two groups of complementary pairing and carry out phosphorylation and annealing respectively behind pcr amplification, synthesize the signal conotoxin gene Lt7.2 of linear total length.

Secondly, through restriction enzyme Kpn I and Not I double digestion method plasmid pTRX-Neu5 is carried out enzyme and cut, obtain linearizing carrier pTRX after the excision Neu-5 fragment.

At last, utilize the T4DNA ligase enzyme that the signal conotoxin gene Lt7.2 of above-mentioned linearity is connected with above-mentioned linearizing carrier pTRX, obtain recombinant expression vector pTRX-Lt7.2.

The present invention also provides a kind of polypeptide expression method, and the practical implementation step is:

(1) with recombinant expression plasmid pTRX-Lt7.2 transformed into escherichia coli BL21 (DE3);

(2) e. coli bl21 after the culture transformation (DE3);

(3) e. coli bl21 (DE3) after cultivating is carried out ultrasonic degradation, high speed centrifugation is collected ultrasonic supernatant; Supernatant obtains recombination fusion protein through nickel post affinitive layer purification;

(4) recombination fusion protein warp Enterokinase, EK enzyme enzyme is cut, and the product after enzyme is cut obtains target protein through sieve chromatography filtration and HPLC purifying---conotoxin polypeptide Lt7b.

The expression method of aforementioned polypeptides uses recombinant expression vector pTRX-Lt7.2 as expression plasmid, and expression efficiency is higher, and has optimized microbial culture condition and peptide purification separate mode, has effectively improved the expression amount of conotoxin polypeptide Lt7b.

The present invention finds through frog sciatic nerve-specimen-gastrocnemius muscle Muscle contraction experiment and the experiment of mouse hot plate method; Certain density conotoxin polypeptide Lt7b has transmission of block nerves mediator and analgesic property, so the present invention also provides a kind of conotoxin polypeptide Lt7b application in neurobiology research and analgesic exploitation.

Description of drawings

Fig. 1 recombinant expression vector pTRX-Lt7.2 building-up process synoptic diagram

The sequencing result figure of Fig. 2 recombinant expression vector pTRX-Lt7.2

Fig. 3 recombination fusion protein nickel column separating purification affinity chromatography figure

The SDS-PAGE electrophoretogram of the abduction delivering of Fig. 4 recombination fusion protein and purifying

Conotoxin polypeptide Lt7b RPLC figure after Fig. 5 enzyme is cut

The MALDI-TOF mass spectrum of Fig. 6 conotoxin polypeptide Lt7b

Fig. 7 conotoxin polypeptide Lt7b frog sciatic nerve-specimen-gastrocnemius muscle Muscle contraction suppresses interpretation figure

Fig. 8 conotoxin polypeptide Lt7b is to the analgesic experiment result of mouse Superlysoform method

Embodiment

Below in conjunction with specific embodiment, further specify technical scheme of the present invention.Should be understood that following examples only to be used to the present invention is described and do not limit the present invention in any form.

Embodiment 1: the extraction of the total RNA of conus poison tubing and toxin cDNA clone

The extraction of total RNA is carried out with reference to

LS reagent specification sheets of Gibcol BRL company.LATaq archaeal dna polymerase, 10 * PCR Buffer, DNA ladder buy from TaKaRa company; DNTP mix, pGEM-T Easy Vector Systems is available from Promega company; The PCR primer is synthetic by Invitrogen company; Other organic reagents are homemade analytical pure, available from Guangzhou Chemical Reagent Factory.

Get breechblock alive; With the broken spiral shell shell of iron hammer; Expose spiral shell meat; Careful on ice also sharp separation poison tubing is put into liquid nitrogen rapidly and is fully ground

LS reagent of 15 times of bulking values of adding (being to add 15ml in the 1g tissue) after weighing; Fully homogenate in the ice bath is preserved in-80 ℃ of refrigerators in order to extracting total RNA.Get the 50-100mg tissue sample; With 1ml

LS reagent homogenate, 15-30 ℃ leaves standstill 5min.Add the 0.3mL chloroform then, behind the thermal agitation 3min, 15-30 ℃ leaves standstill 10min.4 ℃, 12, the centrifugal 10min of 000rpm gets the upper strata water.Add the 0.5ml Virahol, leave standstill 10min on ice after, 4 ℃, 12, the centrifugal 10min of 000rpm abandons supernatant.Add 1ml 75% ethanol rinsing deposition again, 4 ℃, 7, the centrifugal 5min of 500rpm abandons supernatant, and the ethanol of trace in the sample is removed in vacuum-drying, adds the deionized water of an amount of no RNase.Get 1 μ l and carry out 1% agarose gel electrophoresis, 1 μ l is with concentration and the purity of ultraviolet spectrometry light estimation RNA, and-80 ℃ of preservations are subsequent use.

1) cDNA first chain is synthetic

The synthetic SMART that uses Clontech company of cDNA first chain ^TMPCR cDNA Synthesis Kit makes an experiment to specifications.In 5 μ l reaction systems, add following component (in operation on ice): the total RNA of 1 μ g spiral shell poison pipe, each 1 μ l of SMART III olignucleotide and CDS III/3 ' PCR primer, with ultrapure water polishing volume, mixing, of short duration centrifugal.72 ℃ of incubation 2min, ice bath 2min, of short duration centrifugal, make mixture combine in the pipe end.Flick tube wall after adding dNTP Mix and the 1 μ l PowerScript RT (CLONTECH) of DTT, 1 μ l 10mmol/L of 2 μ l, 5 * First Strand Buffer, 1 μ l 20mmol/L more successively, mixing is also of short duration centrifugal.Put synthetic first chain of 42 ℃ of reactions of PCR appearance 1hr rt, ice bath termination reaction ,-40 ℃ of preservations.

2) cDNA of O2-superfamily conotoxin clone

The PCR primer sequence is as shown in table 1:

Table 1

The PCR system			The PCR program
					Component	Volume (μ l)		94 ℃ of preparatory sex change	3min
CDNA first chain	1		32 circulations
					Upstream primer (10 μ M)	1		94℃	30sec
Downstream primer (10 μ M)	1		55℃	45sec
					DNTP mixture (2.5mM)	8		72℃	45sec
The LATaq polymerase	0.5		72 ℃ of extensions	10min
					10 * PCR reaction buffer	5
The de-ionized tri-distilled water	33.5
					TV	50

Upstream primer 5 ' GACCCTGCCGTCATCTCAGC 3 '

Downstream primer 5 ' GCCTTGAAGACTCTGAAGAGGA 3 '

Get 5ul PCR product and detect amplification, then remaining PCR product is carried out the segmental recovery of purpose if any specific band with 1.8% agarose gel electrophoresis.

3) purifying of PCR product

Above-mentioned PCR reaction product is carried out purifying with 1.5% gel, voltage 120V electrophoresis 30 minutes.Cutting-out contains the sepharose piece of target nucleic acid band (about 300-500bp), presses the GEL EXTRACTION KIT specification sheets operation of OMEGA BIOTEK company.The sepharose piece is weighed, press 1g/ml and convert, add the long-pending Binding Buffer damping fluid of 4-5 times of colloid, melt and dissolved in 55-60 ℃ of dissolving 7min up to fully, coagulant liquid is joined HiBind ^TMOn the DNA post (DNA that can combine 25 μ g), can add 700 μ l samples (can repeat to add) at every turn, 10, the centrifugal 1min of 000g; The Binding Buffer that adds 300 μ l is in HiBind ^TMIn the DNA post, 10, the centrifugal 1min of 000g abandons filtrating; Wash post once with 750 μ l through the DNA of alcohol dilution wash buffer, 10, the centrifugal 1min of 000g abandons liquid, repeats to wash post once with DNA wash buffer again; HiBind with sky ^TMThe DNA post is 10, and the centrifugal 1min of 000g abandons trace solution; Wash post with 20 μ l sterilization deionized water or TE damping fluid, 10, the centrifugal 1min of 000rpm collects DNA, and dna solution is-20 ℃ of preservations.Identify and reclaim production concentration.

4) the PCR product cloning is to the T-carrier

By DNA Ligation Kit explanation the purpose band is connected into pGEM-T Vector.

Linked system is as shown in table 2 below:

Table 2

Component	Volume (μ l)
		The purpose segment	4
pGEM-T?Vector	0.5
		2×Rapid?Ligation?Buffer	5
T4DNA?Ligase	0.5
		TV	10

4 ℃, connection is spent the night.

5) connecting product transforms

To connect product transformed into escherichia coli DH5 α bacterial strain.

At first be equipped with the bacillus coli DH 5 alpha competent cell with the CaCl2 legal system.Picking bacillus coli DH 5 alpha list colony inoculation is not in containing antibiotic LB liquid nutrient medium; 37 ℃ of shaking culture 16-18 hour activation bacterial strains; Being inoculated in 50ml with 1: 50 volume does not then contain in the LB liquid nutrient medium of acillin; 37 ℃, 250rpm vibration amplification culture are about 2-3 hour, at OD ₆₀₀During=0.3 left and right sides, with bacterium liquid ice bath 40 minutes, centrifugal 10 minutes of 4 ℃ of 4000rpm were inverted and remove most supernatant, add the 100mM CaCl of the precooling that is equivalent to stock culture 1/2 volume ₂Resuspended deposition, ice bath 10 minutes, 4 ℃, 4, centrifugal 10 minutes of 000rpm abandons supernatant, again with the 100mM CaCl of the precooling that is equivalent to stock culture volume 1/25 ₂Resuspended deposition.Every pipe adds 20% glycerine, is packed as 200 μ l, and it is available after 2 hours to put-80 ℃ of refrigerators.

Get the competent cell of 100 μ l, add to connect product, mixed evenly after; Ice bath 30 minutes, 42 ℃ of thermal shocks 90 seconds, ice bath 2 minutes; The LB liquid nutrient medium that adds 700 μ l Amp-, 37 ℃ of gentle jolting recovery cells 40 minutes, the centrifugal 4min of 4000rpm; Abandon substratum, the resuspended thalline of 200 μ l LB substratum is all coated Amp ⁺The LB flat board on, 37 ℃ of inversion incubators were cultivated 16 hours, observed the colony growth situation.

6) bacterium colony PCR identifies positive colony

Get 20 sterilization 1.5ml tubules, add 20 μ l LB substratum, 20 positive colony branches of picking are clipped in each tubule in super clean bench.

PCT system system and PCR program are as shown in table 3:

Table 3

7) enlarged culturing of positive bacterium colony and plasmid extract

Get bacterium colony PCR male bacterium liquid and be added to containing in the Amp LB substratum of 5ml, 37 ℃ of shaking table overnight cultures are extracted plasmid with OMEGA mini plasmid extraction kit.Get 5ml bacterium liquid, 10, the centrifugal 1min of 000g; Abandon supernatant, add 250 μ l solution I/Rnase, re-suspended cell; Add 250 μ l solution II, softly put upside down mixing 4-6 time, lysing cell; Add 350 μ l solution III, mixing is up to white precipitate occurring; 10, behind the centrifugal 10min of 000g, supernatant is transferred on the HiBindTM DNA post that places on the 2ml centrifuge tube sleeve pipe; 10, the centrifugal 1min of 000g abandons liquid; Wash post with 500 μ l HB buffer, 10, the centrifugal 1min of 000g abandons liquid; Wash post once with 750 μ l through the DNA of alcohol dilution wash buffer, 10, the centrifugal 1min of 000g abandons liquid, repeats to wash post once; Empty HiBind ^TMDNA post 10, the centrifugal 1min of 000g abandons trace liquid; 30 μ l sterilization de-ionized washing post twice, 10, the centrifugal 1min of 000g, dissolving plasmid.

8) contain the pulsating T vector plasmid order-checking of insertion

Adopt ABI PRISM 3730 automatic DNA sequencer DNAs of Perkin Elmer company to carry out examining order, sequencing reaction is pressed ABI PRISM BigDye ^TMThe specification sheets of Terminator Cycle Sequencing Ready Reaction Kits is operated, and uses T7 and SP6primer to carry out two-way sequencing.

Embodiment 2: the structure of South China Sea signal toxin polypeptide Lt7b fusion expression vector

1) plasmid and bacterial strain:

Intestinal bacteria (Escherichia coli) DH5 α is available from Invitrogen company; Preserved by this laboratory, its genotype is: DH5 α: supE44 Δ lac U169

hsdR17 recA1 endAl gyrA96 thi-1 rel A1; Escherichia coli expression host bacterium BL21 (DE3) is available from Stratagene company, and genotype is: BL21 (DE3): F-ompT hsdSB (r-B, m-B) dcm gal λ (DE3).

2) reagent and other materials:

Restriction enzyme Kpn I and Not I, D12000DNAMarker are available from TaKaRa company, and the T4DNA ligase enzyme is available from Promega company; Taq archaeal dna polymerase, 10 * PCR Buffer and dNTP are available from ancient cooking vessel state company; Gel Extraction Kit and Plasmid Miniprep Kit are OMEGA BIOTEK Company products; BCA ^TMProtein Assay Kit is the PIERCE Company products; Lower molecular weight standard protein 14.4～108kD is biological available from triumphant base; The EK enzyme available from big marine biotechnology national project research centre, the South Sea; Chromatographic grade TFA (trifluoroacetic acid) is available from Sigma company; The acillin sodium salt is available from North China Pharmaceutical Factory; Tryptone and Yeast Extract are available from Oxoid company; T7promoter sequencing primer (T7), the oligonucleotide primer of Lt7.2 gene is synthetic by Invitrogen company; Other reagent is homemade AR.

3) experimental technique:

(1) South China Sea signal conotoxin gene Lt7.2's is synthetic

Primer is synthetic: signal conotoxin gene Lt7.2 is divided into (a) and (b), (c), (d) four sections complementary fragments, holds the restriction enzyme site that has added restriction enzyme Kpn I and Not I respectively at 5 of this gene ' end and 3 '.In addition, added the recognition site of Ek enzyme at 5 ' end, and also added two terminator codons (TAA) at 3 ' end, to prevent ribosomal jump, primer sequence is as follows:

(a)5’C?GATGATGATGAT?AAA?TGC?ACC?GAT?TGG?CTG?GGC?TCG?TGC?TCT?TCGCCG?3’

(b)3’CATGG?CTA?CTA?CTA?CTA?TTT?ACG?TGG?CTA?ACC?GAC?CCG?AGC?ACG?AGAAGC?GGC?AGC?CTT?5’

(c)5’TCG?GAA?TGC?TGC?TAT?GAT?AAC?TGC?GAA?ACC?TAT?TGC?ACC?CTG?TGGAAA?TAA?TAA?GC?3’

(d)3’ACG?ACG?ATA?CTA?TTG?ACG?CTT?TGG?ATA?ACG?TGG?GAC?ACC?TTT?ATTATT?CGCCGG?5’

It is the solution of 10 μ mol/L that above-mentioned (a) and (b), (c), (d) primer Oligo segment are used the atom level water dissolution.Primer is divided into two groups of complementary pairing carries out phosphorylation and annealing respectively.

Phosphorylation system (10 μ L) as shown in table 4:

Table 4

10μM?Oligo	1.0μL
		10 * T4 Starch phosphorylase damping fluid	1.0μL
10mM?ATP	1.0μL
		T4 polynucleotide kinase (10U/ μ L)	0.5μL
ddH 2O	6.5μL

With 37 ℃ of each phosphorylation systems, water-bath 1 hour.

Complementary pairing: the complementary Oligo that phosphorylation is good adds together, 94 ℃ of reaction 3min, 45 ℃ of reaction 5min.The signal conotoxin gene Lt7.2 that obtains matching.

(2) structure of recombinant vectors pTRX-Lt7.2

Fusion expression vector pTRX, its maternal carrier are the PET22b of Novagen company, and this carrier contains the generic features of prokaryotic expression carrier, are secreted expression carriers.Fusion expression vector pTRX is with escherichia coli thioredoxin (thioredoxin; Trx) signal peptide on the displacement PET22b; And behind the TRX gene, add the joining region; Comprising sequence, proteolytic enzyme cutting site and the MCS (MCS) of flexible zone, coding 6His, is a carrier simple and easy to use and efficiently express.

It is streak culture on the flat board of ammonia benzyl resistance that the guarantor who gets the pTRX plasmid plants bacterium liquid, to obtain activatory list bacterium colony.Choose single colony inoculation and add in the liquid-rich substratum, after 37 ℃ of shaking culture are spent the night, collect thalline, extract plasmid in 5ml LB.Utilize Kpn I and Not I double digestion method that the pTRX plasmid is carried out the linearizing preparation, purpose is in order to excise the gene fragment between Kpn I and the Not I restriction enzyme site, to obtain linearizing carrier pTRX.Carry out glue after the carrier pTRX linearizing and reclaim and purification process, utilize the T4DNA ligase enzyme that above-mentioned carrier pTRX is connected with the good signal conotoxin gene Lt7.2 of above-mentioned pairing, change in the bacillus coli DH 5 alpha after the connection and increase.Sequencing result is correct, explains that recombinant vectors pTRX-Lt7.2 makes up successfully.

I. the pTRX DNA that extracts is through restriction enzyme Kpn I and Not I double digestion.

Endonuclease reaction system (30 μ L) as shown in table 5:

Table 5

DNA	3.0μg
		10x?K?Buffer	3.0μL
Kpn?I	2.0μL
		Not?I	2.0μL
0.1％BSA	3.0μL
		ddH 2O	Complement to 30.0 μ L

Place 37 ℃ of enzymes to cut 6hr in sample; Then enzyme is cut product and carry out 1% agarose gel electrophoresis; Cutting-out contains the sepharose piece of carrier pTRX; Adopt the Gel Extraction Kit (Cat.No.D2500-02) of OMEGA BIOTEK company and carry out the glue reclaimer operation, obtain linearizing carrier pTRX according to its specification sheets.

Ii. ligation

Utilize the T4DNA ligase enzyme that above-mentioned carrier pTRX is connected with the good signal conotoxin gene Lt7.2 of above-mentioned pairing.

Ligation system (10 μ L) as shown in table 6:

Table 6

The signal conotoxin gene Lt7.2 that pairing is good	2.0μL
		2×T4DNA?ligase?Buffer	5.0μL
Carrier pTRX	2.0μL
		T4DNA ligase enzyme (10U/ μ L)	1.0μL

With the sample mixing, 16 ℃ of connections are spent the night.To connect product adding bacillus coli DH 5 alpha competent cell and transform, order-checking, the result is correct, explains and clones successfully, obtains recombinant vectors pTRX-Lt7.2.

Embodiment 3: the efficient prokaryotic expression of South China Sea signal conotoxin polypeptide gene

1) Expression of Fusion Protein

The correct recombinant vectors pTRX-Lt7.2 of order-checking is converted into e. coli bl21 (DE3) is built into engineering strain.Picking engineering strain list colony inoculation is in Amp ⁺In the LB liquid enriched medium, 37 ℃ of shaking culture are spent the night as planting daughter bacteria.Get kind of daughter bacteria and be inoculated in fresh Amp by 1: 50 volume ratio ⁺In the LB rich medium, 37 ℃ of thermal agitation amplification culture are about 0.6 to OD600, add IPTG to final concentration be 0.1mmol/L, add 20% glucose solution to final concentration 0.2% simultaneously, in 18 ℃ of abduction deliverings 10 hours.Induce and finish back 4 ℃, 10, the centrifugal 10min of 000rpm receives bacterium, and is resuspended with 1: 10 ratio with the ultrasonic Buffer of precooling (the 20mmol/L imidazoles, pH 7.0 for 50mmol/L Tris, 500mmol/L NaCl).With 300W power, the broken bacterium of ultrasonic 1h under the ice bath.Back 4 ℃ of ultrasonic end, 12, the centrifugal 10min of 000rpm, twice, collect the ultrasonic supernatant that contains recombination fusion protein.

2) preparation of signal conotoxin Lt7b

(1) affinity chromatography of recombination fusion protein

Adopt the Chelating Sepharose of GE company ^TMFast Flow filler is with Ni ²⁺Be part, the treatment process before and after the perfusion of chromatography column and the use is seen specification sheets.

Before the use, the NiSO of 0.2M in the elder generation ₄Combine with the post material, with the most unconjugated Ni of washing, with the ultrasonic Buffer balance chromatography column of 5 times of column volumes, the entire operation process is kept the constant flow rate of 4.0ml/min then.Then, wash post to ultraviolet absorption value with ultrasonic Buffer and reach baseline, leave and take percolation peak sample in the process the centrifugal supernatant upper prop after ultrasonic.Use imidazole concentration to carry out the foreign protein wash-out then, use the Elution Buffer wash-out target protein of imidazole concentration at last as 200mmol/L as the Wash Buffer of 50mmol/L.Through above-mentioned affinity chromatography step to above-mentioned fusion rotein purifying.

(2) enzyme of recombination fusion protein is cut

Adopt the Sephadex G25 post of Pharmacia company to change sds sample buffer.The perfusion and the treatment process of chromatography column see specification sheets for details.The entire operation process is kept the constant flow rate of 4.0ml/min.Earlier cut Buffer balance chromatography column, then with Ni with the Ek enzyme enzyme of 1 times of volume ²⁺Fusion rotein upper prop behind the column purification continues to use EK enzyme enzyme to cut Buffer (pH 8.0 for 50mmol/L Tris, 100mmol/L NaCl) then and carries out wash-out and collect the target protein peak.Sample is after Sephadex G25 gel permeation chromatography is enzyme cutting buffering liquid with buffer exchange, and the EK enzyme of adding 1% at room temperature enzyme is cut 18h.

(3) enzyme is cut product purification

Sephadex G50 Fine molecular sieve chromatography specification is that (5.0cm * 100cm), use AKTA explorer system to carry out medium pressure chromatography, constant flow rate is 2ml/min to Pharmacia XK50.Use 50mM NH ₄HCO ₃1 column volume of balance Sephadex G50 chromatography column is gone up appearance 60ml enzyme at most and is cut the product sample.Set automatic collection procedure, collect uv-absorbing target protein peak, obtain signal conotoxin Lt7b.

(4) HPLC detects and purifying

Signal conotoxin Lt7b after the freeze-drying directly goes up the C18 reversed-phase column with small amount of deionized water dissolving back and detects also purifying.Linear gradient elution, program is as shown in Figure 2, and 215nm and 280nm place dual wavelength detect, and collect a small amount of elution peak sample and carry out the mass spectrometric detection (see figure 6).All the other samples carry out vacuum lyophilization once more and are stored in-20 ℃.

Embodiment 4: the physiologically active of signal conotoxin Lt7b is identified

Test the physiologically active of identification signal conotoxin Lt7b through frog sciatic nerve-specimen-gastrocnemius muscle Muscle contraction in the present embodiment.

Experimental procedure: twoly prepare sciatic nerve-specimen-gastrocnemius muscle after ruining the marrow frog, with aseptic absorbent cotton administration, medicine Lt7b working concentration to be measured is 10 μ M.Stimulation parameter is: time-delay 100ms, and the wide 0.5ms of ripple, frequency 0.5Hz, intensity 5v, sweep velocity is 4.00s/div.Making electricity consumption Physiological Experiment system is that safe alliance science and technology BL-410 biological function experimental system and Chengdu Instruement Factory make JZJ01 type muscle tone transverter, and range is 30g, is numbered 4037.

Interpretation of result: as shown in Figure 7, effectively block nerves--the mediator transmission and the inhibition Muscle contraction of flesh joint, significant block nerves mediator transmitted, and can be used for preparing the tool drugs of neurobiology research when the Lt7b final concentration reached 10 μ M.

Embodiment 5: the analgesia effect experiment on the physiological models

General planning: mouse Superlysoform is licked sufficient method

Experimental procedure: occur the pain reaction after the injection of formalin of mouse vola: the leg that contracts, lick and sting the injection pawl.The Superlysoform pain reaction is biphasic or bipolar type; Phase (first o'clock phase) when promptly occurring the acute pain about about 5min after the injection at once; Quiescent stage about middle about 10min; Phase (second o'clock phase) when occurring the Secondary cases pain of sustainable 40min～60min subsequently, the quiescent stage injection can normally be walked completely, does not have obvious pain reaction.Therefore 0min～5min is decided to be first phase, 15min～60min is decided to be second phase.Write down respectively after the injection of formalin the first, the second phase mouse contract leg, lick the time of stinging.Choosing KM is 40 of mouse, body weight 20 ± 2g, male and female half and half; Be divided into four groups at random, saline water group, Lt7b (20nm) group; Lt7b (10nm) group and lignocaine group, each organizes the Superlysoform of subcutaneous injection 5% at the bottom of every mouse intrathecal injection 5ul medicine 10min metapedes.Observe in the 1h mouse contract leg, lick the time of stinging (s).

Interpretation of result: can find out that from the result of Fig. 8 four groups receive the reagent thing in I reaction, to lick foot time big-difference too not, the leg that contracts in the II phase reaction of drug group mouse after administration is licked the foot time all has reduction in various degree.Wherein Lt7b (20nm) group mouse is compared with Lt7b (10nm) group at 15-60min, and analgesic effect is more remarkable.This shows that Lt7b has certain analgesic activity to the II phase pain that Superlysoform causes, and analgesic effect strengthens with the increase of administration concentration.

Claims (5)

1. South China Sea signal conotoxin gene, it is characterized in that: gene order is shown in sequence in the sequence table 1.

2. polypeptide by the described conotoxin genes encoding of claim 1, it is characterized in that: aminoacid sequence is shown in sequence in the sequence table 2.

3. a recombinant expression vector is characterized in that: connected to form by carrier pTRX and the described conotoxin gene of claim 1.

4. polypeptide expression method, it is characterized in that: implementation step is:

(1) recombinant expression vector described in the claim 3 is transformed the host bacterium;

(2) the host bacterium after the culture transformation;

(3) the host bacterium after cultivating is carried out ultrasonic degradation, collect supernatant; Supernatant obtains recombination fusion protein through affinitive layer purification;

(4) recombination fusion protein is cut through the enteropeptidase enzyme, and the product that enzyme is cut obtains target protein, the conotoxin polypeptide through sieve chromatography filtration and HPLC purifying.

5. the application of the described polypeptide of claim 2 in neurobiology research and analgesic exploitation.

Images