CN102618515A

CN102618515A - Protein FKCadAl related with resistance to heavy-metal cadmium, and coding gene and application thereof

Info

Publication number: CN102618515A
Application number: CN2012100796750A
Authority: CN
Inventors: 谢丽娟; 陈亮; 许光远; 俞陆军; 胡敏; 廖斌; 束文圣
Original assignee: Sun Yat Sen University
Current assignee: Sun Yat Sen University
Priority date: 2012-03-22
Filing date: 2012-03-22
Publication date: 2012-08-01
Anticipated expiration: 2032-03-22
Also published as: CN102618515B

Abstract

The invention discloses a gene with resistance to heavy-metal cadmium contained in unknown microorganisms living acid mining drainage (AMD), i.e., P-type ATP (Adenosine-Triphosphate) enzyme, and an amino acid sequence of a protein molecule coded by the gene. The transformation experiment of escherichia coli proves that the expression of the gene in the escherichia coli can improve the resistance to the heavy-metal cadmium. The gene disclosed by the invention can be used for improving the resistance of the microorganisms and plants to the heavy-metal cadmium and further eliminating heavy-metal pollution to the environment, and provides a biological resource with excellent performance for bioremediation.

Description

A kind of heavy metal cadmium resistance-associated protein FKCadA1 and encoding sox and application

Technical field

The invention belongs to microbiological genetic engineering and biological prosthetic field.Specifically; The invention provides and live in acidic mine waste water (acid mining drainage; AMD) a kind of gene to the heavy metal cadmium resistance that a kind of unknown Institute of Micro-biology is contained is the sequence of P type ATP enzyme (FKCadA1), and this sequence is inferred the aminoacid sequence of encode protein molecule.The present invention has great application value in raising mikrobe and plant aspect the resistance of heavy metal cadmium.

Background technology

Along with development and use, the industrial development of Mineral resources, the heavy metal pollution on the environment is on the rise, and heavy metal pollution of soil has become the problem of a harm global environment quality.Heavy metal-polluted soil can influence growth and development of plant, reduces output and the quality of farm crop, has brought serious economy loss.In addition, in plant materials, accumulated by the crop of heavy metal pollution of soil, and pass through the food chain enrichment in human body and animal body, harm human and livestock health, cause cancer and other diseases etc.Improvement heavy metal contamination is very urgent, during various recovery techniques and measure are being studied and used.National governments and scientist put forth effort to address this problem through two approach: one is to utilize physics, the heavy metal contamination that the method for chemistry attempts to remove soil or water body: two for utilizing modern biotechnology to remove pollution.Since the eighties in 20th century, processing costs is low, little to environmental influence, the efficient advantages of higher because of it has for bioremediation technology, more and more receives numerous scientific and technical personnel's extensive concern.Biological prosthetic generally is divided into phytoremediation, animal is repaired and mikrobe is repaired three types, and wherein the reparation of phytoremediation and mikrobe is the focus of research.It is exactly to utilize mikrobe with the contaminant degradation in the environment or be converted into the process of other innoxious substances that mikrobe is repaired.In recent years, based on the mechanism of action of mikrobe to heavy metal, the economic worth heavy metal is arranged is that the biologic treating technique of purpose reaches its maturity to repair poisonous and harmful metallic pollution or recovery.Phytoremediation refers to utilize plant to go to administer the technology of the pollution in the media such as water body, soil and bed mud.Yet the biology that is used for the heavy metal contamination reparation tends to receive the murder by poisoning of heavy metal, and poor growth, living weight are little, even can not survive, so the toxic action of heavy metal on plants and mikrobe is the key constraints of biological prosthetic.

Heavy metal is to study the The Molecular Biology Mechanism of tolerance heavy metal in the solution biological prosthetic to the fundamental way of the toxic action of biology; The clone obtains to be used for the transgenic engineering biology of biological prosthetic excellent property to the key gene of heavy metal tolerance through genetic engineering means.

Owing to technical reason, up to date, but the utilization of microbial gene resource mainly is confined to culturing micro-organisms.Yet, culturing micro-organisms only account for the occurring in nature mikrobe less than 1%, therefore the grand genome of mikrobe in the various habitats is a huge and genetic resources storehouse that do not excavate.Extreme environment has abundant Microbial resources, in the middle of many genes relevant with crucial vital process with adverse circumstance in secular adaptive evolution, obtained stronger patience potential, excavating these resistant genes has become international important research focus.Acidic mine waste water (AMD) is the important system of extreme habitat microbiological research.AMD derives from mining activity and makes and contain sulfur mineral and (be mainly pyrite; FeS2) be exposed in the sky G&W; Rapid oxidation is produced due to the acid under the microorganism catalysis effect; Its pH value and is rich in vitriol and heavy metals such as Pb, Zn, Cu, Cd and Ni generally about 1-4, is one of serious environmental problems of facing of mining industry.The prokaryotic micro-organisms of in AMD, surviving has formed some unique mechanism gradually in the evolution of long period of time process, compel to tackle multiple extreme environment such as low pH value, high salinity and high heavy metal association.Therefore, the AMD habitat becomes the adversity gene storehouse that has characteristic and enrich.

Because some metals have toxicity when high density, so mikrobe constitutes the resistance to heavy metal through reducing transportation, the resistance effect of oozing or discharge effect.Though mikrobe can be resisted heavy metal ion excessive in the environment through modes such as accumulation, redox; But they are only as the effective detoxifcation mode of cellular exposure in low concentration heavy metal environment; In the environment of high density heavy metal contamination, any biology of growth all must be through being used for detoxifying as independent the effluxing of alternate manner of perhaps uniting fast.Therefore, the method for full blast is directly heavy metal ion to be transported out the extracellular.

Exist many in the mikrobe and metals ion transportation proteins associated family, they are positioned on the cytolemma mostly, play a part ionic pump.P type ATP enzyme is exactly one of them.In P type ATP enzyme, the transmembrane channel of transportation and combination and the hydrolysis site of ATP all are to be made up of a polypeptied chain, and it can only transport monovalence and the divalence inorganic cation that comprises proton.In P type ATP enzyme family, the most attractive characteristics are exactly the conservative region that height is arranged at its N end, are estimated as the binding site of metal, under the situation of hydrolysising ATP energy supply, change passage structure picture and form ionic channel, and metals ion is seen off outside the born of the same parents.Four kinds of different P type ATP enzymes are arranged on the escherichia coli chromosome, and wherein a kind of is MgtA, is used for absorbing Mg ²⁺, other three kinds transportation K ⁺, Cu ²⁺With output Zn ²⁺Two kinds of P type ATP enzymes are arranged among the P.Putida KT2440, and CadA2 is used for transporting Cd ²⁺And Pb ²⁺, and the effect of CadA1 is not clear at present.The function of CadA2 is also studied to such an extent that be perfectly clear in P.Putida 06909, and it is responsible for Cd ²⁺+ and Zn ²⁺Transportation.In P.Putida CD2, two kinds of P type ATP enzymes are also arranged, CadA2 provides Cd ²⁺, Zn ²⁺And Pb ²⁺Resistance, and wherein the effect of CadA1 is also unclear at present.

In addition, in mikrobe, what effect to be the heavy metal cadmium resistance played actually still unclear for the CadA1 gene up to now, also from the AMD mikrobe, is not cloned into the report of CadA1 gene.

Summary of the invention

The object of the present invention is to provide the P type ATP enzyme in the AMD mikrobe, and this proteic new gene of coding, basic substance established for developing gene engineering product from now on.

In one aspect of the invention, P type ATP enzyme (heavy metal cadmium resistance-associated protein FKCadA1) in a kind of acidic mine waste water mikrobe is provided, it is a following protein molecular (i) or (ii):

(i) has described aminoacid sequence like SEQ ID NO:1;

(ii) replace in the aminoacid sequence process that limits like SEQ ID NO:1, lack or superpose one or several amino acid derived protein and protein (i) have identical functions.

In another aspect of the present invention, a kind of dna molecular is provided, it comprises: the nucleotide sequence (like SEQ ID NO:2) of the described P type ATP enzyme of encoding.

Invention finds that FKCadA1 albumen has the effect of cadmium metal resistance, can in administering Environmental Cadmium Pollution, use.

This proteic encoding sox has been protected in invention simultaneously, has the sequence shown in SEQ ID NO:2; And the application of this gene in administering Environmental Cadmium Pollution.

Invention, is found to coerce down at cadmium as subjects with the genetic engineering bacterium of expressing FKCadA1, and its cadmium tolerance is much higher than the non-genomic engineering bacteria.At concentration of cadmium ions is 200 μ M when following, when especially 150 μ M are following, still has higher survival rate.

Compared with prior art, the present invention has following beneficial effect:

The present invention has cloned a new P type ATP enzyme gene from the AMD mikrobe, called after FKCadA1, and its resistance to heavy metal cadmium carried out functional analysis.Can improve in the intestinal bacteria resistance through this gene of intestinal bacteria transformation experiment proof to cadmium.

Said gene sequence or aminoacid sequence carry out transgenic exploitation gene engineering product mask has great application value; Can be used for cultivating the heavy metal super-enriched plant or the mikrobe of high-biomass specifically, be used for the restoration of the ecosystem of heavy-metal contaminated soil and water body.

Description of drawings

Phase when accompanying drawing 1 is the expression of FKCadA1 in intestinal bacteria; Wherein:

M: molecular weight of albumen standard;

1: BL21 (DE3) bacterial strain that carries empty carrier pET28a;

2-9: BL21 (DE3) bacterial strain inducing that carries pET28a-FKCadA1 was expressed 0,1,2,3,4,5,6,7 hour respectively.

Intestinal bacteria the growing state different cadmium concentrations under cultivate 12 hour after of accompanying drawing 2 for expressing FKCadA1.

Accompanying drawing 3 is for expressing the growth curve of intestinal bacteria under 150 μ M cadmiums are coerced of FKCadA1.

Embodiment

The clone of embodiment 1FKCadA1 gene complete sequence

Open-air microbiological specimens collection:

Lead/zinc ore is chosen the AMD of different souring stages (is standard with pH) in the Yunfu, uses the filter membrane of 0.22 μ m to collect the cell of 20LAMD the inside.In order to keep the complete preservation of nucleic acid, preserve sample and freeze in liquid nitrogen, take back the laboratory in 24 hours, and be put in-70 ℃ of refrigerator prolonged preservation.

The extraction of nucleic acid:

DNA extraction adopts the SET method, and process is following: in SET buffer, add N,O-Diacetylmuramidase and Proteinase K, behind the digestion 30min; 15, behind the centrifugal 15min of 000rpm with chloroform extracting 2 times, after spending the night with isopropanol precipitating; 75% ethanol cleans 2 times, is dissolved in the aqua sterilisa at last.Reclaim genomic dna with Qiagen tip-100 column purification, detect DNA quality and concentration with the nucleic acid-protein analyser.

Gene order-checking:

With press proof article in the GS FLX Titanium General Library Preparation Kit preparation of Roche company.Use Roche 454Genome Seqencer FLX sequenator,, obtain base sequence with Pyrobayer software through checking order.

Genome sequence is analyzed:

After removing low-quality sequencing result, genome is analyzed as follows:

Sequence assembly: use the GS De Novo Assembler Software of Euler-SR and 454 Corp. to carry out sequence assembly.Effect with the splicing of N50 index assessment;

Genome annotation: the whole genome sequence that will splice good mikrobe carries out genomic note with IMG and SEED system, finds new gene.

The clone of FKCadA1 gene fragment:

Pass through PCR method: with the cloned plasmids that contains goal gene is template; Design a pair of primer (introducing different restriction enzyme sites respectively) by gene order at the upstream and downstream primer; PCR obtains the band of a 2000bp size; And be cloned in PCR2.1 (available from the invitrogen company) carrier, sequence entrusts invitrogen company to measure.

The FKCadA1 gene sequencing:

Sequencing result shows that CadA1 gene size is 2049bp (seeing SEQ ID NO:2), 682 amino acid (seeing SEQ ID NO:1) of encoding.

The functional analysis of embodiment 2FKCadA1 gene

Utilize the intestinal bacteria transformation experiment to analyze the function of FKCadA1 gene in the present embodiment.

Make up recombinant expression vector:

A pair of primer below the design is introduced the BamHI restriction enzyme site at the FKCadA1 gene 5 ', and 3 ' introduces the XhoI restriction enzyme site.

FKCadA1-F(SEQ ID NO：3)：

5’CGCGGATCCATGCCAACCGATCCAGTTTGT3’

FKCadA1-R(SEQ ID NO：4)：

5’CCGCTCGAGCATTAATGTATACTGCTGAACTTTGTTC3’

With the PCR2.1-FKCadA1 carrier is that template is carried out PCR.Respectively PCR product and yeast shuttle expression carrier pET28a are carried out enzyme with BamHI and XhoI and cut, enzyme is cut product reclaim, connect and transformed into escherichia coli DH5 α.Cut evaluation through order-checking and enzyme, obtained the pET28a-FKCadA1 recon.

Protein expression:

With recon pET28a-FKCadA1 transformed into escherichia coli expression strain BL21 (DE3), through PCR checking screening positive clone.The thalline list spot that picking contains recombinant plasmid 37 ℃ of incubated overnight to the 10ml LB (containing Kan50 μ g/ml).1ml bacterium liquid joined contain 100ml LB substratum (containing Kan50 μ g/ml), 37 ℃ of concussions are cultured to OD600 and are about 0.4-1.0 (best 0.6, approximately need 2hr).

Adding IPTG was that 1mM induces to final concentration, whenever collected 1ml bacterium liquid at a distance from 1 hour, and centrifugal 12000g * 60s gathers in the crops deposition, and is resuspended with 80 μ l ddH2O, adds 20 μ l, 5 * SDS-PAGE sample-loading buffer, mixing, boiling water bath 10min.Get supernatant and do SDS-PAGE analysis (seeing accompanying drawing 1) as sample.

Transformant is to the mensuration of heavy metal cadmium resistance:

The thalline list spot that picking contains recombinant plasmid 37 ℃ of incubated overnight to the 10ml LB (containing Kan 50 μ g/ml).The 100ul bacterium is joined 10ml Cd ²⁺Concentration is respectively in the LB substratum (containing Kan 50 μ g/ml, IPTG1mM) of 0 μ M, 50 μ M, 100 μ M, 150 μ M, 200 μ M, and 37 ℃, 200rpm concussion were cultivated 12 hours, measured the OD600 value respectively.

According to experimental result, choose Cd ²⁺Concentration be 150 μ M as stress conditions, carried out the mensuration of growth curve.The thalline list spot that picking contains recombinant plasmid 37 ℃ of incubated overnight to the 10ml LB (containing Kan 50 μ g/ml).The 100ul bacterium is joined 10ml Cd ²⁺Concentration is in the LB substratum (containing Kan 50 μ g/ml, IPTG1mM) of 150 μ M, and 37 ℃, 200rpm shake cultivation, and is every at a distance from 2 hours mensuration OD600 values.

Experimental result shows that the BL21 (DE3) that expresses the FKCadA1 gene is at 0-200 μ M Cd ²⁺Can normal growth under the concentration, and empty carrier is to impinging upon Cd ²⁺When surpassing 150 μ M, concentration just can not grow (seeing accompanying drawing 2).At 150 μ MCd ²⁺Under the concentration, the BL21 (DE3) that expresses the FKCadA1 gene can grow in culturing process, and the growth of empty carrier contrast is suppressed (seeing accompanying drawing 3) always.The experimental result explanation, FKCadA1 plays an important role to the defence of heavy metal cadmium.

SEQ ID NO：1

MPTDPVCGMFVPQNTNIVLIKDGDTYYFCSTACKIKFQQPIEARKKDRLALIVAWSFAIPVLIITYFISFGMKDYVMLVLSLPVQFYSGLKFYKGAYQAIKMRSGNMDLLIALGTSVAFFFSVAIIVFPSFIPTNTTYFDTSAFIIALILTGSYIQDITESKANDAANELIKRLPSRVNLMDVNGTTITVSLDKLKKDNIILVKPGENVPVDGTVIDGETEVDESMISGEPEPVVKIKGSSVISGTTNLNGVIKVRVDSVGKDSTINKISELIEHAAAGRVKSQKLADIFSAYFVPVVIGVSIVTAFFWYGFLSYAGSSAVYEITVLSFVSVIIIACPCAIGLAAPITLLVASNASLKNHLLLKNISSLEKLAKINLAVFDKTGTLTDSRPDIDKIVVKDGRYNDISVLEYAASLEQYSNHPIASAIVKYAKSKHITFKDISRVEEKPGEGIYGRFNDKNLVIKRGDSLNSVSLYVNNVLIGDILLSYHIKKDAVVVIKKLHSIGIKTAIITGDRLAEANRVGSMLNIDYIHAEITPEKKSEIIKKYQKQGYYVMYAGDGINDAIALETADVGVAMGTGSDIAKESGDVIILKDDLLLVYYLKKVGDYTLSKIKQNILWAIGYNAILIPVAAGVLVPIFGLGVYSLLPIFAALAMGMSSVSVVLNSLLLKPKLNKVQQYTLM

SEQ ID NO：2

ATGCCAACCGATCCAGTTTGTGGAATGTTCGTTCCTCAAAATACTAATATTGTATTGATAAAAGATGGTGATACATATTATTTTTGTTCTACCGCATGTAAGATAAAGTTTCAGCAGCCTATAGAAGCAAGGAAAAAAGATAGATTAGCGCTCATAGTAGCCTGGAGCTTTGCTATTCCCGTGCTAATTATAACTTATTTTATTTCCTTTGGTATGAAGGATTATGTGATGCTTGTACTGTCATTACCTGTGCAGTTCTATTCTGGGCTTAAATTCTATAAAGGTGCTTATCAGGCCATAAAAATGCGTTCCGGAAACATGGACCTGCTTATAGCTTTAGGTACCTCAGTGGCGTTCTTCTTTTCCGTAGCCATCATAGTATTCCCTTCGTTTATACCGACTAATACTACTTATTTTGACACTTCTGCCTTCATAATAGCTCTTATTTTAACAGGCAGTTATATACAGGACATAACGGAGTCGAAGGCTAATGATGCTGCGAATGAATTGATCAAACGTCTACCTTCACGCGTTAATCTTATGGATGTAAACGGTACCACAATAACAGTAAGTCTAGACAAGTTAAAAAAAGATAATATAATTTTAGTGAAGCCTGGAGAAAATGTGCCCGTCGATGGAACAGTTATTGATGGCGAAACTGAAGTGGACGAATCTATGATAAGTGGAGAGCCTGAGCCTGTTGTAAAGATAAAAGGAAGTAGTGTAATATCCGGAACCACTAATTTAAATGGTGTAATAAAGGTAAGAGTTGACAGCGTAGGCAAGGACTCGACAATAAATAAAATATCCGAACTTATAGAACATGCGGCTGCAGGAAGGGTTAAATCGCAGAAGCTGGCGGACATATTCTCTGCTTATTTCGTGCCGGTAGTAATAGGGGTATCGATTGTGACGGCTTTTTTTTGGTATGGTTTTCTTTCCTATGCTGGCAGCAGCGCAGTGTATGAAATTACAGTATTGTCATTCGTTTCTGTTATAATAATAGCATGTCCATGCGCAATTGGCTTGGCGGCACCGATAACACTTTTAGTGGCTTCTAATGCTTCCTTAAAAAATCACTTGCTATTGAAGAATATATCGAGCCTTGAAAAACTCGCCAAAATAAATTTGGCCGTTTTTGATAAGACAGGCACATTGACCGACTCAAGGCCTGATATAGACAAAATAGTCGTTAAAGACGGCAGATATAATGATATATCTGTATTAGAGTATGCTGCGTCCTTGGAGCAATACTCTAATCATCCGATTGCAAGCGCTATAGTTAAATATGCTAAAAGTAAACACATAACTTTTAAAGACATCTCACGGGTGGAAGAAAAGCCAGGAGAAGGAATTTATGGAAGATTTAATGACAAGAATCTCGTAATAAAGCGCGGAGACAGCCTAAACAGCGTGAGCTTGTATGTAAATAATGTCTTAATTGGAGATATTCTCCTGTCTTATCATATAAAAAAGGATGCTGTTGTTGTAATAAAGAAACTGCATTCTATAGGTATTAAGACGGCCATTATAACTGGGGACAGGCTGGCAGAAGCAAATCGAGTAGGGTCAATGCTTAATATAGATTATATCCATGCGGAGATTACTCCAGAAAAGAAGTCTGAAATAATAAAAAAGTATCAAAAGCAAGGATACTATGTTATGTATGCTGGTGATGGTATAAACGATGCAATAGCCCTAGAGACAGCGGATGTAGGCGTAGCTATGGGAACTGGAAGTGATATAGCCAAAGAAAGTGGCGATGTTATAATTCTTAAAGACGATTTGCTACTGGTATATTACTTGAAGAAAGTTGGAGATTACACACTGTCAAAAATAAAGCAGAATATTTTATGGGCAATAGGTTACAATGCCATACTTATACCTGTAGCAGCAGGCGTACTTGTTCCTATATTTGGTCTAGGGGTGTACTCTTTGTTACCGATATTTGCTGCATTAGCAATGGGTATGAGTTCTGTAAGTGTAGTATTAAACTCTTTACTTTTAAAACCTAAATTGAACAAAGTTCAGCAGTATACATTAATGTAG。

SEQUENCE LISTING

< 110>Zhongshan University

< 120>a kind of heavy metal cadmium resistance-associated protein FKCadA1 and encoding sox and application

<130>

<160> 4

<170> PatentIn version 3.2

<210> 1

<211> 682

<212> PRT

< 213>artificial sequence

<400> 1

Met Pro Thr Asp Pro Val Cys Gly Met Phe Val Pro Gln Asn Thr Asn

1 5 10 15

Ile Val Leu Ile Lys Asp Gly Asp Thr Tyr Tyr Phe Cys Ser Thr Ala

20 25 30

Cys Lys Ile Lys Phe Gln Gln Pro Ile Glu Ala Arg Lys Lys Asp Arg

35 40 45

Leu Ala Leu Ile Val Ala Trp Ser Phe Ala Ile Pro Val Leu Ile Ile

50 55 60

Thr Tyr Phe Ile Ser Phe Gly Met Lys Asp Tyr Val Met Leu Val Leu

65 70 75 80

Ser Leu Pro Val Gln Phe Tyr Ser Gly Leu Lys Phe Tyr Lys Gly Ala

85 90 95

Tyr Gln Ala Ile Lys Met Arg Ser Gly Asn Met Asp Leu Leu Ile Ala

100 105 110

Leu Gly Thr Ser Val Ala Phe Phe Phe Ser Val Ala Ile Ile Val Phe

115 120 125

Pro Ser Phe Ile Pro Thr Asn Thr Thr Tyr Phe Asp Thr Ser Ala Phe

130 135 140

Ile Ile Ala Leu Ile Leu Thr Gly Ser Tyr Ile Gln Asp Ile Thr Glu

145 150 155 160

Ser Lys Ala Asn Asp Ala Ala Asn Glu Leu Ile Lys Arg Leu Pro Ser

165 170 175

Arg Val Asn Leu Met Asp Val Asn Gly Thr Thr Ile Thr Val Ser Leu

180 185 190

Asp Lys Leu Lys Lys Asp Asn Ile Ile Leu Val Lys Pro Gly Glu Asn

195 200 205

Val Pro Val Asp Gly Thr Val Ile Asp Gly Glu Thr Glu Val Asp Glu

210 215 220

Ser Met Ile Ser Gly Glu Pro Glu Pro Val Val Lys Ile Lys Gly Ser

225 230 235 240

Ser Val Ile Ser Gly Thr Thr Asn Leu Asn Gly Val Ile Lys Val Arg

245 250 255

Val Asp Ser Val Gly Lys Asp Ser Thr Ile Asn Lys Ile Ser Glu Leu

260 265 270

Ile Glu His Ala Ala Ala Gly Arg Val Lys Ser Gln Lys Leu Ala Asp

275 280 285

Ile Phe Ser Ala Tyr Phe Val Pro Val Val Ile Gly Val Ser Ile Val

290 295 300

Thr Ala Phe Phe Trp Tyr Gly Phe Leu Ser Tyr Ala Gly Ser Ser Ala

305 310 315 320

Val Tyr Glu Ile Thr Val Leu Ser Phe Val Ser Val Ile Ile Ile Ala

325 330 335

Cys Pro Cys Ala Ile Gly Leu Ala Ala Pro Ile Thr Leu Leu Val Ala

340 345 350

Ser Asn Ala Ser Leu Lys Asn His Leu Leu Leu Lys Asn Ile Ser Ser

355 360 365

Leu Glu Lys Leu Ala Lys Ile Asn Leu Ala Val Phe Asp Lys Thr Gly

370 375 380

Thr Leu Thr Asp Ser Arg Pro Asp Ile Asp Lys Ile Val Val Lys Asp

385 390 395 400

Gly Arg Tyr Asn Asp Ile Ser Val Leu Glu Tyr Ala Ala Ser Leu Glu

405 410 415

Gln Tyr Ser Asn His Pro Ile Ala Ser Ala Ile Val Lys Tyr Ala Lys

420 425 430

Ser Lys His Ile Thr Phe Lys Asp Ile Ser Arg Val Glu Glu Lys Pro

435 440 445

Gly Glu Gly Ile Tyr Gly Arg Phe Asn Asp Lys Asn Leu Val Ile Lys

450 455 460

Arg Gly Asp Ser Leu Asn Ser Val Ser Leu Tyr Val Asn Asn Val Leu

465 470 475 480

Ile Gly Asp Ile Leu Leu Ser Tyr His Ile Lys Lys Asp Ala Val Val

485 490 495

Val Ile Lys Lys Leu His Ser Ile Gly Ile Lys Thr Ala Ile Ile Thr

500 505 510

Gly Asp Arg Leu Ala Glu Ala Asn Arg Val Gly Ser Met Leu Asn Ile

515 520 525

Asp Tyr Ile His Ala Glu Ile Thr Pro Glu Lys Lys Ser Glu Ile Ile

530 535 540

Lys Lys Tyr Gln Lys Gln Gly Tyr Tyr Val Met Tyr Ala Gly Asp Gly

545 550 555 560

Ile Asn Asp Ala Ile Ala Leu Glu Thr Ala Asp Val Gly Val Ala Met

565 570 575

Gly Thr Gly Ser Asp Ile Ala Lys Glu Ser Gly Asp Val Ile Ile Leu

580 585 590

Lys Asp Asp Leu Leu Leu Val Tyr Tyr Leu Lys Lys Val Gly Asp Tyr

595 600 605

Thr Leu Ser Lys Ile Lys Gln Asn Ile Leu Trp Ala Ile Gly Tyr Asn

610 615 620

Ala Ile Leu Ile Pro Val Ala Ala Gly Val Leu Val Pro Ile Phe Gly

625 630 635 640

Leu Gly Val Tyr Ser Leu Leu Pro Ile Phe Ala Ala Leu Ala Met Gly

645 650 655

Met Ser Ser Val Ser Val Val Leu Asn Ser Leu Leu Leu Lys Pro Lys

660 665 670

Leu Asn Lys Val Gln Gln Tyr Thr Leu Met

675 680

<210> 2

<211> 2049

<212> DNA

< 213>artificial sequence

<400> 2

atgccaaccg atccagtttg tggaatgttc gttcctcaaa atactaatat tgtattgata 60

aaagatggtg atacatatta tttttgttct accgcatgta agataaagtt tcagcagcct 120

atagaagcaa ggaaaaaaga tagattagcg ctcatagtag cctggagctt tgctattccc 180

gtgctaatta taacttattt tatttccttt ggtatgaagg attatgtgat gcttgtactg 240

tcattacctg tgcagttcta ttctgggctt aaattctata aaggtgctta tcaggccata 300

aaaatgcgtt ccggaaacat ggacctgctt atagctttag gtacctcagt ggcgttcttc 360

ttttccgtag ccatcatagt attcccttcg tttataccga ctaatactac ttattttgac 420

acttctgcct tcataatagc tcttatttta acaggcagtt atatacagga cataacggag 480

tcgaaggcta atgatgctgc gaatgaattg atcaaacgtc taccttcacg cgttaatctt 540

atggatgtaa acggtaccac aataacagta agtctagaca agttaaaaaa agataatata 600

attttagtga agcctggaga aaatgtgccc gtcgatggaa cagttattga tggcgaaact 660

gaagtggacg aatctatgat aagtggagag cctgagcctg ttgtaaagat aaaaggaagt 720

agtgtaatat ccggaaccac taatttaaat ggtgtaataa aggtaagagt tgacagcgta 780

ggcaaggact cgacaataaa taaaatatcc gaacttatag aacatgcggc tgcaggaagg 840

gttaaatcgc agaagctggc ggacatattc tctgcttatt tcgtgccggt agtaataggg 900

gtatcgattg tgacggcttt tttttggtat ggttttcttt cctatgctgg cagcagcgca 960

gtgtatgaaa ttacagtatt gtcattcgtt tctgttataa taatagcatg tccatgcgca 1020

attggcttgg cggcaccgat aacactttta gtggcttcta atgcttcctt aaaaaatcac 1080

ttgctattga agaatatatc gagccttgaa aaactcgcca aaataaattt ggccgttttt 1140

gataagacag gcacattgac cgactcaagg cctgatatag acaaaatagt cgttaaagac 1200

ggcagatata atgatatatc tgtattagag tatgctgcgt ccttggagca atactctaat 1260

catccgattg caagcgctat agttaaatat gctaaaagta aacacataac ttttaaagac 1320

atctcacggg tggaagaaaa gccaggagaa ggaatttatg gaagatttaa tgacaagaat 1380

ctcgtaataa agcgcggaga cagcctaaac agcgtgagct tgtatgtaaa taatgtctta 1440

attggagata ttctcctgtc ttatcatata aaaaaggatg ctgttgttgt aataaagaaa 1500

ctgcattcta taggtattaa gacggccatt ataactgggg acaggctggc agaagcaaat 1560

cgagtagggt caatgcttaa tatagattat atccatgcgg agattactcc agaaaagaag 1620

tctgaaataa taaaaaagta tcaaaagcaa ggatactatg ttatgtatgc tggtgatggt 1680

ataaacgatg caatagccct agagacagcg gatgtaggcg tagctatggg aactggaagt 1740

gatatagcca aagaaagtgg cgatgttata attcttaaag acgatttgct actggtatat 1800

tacttgaaga aagttggaga ttacacactg tcaaaaataa agcagaatat tttatgggca 1860

ataggttaca atgccatact tatacctgta gcagcaggcg tacttgttcc tatatttggt 1920

ctaggggtgt actctttgtt accgatattt gctgcattag caatgggtat gagttctgta 1980

agtgtagtat taaactcttt acttttaaaa cctaaattga acaaagttca gcagtataca 2040

ttaatgtag 2049

<210> 3

<211> 30

<212> DNA

< 213>artificial sequence

<400> 3

cgcggatcca tgccaaccga tccagtttgt 30

<210> 4

<211> 37

<212> DNA

< 213>artificial sequence

<400> 4

ccgctcgagc attaatgtat actgctgaac tttgttc 37

Claims

1. a new heavy metal cadmium resistance-associated protein is characterized in that aminoacid sequence is shown in SEQ ID NO:1.

2. the application of the said cadmium metal resistance-associated protein of claim 1 in administering Environmental Cadmium Pollution.

3. the encoding sox of the said cadmium metal resistance-associated protein of claim 1 is characterized in that having the nucleotide sequence like SEQ ID NO:2.

4. the application of the encoding sox of the said cadmium metal resistance-associated protein of claim 3 in administering Environmental Cadmium Pollution.

5. the expression vector that contains the encoding sox of the said cadmium metal resistance-associated protein of claim 3.

6. according to the said carrier of claim 5, the carrier that it is characterized in that setting out is pET28a.

7. a genetic engineering bacterium is characterized in that being obtained by the described expression vector transfection Escherichia coli of claim 6.

8. the application of the said genetic engineering bacterium of claim 7 in administering Environmental Cadmium Pollution.

9. application according to claim 8 is characterized in that the concentration of cadmium ions in the Environmental Cadmium Pollution is below the 50 μ M.

10. claim 1 or 3 described albumen or nucleotides sequence are listed in the application on the development of metallic cadmium resistant transgenic engineering product.