CN102617710B - New immune epitope for specific antibody of human new gene FAMLF, and preparation and application of antibody - Google Patents

New immune epitope for specific antibody of human new gene FAMLF, and preparation and application of antibody Download PDF

Info

Publication number
CN102617710B
CN102617710B CN201210056172.1A CN201210056172A CN102617710B CN 102617710 B CN102617710 B CN 102617710B CN 201210056172 A CN201210056172 A CN 201210056172A CN 102617710 B CN102617710 B CN 102617710B
Authority
CN
China
Prior art keywords
antibody
famlf
gene
polypeptide
present
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201210056172.1A
Other languages
Chinese (zh)
Other versions
CN102617710A (en
Inventor
王少元
黄源茂
李景岗
许能文
叶美玲
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Union Medical College Hospital of Fujian Medical University
Original Assignee
Union Medical College Hospital of Fujian Medical University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Union Medical College Hospital of Fujian Medical University filed Critical Union Medical College Hospital of Fujian Medical University
Priority to CN201210056172.1A priority Critical patent/CN102617710B/en
Publication of CN102617710A publication Critical patent/CN102617710A/en
Application granted granted Critical
Publication of CN102617710B publication Critical patent/CN102617710B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Abstract

The invention discloses a new immune epitope for a specific antibody of a human new gene FAMLF, and preparation and application of an antibody. The human new gene FAMLF is a polynucleotide sequence of cDNA of a new gene related to familial acute myeloid leukemia and a complete open reading frame; and the comprised amino acid residue sequences corresponding to two immune epitopes are as follows respectively: one immune epitope sequence code is SEQ ID NO: 1, and the other immune epitope sequence code is SEQ ID NO: 2. The immune epitope and the specific antibody thereof provided by the invention lay the foundation for research and development of future leukemia specific gene diagnostic antibodies, protein chips, gene chips and gene medicines. For developing anti-leukemic new drugs, improving the diagnosis accuracy and the treatment effect of leukemia, and improving the cure rate of leukemia in Fujian Province, the immune epitope and the specific antibody thereof have an important role and potentially significant social and economic benefits. The immune epitope and the specific antibody thereof provided by the invention lay the foundation for genetic diagnosis and gene therapy of leukemia and other malignancies.

Description

The newly-increased immune epitope of human gene FAMLF specific antibody and antibody preparation and application
Patent application of the present invention be for the applying date be dividing an application that 2010.02.05, application number are 201010107579.3, denomination of invention is " human gene FAMLF is in development and the application of people's gene restructuring, malignant tumour gene test, monoclonal antibody specific " patent application.
Technical field
The present invention relates to a kind of field of medicaments, relate in particular to human gene (FAMLF) full length DNA sequence, construct this full length gene cDNA T clone, design for the PCR primer of the sequence specific amplification region of this gene and develop the specific monoclonal antibody for the expressed albumen of this gene, under segmentation, field is as follows:
(1) molecular biology category.
(2) antibody preparation research field.
(3) clinical blood disease research field.
Background technology
Along with completing of the Human Genome Project, human genome is learned research and has been realized from Structural genomics genomic comprehensive transformation backward, and in human genome, the sequence (except minority interval) of the chromosomal overwhelming majority is clear and definite in 24.Estimate a nearly 20000-25000 gene in human genome.Complete genome sequence determination and become the historic beginning of cracking human inheritance's secret, ensuing task is more arduous, is mainly to complete following target at present: the one, identification, separated, identify and clone all genes (only cloning now more than 10,000); The 2nd, get function and the interaction between gene and the mutual relationship of each gene clear.Have scientist to estimate, to 21 century later, clinical application wonderful stage is likely moved towards in gene therapy, for human health is made significant contribution.And malignant tumour is because its high incidence and mortality ratio become first-selected sick kind of gene therapy, the clone of tumor-related gene provides target spot by the gene therapy for malignant tumour, is one of important foundation of gene therapy.
Leukemia is one of modal malignant tumour of blood system, estimate the leukemic sickness rate of China annual 2.71/10 ten thousand, die from every year nearly 40,000 people of leukaemic, within 5 years, disease free survival rate only reaches 20% left and right, and intractable Relapsed AML incidence is on the rise.Leukemic biological behaviour is complicated and changeable, and the molecular biology mechanism of pathogenesis and generation, development is not yet illustrated.Clinically leukemic prevention, treatment, prognosis judgement are still lacked to effective means, the curative ratio of Patients Following Bone Marrowtransplantation is 40% left and right only, and mortality ratio is still high at present.
Genetics research in recent years shows that leukemia is polygene related neoplasms, and the major progress to leukemia fundamental research in the world, is from the research to leukemia genes involved greatly.Some results of study show, development occurs for the oncogenes such as bcr/abl, c-myc, bcl-1, tal-1, RARa, CAN, MLL, NUP98 and leukemia has closely related.Leukemic study hotspot is concentrated on to the cloning and identification to leukemia genes involved abroad, mainly by building general genomic library or the cDNA library row filter of going forward side by side, but its specificity is not high, and screening positive rate is lower.Fujian Province's leukemia sickness rate is higher than the whole nation, leukaemic's large contingent, and leukemia gene aboundresources, especially leukemia high density family is common, and its lymphoblastic leukaemia genetic gene has unique researching value.Familial leukemia is a kind of malignant tumour of blood system, is again a kind of and disease inherited genetic factors height correlation, and its gene have unique researching value.Our 1,981 one, mountain area, Nian Qidui Fujian Province leukemia high density families (accompanying drawing one is shown in by family collection of illustrative plates), carried out genetics, the aspect researchs such as cytogenetics, the member of seminar was carrying out on the basis of correlative study this acute leukemia high density family genetic mechanism in the past at present, application suppresses subtractive hybridization (SSH) equimolecular biology techniques, using IV-18 Bone Marrow of Patients as Tester, Normal Human Bone Marrow is as Driver, successfully built Familial Acute Myelogenous Leukemia cDNA Suppression Subtractive Hybridization Library, application Differential Screening technology screening is identified library, confirm 28 positive difference expression genes of gene, positive colony is delivered order-checking, sequencing result submits to GenBank to carry out sequence analysis analysis, the EST segment and 11 relevant new EST fragments of unknown leukemia of the relevant known of leukemia of 17 variant expression have been found, 11 new EST fragments are all successfully registered at the gene pool GENBANK of America NI H.By single stage method sxemiquantitative RT-PCR examination, find wherein 4 new EST fragments high expression level in marrow series leukemia people, and low expression in normal people.Choose zywB-87 (the GenBank number of registration: CV973101) in 4, by electronic cloning and SMART-RACE technology, successfully cloned the corresponding new gene cDNA total length of zywB-87 of variant expression, this assignment of genes gene mapping is in karyomit(e) 1q31.3, cDNA total length 2313bp, 82 the amino acid whose protein of encoding, contain signal peptide, be rich in leucine repeating unit (LRR_SD22), the functional zone such as inherent intrinsic disordered structure territory.The new gene that Blast retrieval FAMLF is Unknown Function, is included by GenBank, and is named as FAMLF, and nucleic acid number of registration is eF413001, protein number of registration is aBN58747.The expression of new gene FAMLF in acute myeloid leukemia patient is apparently higher than the expression in normal people, difference has statistical significance (P < 0.01), by bioinformatic analysis, predict that new gene FAMLF is probably positioned cytolemma, participate in the phosphorylation of some albumen in cell means of information transmission; The high expression level of FAMLF, may cause the continuous activation of cell proliferation signal, or the inhibition of apoptosis signal, thereby causes the generation of malignant tumour.And the method for having cloned by T-A successfully constructs the T that comprises FAMLF full length gene cDNA and clones, successfully developed for FAMLF protein-specific monoclonicity antibody, the correlation function of FAMLF gene through Western Bloting, verifies protein high expression level low expression in normal people in Patients with Acute Myeloid Leukemia of this new genetic expression, in further studies confirm that.
This achievement in research, makes full use of, brings into play the unique advantage of this family genetics resource, and the clinical potential application prospect of combining closely, inquires into research targetedly to the clone of leukemia genes involved.For Future Development leukemia specific gene medicine, gene diagnosis chip, diagnosis antibody lay the foundation.This project research, for developing leukemia new drug, improves leukemia diagnosis accuracy rate and result for the treatment of, and improving the leukemic curative ratio in Fujian Province has important effect, has potential great social and economic effects.
Summary of the invention:
The object of the invention is to propose a kind of newly-increased immune epitope and antibody preparation and application of human gene FAMLF specific antibody.
The technical solution adopted in the present invention is: 1, the specific antibody of human gene FAMLF is developed immune peptide epi-position used: SEQ ID NO:1 CGMNFDRSRITNK-NH2; 2, for the specific antibody of above-mentioned immune peptide epi-position.3, the specific antibody of human gene FAMLF is developed immune peptide epi-position used: SEQ ID NO:2CRINRISELVESIETVYT-NH2; 4, for the specific antibody of above-mentioned immune peptide epi-position.
Content of the present invention includes but not limited to: the full length cDNA sequence of Familial Acute Myelogenous Leukemia relative new gene (FAMLF), the complete opening code-reading frame sequence of FAMLF gene, also comprise clone's FAMLF gene primer used, the recombinant vectors that comprises FAMLF gene, analyze the sequence (detection gene) of the needed FAMLF gene efficient of FAMLF gene differential expression specific amplified, its sequence specific amplification region (sequence characterized amplified region, SCAR) PCR primer, preparation FAMLF gene monoclonal antibody immune peptide epitope sequences SEQ ID NO:1 and sequence SEQID NO:2 used, for the monoclonal antibody specific of the expressed protein of FAMLF gene and they are in fundamental research, gene diagnosis, the related application in the fields such as gene quality.They are achieved in that
1, application suppresses subtractive hybridization (SSH) equimolecular biology techniques, using the marrow of the leukemia high density family patient IV-18 of Fujian Province as Tester, Normal Human Bone Marrow is as Driver, successfully built Familial Acute Myelogenous Leukemia cDNA Suppression Subtractive Hybridization Library, application Differential Screening technology screening is identified library, confirm 28 positive difference expression genes of gene, positive colony is delivered order-checking, sequencing result submits to GenBank to carry out sequence analysis analysis, the EST segment and 11 relevant new EST fragments of unknown leukemia of the relevant known of leukemia of 17 variant expression have been found, 11 new EST fragments are all successfully registered at the gene pool GENBANK of America NI H.
2, by single stage method sxemiquantitative RT-PCR examination, find wherein 4 new EST fragments high expression level in marrow series leukemia people, and low expression in normal people.Choose zywB-87 (the GenBank number of registration: CV973101) by electronic cloning and SMART-RACE technology in 4, successfully cloned zywB-87 (the GenBank number of registration: CV973101) corresponding new gene cDNA total length of variant expression, this assignment of genes gene mapping is in karyomit(e) 1q31.3, cDNA total length 2313bp, 82 the amino acid whose protein of encoding, contain signal peptide, be rich in leucine repeating unit (LRR_SD22), the functional zone such as inherent intrinsic disordered structure territory.The new gene that Blast retrieval FAMLF is Unknown Function, is included by GenBank, and is named as FAMLF, and nucleic acid number of registration is eF413001, protein number of registration is aBN58747.
3, by bioinformatic analysis, predict that new gene FAMLF is probably positioned cytolemma, participate in the phosphorylation of some albumen in cell means of information transmission; The high expression level of FAMLF, may cause the continuous activation of cell proliferation signal, or the inhibition of apoptosis signal, thereby causes the generation of malignant tumour.The expression of new gene FAMLF in acute myeloid leukemia patient is apparently higher than the expression in normal people, and difference has statistical significance (P < 0.01).
4, in the mononuclearcell of the patient IV-18 bone marrow fluid from Fujian Province's leukemia high density family, extract mRNA, according to the FAMLF gene order of above-mentioned discovery, design, synthetic primer, through RT-PCR amplification, T-A clone, construct the T clone of the FAMLF full length cDNA sequence of codified 82 amino-acid residues.
5, according to the opening code-reading frame sequence of the FAMLF gene of above-mentioned discovery, see, the immune epitope polypeptide of the protein of design, synthetic this gene is expressed, immunity New Zealand white rabbit, prepare the specific monoclonal antibody for this albumen, and apply the activity that Western Bloting verifies this antibody.
6, FAMLF gene is at the expression analysis of mRNA level: according to the cDNA sequence of the FAMLF gene of above-mentioned discovery, the primer of design, synthetic this gene, analyzes the differential expression between acute myeloid leukemia and normal people of this gene by single stage method RT-PCR.
7, FAMLF gene is at the expression analysis of protein level: the FAMLF monoclonal antibody specific of application foregoing invention, by Western Bloting, the differential expression between acute myeloid leukemia and normal people of this gene is analyzed.
The expression level normal people is high than it by single stage method RT-PCR, Western Bloting, to find the expression level of FAMLF in acute myeloid leukemia, and its difference has statistical meaning.The high expression level of FAMLF, may cause the continuous activation of cell proliferation signal, or the inhibition of apoptosis signal, thereby causes the generation of malignant tumour.
The invention provides producer gene FAMLF monoclonal antibody specific polypeptide epitope sequence SEQ ID NO:1 used and sequence SEQ ID NO:2.
The invention still further relates to the polynucleotide sequence corresponding with polypeptide epitope sequence SEQ ID NO:1 and sequence SEQ ID NO:2.Polynucleotide can be DNA form or rna form.DNA form comprises the DNA of cDNA, genomic dna, synthetic or the DNA obtaining by genetically engineered.DNA can be strand or double-stranded.The polynucleotide sequence of encoding mature polypeptide can be identical with the coding region sequence shown in sequence table SEQ ID NO:1 and SEQ ID NO:2 or the varient of degeneracy.The corresponding polynucleotide of mature polypeptide of code sequence list sequence SEQ ID NO:1 and SEQ ID NO:2 comprise: the encoding sequence that only has mature polypeptide; The encoding sequence of mature polypeptide and various additional code sequence; The encoding sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence.DNA can be coding strand or noncoding strand.
The invention still further relates to the varient of polynucleotide, its coding has the polypeptide of identical aminoacid sequence or the segment of polypeptide, analogue and derivative with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural occurs.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing in fact the function of the polypeptide of its coding.
The invention still further relates to the sense-rna (antisense), siRNA (small interfering RNA), ribozyme (ribozyme), the triple strand dna that on FAMLF sequence information basis, derive, design and form the gene therapy product such as deoxy-oligonucleotide (triple helix-forming oligo-nucleotides, TFO).
The special polynucleotide sequence of encoding human recombination FAMLF of the present invention can obtain by several different methods.For example,, with the separated polynucleotide of hybridization technique well known in the art.These technology including, but not limited to: 1) with probe and genome or cDNA library, hybridize to detect the polynucleotide sequence of homology, and 2) antibody screening of expression library to be to detect the polynucleotide passage of the clone with common structure feature.
Other polypeptide of the present invention relates to the polypeptide of immunologic opsonin ground binding sequence sequence SEQ ID NO:1 and SEQ ID NO:2 or preservation clones coding, their polypeptide fragment or antibody and the T cell antigen receptor (TCR) of variant and/or epi-position of the present invention (immunoassay of specific antibody-antigen combination determines for measuring by well known).
Known this basic antibody structure unit comprises the tetramer.Each tetramer is comprised of two pairs of identical polypeptide chains, and every pair has one " light chain " (about 25kDa) and one " heavy chain " (about 50-70kDa).The aminoterminal of each chain partly comprises approximately 100 to 110 or more amino acid whose variable region, and it is mainly responsible for antigen recognition.The carboxyl terminal of each chain has partly been stipulated constant region, and it is mainly responsible for effector function.Mankind's light chain is divided into κ and lambda light chain, and heavy chain is divided into μ, δ, γ, α or ε, and by the isotype regulation of antibody, is IgM, IgD, IgG, IgA and IgE respectively.The variable region of every pair of light chain/heavy chain forms antibody combining site.
Therefore, complete IgG antibody has two binding sites.Except difunctional or bi-specific antibody, these two binding sites are identical.
These chains all show identical general structure, the relatively conservative framework region (FR) coupling together by three hypervariable regions (being called again complementary determining region or CDR).CDR from every pair of heavy chain and light chain arranges by framework region, makes to be combined with specific epitopes.From N, hold the end to C, light chain and heavy chain IncFlds FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4.Sequence (National Institutes of Health, Bethesda, the Md according to Kabat with the protein of immune meaning.
Dual specific or bifunctional antibody are to have two different heavy chains/light chains to the artificial hybrid antibody with two different binding sites.Bi-specific antibody can be prepared by several different methods, and these methods comprise fusion hybridoma or connect Fab ' fragment.In addition, bi-specific antibody can form " diabodies ".
Antibody of the present invention comprises, but be not limited to polyclone, mono-clonal, polyspecific, the mankind, humanization or chimeric antibody, single-chain antibody, Fab fragment, and F (ab ') fragment, the fragment producing by Fab expression library, antiidiotype (anti-Id) antibody (for example comprising the anti-Id antibody for antibody of the present invention), the antibody producing in cell (that is, and intrabodies), and the fragment of above-mentioned all combination epi-positions.Term " antibody " is used in reference to immunologic competence part or the fragment of immunoglobulin molecules and immunoglobulin molecules in this article, contains the molecule of the antigen binding site of immunologic opsonin conjugated antigen.Immunoglobulin molecules of the present invention can be any type (for example IgG, IgE, IgM, IgD, IgA and IgY), class (for example IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) or the subclass of immunoglobulin molecules.
Most preferably, antibody is mankind's antigen-binding antibody fragment of the present invention, includes but not limited to the Fvs (sdFv) that Fab, Fab ' and F (ab ') 2, Fd, scFv s (scFv), single-chain antibody, disulfide linkage are connected and comprises VL or the fragment in VH territory.Antigen-binding antibody fragment, comprises single-chain antibody, can only comprise variable region or also comprise following all or part: hinge area, CH1, CH2 and CH3 territory.The present invention also comprises the Fab of any combination that comprises variable region and hinge area, CHI, CH2 and CH3 territory.Antibody of the present invention can comprise birds and mammal from any animal-origin.Preferably, this antibody is people, mouse (for example Mouse and rat), donkey, sheep, rabbit, goat, cavy, camel, horse or chicken.Herein, " mankind " antibody comprises the antibody of the aminoacid sequence with human immunoglobulin, comprises separation from human normal immunoglobulin library or the separated antibody from not expressing one or more human immunoglobulin transgenic animal of endogenous immunoglobulin.Antibody of the present invention can be monospecific, dual specific, tri-specific or more polyspecific.Multi-specificity antibody can have specificity for the different epi-positions of polypeptide of the present invention, maybe can have specificity to polypeptide of the present invention and to allos epi-position skins as many in allos or solid support material.
Antibody of the present invention can be described or stipulate according to the epi-position of the present invention of its identification or specific combination or polypeptide portion.This epi-position or polypeptide portion can by regulation described herein, for example, be held with C end position, by the size of continuous amino acid residue, be stipulated by N.Preferred epi-position of the present invention comprises: the polypeptide of sequence SEQ ID NO:2 coding.The present invention includes the polynucleotide of these epi-positions of coding.Even more preferably epi-position of the present invention comprises corresponding to born of the same parents' outer shroud of Familial Acute Myelogenous Leukemia relative new gene of the present invention (FAMLF) or the peptide of its fragment and variant, the amino acid of the polypeptide that for example sequence SEQ ID NO:2 encodes.
Antibody of the present invention also can be described or stipulate according to its cross reactivity.The antibody that comprises not any other analogue in conjunction with polypeptide of the present invention, straight homologues, homologue.Antibody in conjunction with the polypeptide of consistent with polypeptide at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 65%, at least 60%, at least 55%, at least 50% of the present invention (use known in the art and described herein method calculate) is also included within the present invention.Discord is also included within the present invention with the antibody of the polypeptide combination of polypeptide less than 95% of the present invention, less than 90%, less than 85%, less than 80%, less than 75%, less than 70%, less than 65%, less than 60%, less than 55%, less than 50% consistent (using method known in the art and described herein to calculate).
Antibody of the present invention (comprise contain antibody fragment or its variant or consisting of molecule) can immunologic opsonin ground in conjunction with people's Familial Acute Myelogenous Leukemia relative new gene (FAMLF), polypeptide or polypeptide fragment or the variant of the coded polypeptide of sequence SEQ ID NO:2 and/or monkey Familial Acute Myelogenous Leukemia relative new gene (FAMLF).Preferably, antibody mediated immunity of the present invention specifically with mankind's Familial Acute Myelogenous Leukemia relative new gene (FAMLF) combination.Preferably, antibody mediated immunity of the present invention specifically with Familial Acute Myelogenous Leukemia relative new gene (FAMLF) combination of people and monkey.And, preferably, antibody mediated immunity of the present invention specifically in conjunction with people's Familial Acute Myelogenous Leukemia relative new gene (FAMLF) and mouse Familial Acute Myelogenous Leukemia relative new gene (FAMLF) more preferably, antibody mediated immunity of the present invention specifically with people's Familial Acute Myelogenous Leukemia relative new gene (FAMLF) combination, wherein this antibody on human Familial Acute Myelogenous Leukemia relative new gene (FAMLF) comparison mouse Familial Acute Myelogenous Leukemia relative new gene (FAMLF) has higher affinity.
As non-limitative example, if the dissociation constant (K that antibody is combined with the first antigen d) be less than antibody for the K of the second antigen dtime, can think that this antibody is preferentially in conjunction with the first antigen.
The affinity that antibody of the present invention can also be combined with polypeptide of the present invention according to it is described or is defined.Preferred binding affinity comprises having and is less than 5 * 10 -2m, 10 -2m, 5 * 10 -3m, 10 -3m, 5 * 10 -4m, 10 -4those of the dissociation constant of M or Kd.Preferred binding affinity comprises having and is less than 5 * 10 -5m, 10 -5m, 5 * 10 -6m, 10 -6m, 5 * 10 -7m, 10 -7m, 5 * 10 -8m or 10 -8those of the dissociation constant of M or Kd.Even preferred binding affinity comprises having and is less than 5 * 10 -9m, 10 -9m, 5 * 10 -10, 10 -10m, 5 * 10 -11m, 10 -11m, 5 * 10 -12m, 10 -12m, 5 * 10 -13m, 10 -13m, 5 * 10 -14m, 10 -14m, 5 * 10 -14m or 10 -15those of the dissociation constant of M or Kd.
The present invention also provides competition and suppresses the antibody that antibody is combined with epi-position of the present invention, and this is that for example immunoassay described herein is definite by any method for definite competitive binding known in the art.This antibody competition ground suppresses at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 60% or at least 50% epi-position combination.
Antibody of the present invention can be as agonist or the antagonist of polypeptide of the present invention.For example, the present invention includes and destroy partially or completely receptor/ligand and the interactional antibody of polypeptide of the present invention.Preferably, antibody of the present invention is combined with epitope disclosed herein or its part.The invention is characterized in receptor specific antibody and ligand specificity's antibody.The present invention also take that not hinder ligand binding but stop the receptor specific antibody of receptor activation be feature.Receptor activation (being signal transmission) can be determined by described herein or other technology known in the art.For example, can for example,, by using immunoprecipitation and western engram analysis subsequently (seeing above-mentioned) to detect the phosphorylation (tyrosine or serine/threonine) of acceptor or its substrate, determine receptor activation.
The invention still further relates to and not only stop ligand binding but also stop the receptor specific antibody of receptor activation and identification receptor one ligand complex the antibody of the unconjugated acceptor of specific recognition or unconjugated part not preferably.Equally, the present invention also comprises with ligand binding and stops part and the neutralizing antibody of receptors bind, and stops thus receptor activation with ligand binding but do not stop the antibody of part and receptors bind.The present invention also comprises the antibody of activated receptor.These antibody can be used as receptor stimulant and work, and by for example inducing receptor dimerization, strengthen or activate the biologic activity of the ligand-mediated receptor activation of all or part.These antibody can be confirmed as agonist, antagonist or the inverse agonist of biologic activity (particular biological that comprises peptide of the present invention disclosed herein is active).Above-mentioned antibody agonist can be used means known in the art preparation.
Immunologic opsonin ground is in conjunction with the antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) or its fragment or variant, the polypeptide that comprises the aminoacid sequence with any heavy chain of the anti-Familial Acute Myelogenous Leukemia relative new gene of the present invention (FAMLF) antibody expression expression of cell lines and/or any light chain of the anti-Familial Acute Myelogenous Leukemia relative new gene of the present invention (FAMLF) antibody expression expression of cell lines.Immunologic opsonin ground is in conjunction with the antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) or its fragment or variant, the polypeptide that comprises the aminoacid sequence with any one heavy chain VH territory of the anti-Familial Acute Myelogenous Leukemia relative new gene of the present invention (FAMLF) antibody expression expression of cell lines and/or any one light chain VL territory of the anti-Familial Acute Myelogenous Leukemia relative new gene of the present invention (FAMLF) antibody expression expression of cell lines.The VH territory that antibody of the present invention comprises the single anti-Familial Acute Myelogenous Leukemia relative new gene of the present invention (FAMLF) antibody expression expression of cell lines and the aminoacid sequence in VL territory.Antibody of the present invention comprises the expressed VH territory of the present invention's anti-Familial Acute Myelogenous Leukemia relative new genes of two kinds of differences (FAMLF) antibody expression clone and the aminoacid sequence in VL territory.The present invention also comprises following molecule, described molecule comprise immunologic opsonin in conjunction with Familial Acute Myelogenous Leukemia relative new gene (FAMLF), the VH of the anti-Familial Acute Myelogenous Leukemia relative new gene of the present invention (FAMLF) antibody expression expression of cell lines and/or antibody fragment or the variant in VL territory, or consisting of, the present invention also comprises the nucleic acid molecule of these VH of coding and VL territory, molecule, fragment and/or variant.
The present invention also provides immunologic opsonin in conjunction with the antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) polypeptide or polypeptide fragment or variant, wherein said antibody comprises following polypeptide or is comprised of following polypeptide, and this polypeptide has the aminoacid sequence of any one in the heavy chain of one or more anti-Familial Acute Myelogenous Leukemia relative new gene (FAMLF) antibody expression expression of cell lines of the present invention, two, three or more VH CDR.
Especially, the invention provides comprise following polypeptide or by following polypeptide, formed, immunologic opsonin in conjunction with the antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF), described polypeptide has the aminoacid sequence of VH CDR1 in the heavy chain of one or more anti-Familial Acute Myelogenous Leukemia relative new gene (FAMLF) antibody expression expression of cell lines of the present invention.Immunologic opsonin ground comprises following polypeptide in conjunction with the antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) or consisting of, wherein said polypeptide, has the aminoacid sequence of VH CDR2 in the heavy chain of one or more anti-Familial Acute Myelogenous Leukemia relative new gene (FAMLF) antibody expression expression of cell lines of the present invention.Immunologic opsonin ground comprises following polypeptide in conjunction with the antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) or consisting of, wherein said polypeptide, has the aminoacid sequence of VH CDR3 in the heavy chain of one or more anti-Familial Acute Myelogenous Leukemia relative new gene (FAMLF) antibody expression clone of the present invention Yuan Da.Comprise these antibody or antibody fragment or its variant immunologic opsonin and be also included within the present invention in conjunction with the molecule of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) or Familial Acute Myelogenous Leukemia relative new gene (FAMLF) fragment or its variant, in the nucleic acid molecule of encode equally these antibody, molecule, fragment and/or variant is also included within.
The present invention also provides immunologic opsonin in conjunction with the antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) polypeptide or polypeptide fragment or variant, wherein said antibody comprises following polypeptide or consisting of, described polypeptide, has the aminoacid sequence of any one in the light chain of one or more anti-Familial Acute Myelogenous Leukemia relative new gene (FAMLF) antibody expression expression of cell lines of the present invention, two, three or more VL CDR.Especially, the invention provides comprise following polypeptide or by following polypeptide, formed, immunologic opsonin in conjunction with the antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF), described polypeptide has the aminoacid sequence of VL CDR1 in the light chain of one or more anti-Familial Acute Myelogenous Leukemia relative new gene (FAMLF) antibody expression expression of cell lines of the present invention.Immunologic opsonin ground comprises following polypeptide in conjunction with the antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) or consisting of, wherein said polypeptide, has the aminoacid sequence of VLCDR2 in the light chain of one or more anti-Familial Acute Myelogenous Leukemia relative new gene (FAMLF) antibody expression expression of cell lines of the present invention.Immunologic opsonin ground comprises following polypeptide in conjunction with the antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) or consisting of, wherein said polypeptide, has the aminoacid sequence of VL CDR3 in the light chain of one or more anti-Familial Acute Myelogenous Leukemia relative new gene (FAMLF) antibody expression clone of the present invention Yuan Da.Comprise these antibody or antibody fragment or its variant immunologic opsonin and be also included within the present invention in conjunction with the molecule of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) or Familial Acute Myelogenous Leukemia relative new gene (FAMLF) fragment or its variant, in the nucleic acid molecule of encode equally these antibody, molecule, fragment and/or variant is also included within.
The present invention immunologic opsonin is also provided in conjunction with the antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) polypeptide or Familial Acute Myelogenous Leukemia relative new gene (FAMLF) polypeptide fragment or variant (comprise contain antibody fragment or variant or consisting of molecule), wherein said antibody comprises in the expressed heavy chain of one or more anti-Familial Acute Myelogenous Leukemia relative new gene (FAMLF) antibody expression clones of the present invention or light chain, two, three or more VH CDR and one, two, three or more VL CDR, or formed by them.Especially, the invention provides immunologic opsonin in conjunction with the antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) polypeptide or polypeptide variants or variant, VH CDR1 and VL CDR1 that wherein said antibody comprises VH CDR and VL CDR in the expressed heavy chain of one or more anti-Familial Acute Myelogenous Leukemia relative new gene (FAMLF) antibody expression clones of the present invention or light chain, VH CDR1 and VL CDR2, VH CDR1 and VL CDR3, VH CDR2 and VL CDR1, VH CDR2 and VL CDR2, VHCDR2 and VL CDR3, VH CDR3 and VH CDR1, VH CDR3 and VL CDR2, VH CDR3 and VL CDR3, or their any combination, or formed by them.One or more in these combinations come from the single anti-Familial Acute Myelogenous Leukemia relative new gene of the present invention (FAMLF) antibody expression clone.The fragment that comprises these antibody or variant or consisting of, the molecule of immunologic opsonin Familial Acute Myelogenous Leukemia relative new gene (FAMLF) is also contained in the present invention, in the nucleic acid molecule of encode equally these antibody, molecule, fragment or variant is also included within.
The present invention also provide code book invention antibody (comprise contain antibody fragment or its variant or consisting of molecule) nucleic acid molecule, be generally separated nucleic acid molecule.The following antibody of nucleic acid molecule encoding of the present invention (comprise contain antibody fragment or its variant or consisting of molecule), the VH territory of the aminoacid sequence in any VH territory that described antibody comprises the heavy chain with the anti-Familial Acute Myelogenous Leukemia relative new gene of the present invention (FAMLF) antibody expression expression of cell lines and there is the VL territory of aminoacid sequence of the light chain of the anti-Familial Acute Myelogenous Leukemia relative new gene of the present invention (FAMLF) antibody expression expression of cell lines, or formed by them.The following antibody of nucleic acid molecule encoding of the present invention (comprise contain antibody fragment or its variant or consisting of molecule), the VH territory of the aminoacid sequence in any VH territory that described antibody comprises the heavy chain with the anti-Familial Acute Myelogenous Leukemia relative new gene of the present invention (FAMLF) antibody expression expression of cell lines or there is the VL territory of aminoacid sequence of the light chain of the anti-Familial Acute Myelogenous Leukemia relative new gene of the present invention (FAMLF) antibody expression expression of cell lines, or formed by them.
The present invention also provide the variant (comprising derivative) that comprises antibody molecule described herein (for example VH territory and/or VL territory) or consisting of antibody, wherein this antibody mediated immunity is specifically in conjunction with Familial Acute Myelogenous Leukemia relative new gene (FAMLF) or its fragment or variant.Can use standard technique well known by persons skilled in the art sudden change to be introduced in the nucleotide sequence of code book invention molecule, these technology comprise and for example cause the site-directed mutagenesis of amino acid replacement and the mutagenesis of PCR mediation.Preferably, this variant (comprising derivative) coding is less than 50 amino acid replacements, is less than 40 amino acid replacements, is less than 30 amino acid replacements, is less than 25 amino acid replacements, is less than 20 amino acid replacements, is less than 15 amino acid replacements, is less than 10 amino acid replacements, is less than 5 amino acid replacements, is less than 4 amino acid replacements, is less than 3 amino acid replacements or is less than 2 amino acid replacements (with respect to for VH territory, VH CDR1, VH CDR2, VH CDR3, VL territory, VL CDR1, VL CDR2 or VL CDR3)." conserved amino acid substitutes " refers to amino-acid residue is replaced by the amino-acid residue having with the side chain of similar electric charge.There is the amino-acid residue family existing definition in the prior art with the side chain of similar electric charge.These families comprise and have basic side chain (Methionin for example, arginine, Histidine), acid side-chain (aspartic acid for example, L-glutamic acid), uncharged polar side chain (glycine for example, l-asparagine, glutamine, Serine, Threonine, tyrosine, halfcystine), non-polar sidechain (L-Ala for example, α-amino-isovaleric acid, leucine, Isoleucine, phenylalanine, methionine(Met), tryptophane), β branched building block (Threonine for example, α-amino-isovaleric acid, Isoleucine) and aromatic side chain (tyrosine for example, phenylalanine, tryptophane, Histidine) amino acid.Or, can be along all or part of encoding sequence, for example by saturation mutagenesis, introduce randomly sudden change, and can be with regard to the biologic activity screening institute mutant that obtains for example, mutant with the evaluation retentive activity ability of Familial Acute Myelogenous Leukemia relative new gene (in conjunction with).
Immunologic opsonin ground in conjunction with the antibody of the present invention of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) polypeptide or its fragment or variant (comprise contain its antibody fragment or variant or consisting of molecule), comprise following nucleotide sequence coded aminoacid sequence or consisting of, described nucleotide sequence and the nucleotide sequence hybridization that is complementary to VH of one or more anti-Familial Acute Myelogenous Leukemia relative new gene (FAMLF) antibody expression expression of cell lines of the present invention or the encoding sequence in VL territory, the condition of described hybridization is stringent condition, fall as being combined DNA hybridization at approximately 45 ℃ in 6 * sodium chloride/sodium citrate (SSC) with filter membrane, in 0.2 * SSC/0.1%SDS, at about 50-65 ℃, do afterwards one or repeatedly washing, height stringent condition, fall as with the hybridization at approximately 45 ℃ in 6 * SSC of filter membrane bind nucleic acid, in 0.1 * SSC/0.2%SDS, at approximately 68 ℃, do afterwards one or repeatedly washing, or other tight hybridization conditions well known by persons skilled in the art.The nucleic acid molecule of these antibody of encoding is also included within the present invention.
As well known in the art, there is the polypeptide of similar aminoacid sequence or its fragment or variant and usually there is similar structure and many identical biologic activity.Therefore, immunologic opsonin ground is in conjunction with the antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) polypeptide or Familial Acute Myelogenous Leukemia relative new gene (FAMLF) polypeptide fragment or variant (comprising the molecule that contains its antibody fragment or variant or be comprised of them), comprise have following aminoacid sequence VH territory or consisting of, the aminoacid sequence in the VH territory of the heavy chain that the anti-Familial Acute Myelogenous Leukemia relative new gene of described aminoacid sequence and the present invention (FAMLF) antibody expression clone is expressed has at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% consistence.
Immunologic opsonin ground is in conjunction with Familial Acute Myelogenous Leukemia relative new gene (FAMLF) polypeptide or the fragment of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) polypeptide or the antibody of variant (comprising the molecule that contains its antibody fragment or variant or be comprised of them), comprise have following aminoacid sequence VL territory or consisting of, the aminoacid sequence in the VL territory of the light chain that the anti-Familial Acute Myelogenous Leukemia relative new gene of described aminoacid sequence and the present invention (FAMLF) antibody expression clone is expressed has at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% consistence.
The present invention also comprises the antibody (comprising the molecule that contains its antibody fragment or variant or be comprised of them) with one or more antibody described herein with one or more identical biological properties.So-called " biological property " refers to external or activity in vivo or the character of antibody, as for example, ability in conjunction with Familial Acute Myelogenous Leukemia relative new gene (FAMLF) (expressing at the chimeric Familial Acute Myelogenous Leukemia relative new gene of Familial Acute Myelogenous Leukemia relative new gene (FAMLF), film (FAMLF) of cell surface and/or fragment or the variant of Familial Acute Myelogenous Leukemia relative new gene (FAMLF)); Substantially suppress or destroy the ability of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) and Familial Acute Myelogenous Leukemia relative new gene (FAMLF) ligand binding: the ability of lowering Familial Acute Myelogenous Leukemia relative new gene (FAMLF) expression of polypeptides on cell surface; Suppress or destroy the ability of the biologic activity of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) mediation.Optionally, the antibody of the present invention epi-position identical with at least one antibodies of specifically mentioning herein.This epi-position is in conjunction with using assay method known in the art to determine.
During the present invention also provides and the antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) (comprising the molecule that contains its antibody fragment or variant or formed by them), the part that described antibody comprises antibody VH of the present invention or VL territory (for example VHCDR1, VH CDR2, VH CDR3, VL CDR1, VL CDR2 and/or VL CDR3) or consisting of.For example, the antibody of " in and Familial Acute Myelogenous Leukemia relative new gene (FAMLF) or its fragment or variant " can be reduce or thoroughly destroy Familial Acute Myelogenous Leukemia relative new gene (FAMLF) or its fragment or variant in conjunction with the antibody of the ability of its part; And/or thoroughly destroy or suppress the antibody that Familial Acute Myelogenous Leukemia relative new gene (FAMLF) signal transmits cascade.In and the antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF), the polypeptide that comprises the aminoacid sequence with antibody VH territory of the present invention or its fragment or variant and antibody VL territory of the present invention or its fragment or variant, or consisting of.In and the antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF), the many skins that comprise the VH territory of (or scFv or Fab fragment) that there is monospecific antibody of the present invention and the aminoacid sequence of VL territory or its fragment or variant, or consisting of.In and Familial Acute Myelogenous Leukemia relative new gene (FAMLF)) antibody, the polypeptide that comprises the aminoacid sequence with antibody VH territory of the present invention or its fragment or variant, or consisting of.In and the antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF), the polypeptide that comprises the aminoacid sequence with antibody VL territory of the present invention or its fragment or variant, or consisting of.In and the antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) or its fragment or variant, the polypeptide that comprises the aminoacid sequence with antibody VH CDR territory of the present invention or its fragment or variant, or consisting of.In and the antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) or its fragment or variant, the polypeptide that comprises the aminoacid sequence with antibody VH CDR3 territory of the present invention or its fragment or variant, or consisting of.In and the antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) or its fragment or variant, the polypeptide that comprises the aminoacid sequence with antibody VLCDR territory of the present invention or its fragment or variant, or consisting of.In and the antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) or its fragment or variant, the polypeptide that comprises the aminoacid sequence with antibody VL CDR3 territory of the present invention or its fragment or variant, or consisting of.The nucleic acid molecule of these antibody of encoding is also included within the present invention.
The present invention also provide the cell surface expression (measuring by any currently known methods in this area, for example facs analysis assay method) of lowering Familial Acute Myelogenous Leukemia relative new gene (FAMLF) antibody (comprise contain its antibody fragment or variant or consisting of molecule).As a kind of non-limiting hypothesis, this downward may be the result of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) internalization of antibody induction.The part of the VH that described antibody comprises the aminoacid sequence with antibody of the present invention or VL territory or its fragment or variant (for example VH CDR1, VH CDR2, VH CDR3, VL CDR1, VL CDR2, VL CDR3) or consisting of.Lower the antibody of the cell surface expression of Familial Acute Myelogenous Leukemia relative new gene (FAMLF), the polypeptide that comprises the aminoacid sequence with antibody VH territory of the present invention or its fragment or variant and antibody VL territory of the present invention or its fragment or variant or consisting of.
Lower the antibody of the cell surface expression of Familial Acute Myelogenous Leukemia relative new gene (FAMLF), comprise have from the polypeptide of the VH territory of monospecific antibody of the present invention (or scFv or Fab fragment) and the aminoacid sequence of VL territory or its fragment or variant or consisting of.Lower the antibody of the cell surface expression of Familial Acute Myelogenous Leukemia relative new gene (FAMLF), the polypeptide that comprises the aminoacid sequence with antibody VH territory of the present invention or its fragment or variant or consisting of.Lower the antibody of the cell surface expression of Familial Acute Myelogenous Leukemia relative new gene (FAMLF), the polypeptide that comprises the aminoacid sequence with antibody VL territory of the present invention or its fragment or variant or consisting of.Lower the antibody of the cell surface expression of Familial Acute Myelogenous Leukemia relative new gene (FAMLF), the polypeptide that comprises the aminoacid sequence with antibody VH CDR3 of the present invention or its fragment or variant or consisting of.Lower the antibody of the cell surface expression of Familial Acute Myelogenous Leukemia relative new gene (FAMLF), the polypeptide that comprises the aminoacid sequence with antibody VLCDR3 of the present invention or its fragment or variant or consisting of.The nucleic acid molecule of these antibody of encoding is also included within the present invention.
The present invention also provide increase the active antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) (comprise contain its antibody fragment or variant or consisting of molecule), the part that described antibody comprises VH or VL territory or its fragment or the variant with antibody of the present invention (for example VH CDR1, VH CDR2, VH CDR3, VL CDR1, VL CDR2, VL CDR3) or consisting of.Increase the active antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF), the polypeptide that comprises the aminoacid sequence with antibody VH territory of the present invention or its fragment or variant and antibody VL territory of the present invention or its fragment or variant or consisting of.Increase the active antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF), comprise have from the polypeptide of the VH territory of monospecific antibody of the present invention (or scFv or Fab fragment) and the aminoacid sequence of VL territory or its fragment or variant or consisting of.Increase the active antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF), the polypeptide that comprises the aminoacid sequence with antibody VH territory of the present invention or its fragment or variant or consisting of.Increase the active antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF), the polypeptide that comprises the aminoacid sequence with antibody VL territory of the present invention or its fragment or variant or consisting of.Increase the active antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF), the polypeptide that comprises the aminoacid sequence with VH CDR territory or its fragment or variant or consisting of.Increase the active antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF), the polypeptide that comprises the aminoacid sequence with antibody VH CDR3 of the present invention or its fragment or variant or consisting of.Increase the active antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF), the polypeptide that comprises the aminoacid sequence with antibody VL CDR city of the present invention or its fragment or variant or consisting of.Increase the active antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF), the polypeptide that comprises the aminoacid sequence with antibody VL CDR3 of the present invention or its fragment or variant or consisting of.The nucleic acid molecule of these antibody of encoding is also included within the present invention.
The present invention also provide comprise immunologic opsonin in conjunction with the antibody (comprise and contain its antibody fragment or variant) of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) and heterologous polypeptide or consisting of fusion rotein.Preferably, be useful for function or useful for target Familial Acute Myelogenous Leukemia relative new gene (FAMLF) express cell with the heterologous protein of antibody fusion.Fusion rotein of the present invention comprises following polypeptide or its fragment or variant and allogeneic polypeptide sequence or is comprised of them, and described polypeptide has the aminoacid sequence in any one or more VH of antibody of the present invention territory or the aminoacid sequence in any one or more VL of antibody of the present invention territory.Fusion rotein of the present invention comprises following polypeptide or its fragment or variant and allogeneic polypeptide sequence, and described polypeptide has the aminoacid sequence of any one of antibody of the present invention, two, three or more VH CDR or any one of antibody of the present invention, the aminoacid sequence of two, three or more VL CDR.This fusion rotein comprises following polypeptide or its fragment or variant and allogeneic polypeptide sequence, wherein said polypeptide has the aminoacid sequence of antibody VH CDR3 of the present invention, and this fusion rotein can immunologic opsonin ground in conjunction with Familial Acute Myelogenous Leukemia relative new gene (FAMLF).Fusion rotein comprises following polypeptide or its fragment or variant and allogeneic polypeptide sequence, and wherein said polypeptide has the aminoacid sequence at least one VH territory of antibody of the present invention and the aminoacid sequence at least one VL territory of antibody of the present invention.Preferably, the VH of fusion rotein and VL territory are corresponding to monospecific antibody of the present invention (or scFv or Fab fragment).Fusion rotein of the present invention comprises following polypeptide or its fragment or variant and allogeneic polypeptide sequence or is comprised of them, and described polypeptide has the aminoacid sequence of any one of antibody of the present invention, two, three or more VH CDR and any one of antibody of the present invention, the aminoacid sequence of two, three or more VL CDR.Preferably, two, three, four, five, six in these VH CDR or VL CDR or more corresponding to monospecific antibody of the present invention (or scFv or Fab fragment).The nucleic acid molecule of these fusion roteins of encoding is also included within the present invention.
Antibody of the present invention can, for such as but not limited to purifying, detection and target polypeptide of the present invention, comprise diagnosis and the methods for the treatment of of in vitro and in vivo.For example, these antibody can be used for to immunoassay quantitatively and qualitatively to measure the level of biological sample polypeptide of the present invention.
Antibody of the present invention can give individuality in the mode of passive immunization.Or, can use polypeptide of the present invention to carry out epitope mapping to identify the epi-position of this antibody institute combination.The epi-position of identifying in this way can for example be used as vaccine candidate object again, for immune body, causes the Familial Acute Myelogenous Leukemia relative new gene (FAMLF) for natural form.
Just as described in more detail below, antibody of the present invention can be used separately or use with other combination of compositions.Can also these antibody domain heterologous polypeptides be merged at N or C end by recombination form, or make these antibody and polypeptide or other composition put together (comprising covalency and non-covalent puting together) by chemical mode.For example, antibody of the present invention can by recombination form with in test experience, with the molecule of marking and effector molecule, merge or put together as heterologous polypeptide, medicine, radionuclide or toxin.
Antibody of the present invention comprises for example by the derivative that any types of molecules of this antibody covalent attachment is modified.For example; but be not construed as limiting; this antibody derivatives comprises the antibody through modifying, and the example of described modification has glycosylation, acetylize, PEGization (pegylation), phosphorylation, amidation, the derivatize being undertaken by known protection/blocking groups, proteolysis to cut, be connected with cell ligand or other albumen etc.Many chemically modifieds can be undertaken by known technology, include but not limited to that the metabolism of special chemical chop, acetylize, formylation, tunicamycin is synthetic etc.In addition, this derivative can also contain one or more nonclassical amino acids.
Antibody of the present invention can produce by any suitable currently known methods in this area.Polyclonal antibody for object antigen can be prepared by several different methods well known in the art.For example, polypeptide of the present invention can be applied to multiple host animal, include but not limited to rabbit, mouse, rat etc., to induce the serum that contains the special polyclonal antibody for this antigen to produce.According to host species, can use multiple adjuvant to strengthen this immunne response, these adjuvants include but not limited to that freund's adjuvant (completely with incomplete), mineral rubber are if aluminium hydroxide, surfactant are if mankind's adjuvant of lysolecithin, poly alcohol, polyanion, peptide, oiliness emulsion, keyhole limpet hemocyanin, dinitrophenol(DNP) and potentially useful is as BCG (bacille Calmette-Guerin vaccine) and corynebacterium parvum (Corynebacterium parvum).These adjuvants are well known in the art.
Monoclonal antibody can be prepared by extensive multiple technologies known in the art, and these technology comprise uses hybridoma, restructuring, display technique of bacteriophage or their combination.For example, can use hybridoma technology, comprise known in the art and as Harlow etc., antibody: laboratory manual (Cold Spring Harbor Laboratory Press, the 2nd edition, 1988); Hammerling etc., in monoclonal antibody and T quadroma 563-581 (Elsevier, N.Y.1981) (described reference is intactly incorporated to herein as a reference), the hybridoma technology of instruction is prepared monoclonal antibody.Term " monoclonal antibody " refers to and derives from monospecific polyclonal, comprises eucaryon, protokaryon or bites mattress body clone's antibody, but not refer to its preparation method.
The method of using hybridoma technology preparation and screening specific antibody is conventional with well known in the art.Can use polypeptide of the present invention or express the cellular immunization mouse of this peptide.Once immunne response be detected, spleen the separating Morr. cell of results mouse in the serum of mouse, detected after the special antibody for this antigen.Then by knowing technology, these splenocytes and any suitable myeloma cell are merged.By limiting dilution, screen and clone hybridization knurl.Then by methods known in the art, analyze hybridoma, can be in conjunction with the cell of the antibody of polypeptide of the present invention to find secretion.Can be by using positive hybridoma clone immune mouse to produce the ascites that generally contains high-level antibody.
Therefore, the invention provides and prepare the method for monoclonal antibody and the antibody producing by the method, described method comprises the hybridoma of cultivating secretion antibody of the present invention, wherein preferably this hybridoma be by by separation from using splenocyte and the myeloma cell of the mouse of antigen immune of the present invention to merge generation, then screening merge the hybridoma that produces can be in conjunction with the hybridoma clone of the antibody of polypeptide of the present invention to find secretion.
Another well-known process of preparing polyclone and mono-clonal mankind B clone is to use Epstein-Barr virus (EBV) to transform.The working method of the B clone that preparation EBV transforms is that this area is conventionally known, such as the Current Protocols in Immunology (volume such as Coligan, 1994, John Wiley & Sons, NY) (being hereby intactly incorporated to herein as a reference) the 7.22nd chapter to working method.For the source of the B cell that transforms human peripheral normally, but also can derive from other source for the B cell transforming, include but not limited to the tissue of lymphoglandula, tonsilla, spleen, tumor tissues and infection.Generally before EBV transforms, tissue is made to single-cell suspension liquid.In addition, can take steps with physics remove or inactivation containing the T cell in the sample of B cell, because can suppress from the T cell of anti-EBV antibody serum positive individuals the B cellular immortalization that EBV causes.Generally, the sample that contains mankind B cell with EBV inoculation, and cultivate 3-4 week.The typical case source of EBV is the culture supernatants of B95-8 clone.Generally can when finishing, incubation period observe the physics sign that EVB transforms in 3-4 week.By phase microscope, transformant can show as greatly, becomes clear, crinosity tendency are assembled for cell cluster closely.At first, EBV system is generally polyclonal.Yet through long-term cell cultures, system can due to the selectivity Fast Growth of particular B cell clone, displacement be monoclonal or polyclonal for EBV.Or, polyclone EBV can be transformed be subclone (for example cultivating by limiting dilution) or make it to merge with suitable fusion partners and limiting dilution bed board to obtain mono-clonal B clone.For EBV transformation cell lines, suitable fusion partners comprises mouse myeloma cell line (for example SP2/O, X63-Ag8.653), hetero hybridoma cells system (people * mouse: for example SPAM-8, SBC-H20 and CB-F7) and human cell line (for example GM 1500, SKO-007, RPMI 8826 and KR-4).Therefore, the present invention also provides the method for preparation for polyclone or the monoclonal human antibody of polypeptide of the present invention or its fragment, and the method comprises that EBV transforms human B cell.
The antibody fragment of identification specific epitopes can produce by known technology.For example, Fab of the present invention and F (ab ') 2 fragments can be by being used for example papoid (producing Fab fragment) or stomach en-(produce F (ab ') 2 fragments of enzyme) proteolysis immunoglobulin molecules produces.F (ab ') 2 fragments contain variable region, constant region of light chain and heavy chain CH1 district.
For example, antibody of the present invention also can be used the multiple mattress body display library of biting known in the art to produce.In biting mattress body display method, functional antibodies territory is illustrated in its surface of biting mattress body particle of polynucleotide sequence of coding.This bites mattress body can be for for example showing, from the antigen binding domain of repertoire or combinatorial antibody library (people or mouse) expression.Can use antigen, for example antigen of applying marking or the antigen of being combined or being caught by it with solid surface or pearl, select or identify express binding purposes antigen antigen binding domain bite mattress body.For these methods bite mattress body filobactivirus typically, comprise fd and M13, there are the gene III of recombination form and phage or Fab, the Fv of gene VIII protein fusion or the stable Fv antibody domain of disulfide linkage in the combination territory of phage expression.Can comprise for the preparation of the example of the phage display method of antibody of the present invention and being disclosed in as those in Publication about Document: Brinkman etc., J.Immunol.Methods 182:41-50 (1995); Ames etc., J.Immunol.Methods 184:177-186 (1995); Kettleborough etc., Eur.J.Immunol.24:952-958 (1994); Persic etc., Gene 187:9-18 (1997); Burton etc., Advances in Immunology 57:191-280 (1994); PCT applies for PCT/GB9I/01134; The open text WO90/02809 of PCT; WO 91/10737; WO 92/01047:WO 92/18169; WO 93/11236:WO 95/15982:20 95/20401; With United States Patent (USP) 5,698,426; 5,223,409; 5,403,484; 5,580,717; 5,427,908; 5,750,753; 5,821,047; 5,571,698; 5,427,908; 5,516,637; 5,780,225; 5,658,727; 5,733,743 and 5,969,108; Allly all intactly be incorporated to herein as a reference.
People's antibody is particularly suitable for treating human patients completely.People's antibody can be prepared by several different methods known in the art, comprises the above-mentioned mattress body display method of biting that the antibody library of human normal immunoglobulin sequence carries out that derives from of using.See for example United States Patent (USP) 4,444,887 and 4,716,111; With the open text WO 98/46645 of PCT, WO 98/50433, and WO 98/24893, and WO 98/16654, and WO 96/34096, and WO 96/33735, and WO 91/10741; Allly all intactly be incorporated to herein as a reference.
Can also use the transgenic mice of can not the endogenous immune jujube albumen of expressive function but can express human immunoglobulin gene to prepare people's antibody.For example, can in mouse embryo stem cell, introduce people's heavy chain and light chain immunoglobulin gene mixture randomly or by homologous recombination.Or, can in mouse embryo stem cell, introduce people variable region, constant region and diversity region and people's heavy chain and light chain gene.Can be individually or when introducing human normal immunoglobulin site by homologous recombination, cause the afunction of murine heavy chain and light chain immunoglobulin gene.Especially, the homozygous deletion in JH district can stop endogenous antibody to produce.Increase this modification embryonic stem cell and be injected in blastocyst to produce gomphosis mouse.Then raise gomphosis mouse to produce the offspring of isozygotying who expresses people's antibody.With normal way, use selected antigen, for example this transgenic mice of all or part of immunity of polypeptide of the present invention.Use conventional hybridization knurl technology to obtain the monoclonal antibody for this antigen from this immune transgenic mice.The human normal immunoglobulin transgenosis that transgenic mice comprises is reset in B cell differentiation procedure, and subsequently through classification conversion and somatic mutation.Thus, use this technology can prepare upper useful IgG, IgA, IgM and the IgE antibody for the treatment of.About preparing the summary of this technology of people's antibody, see Lonberg and Huszar, Int.Rev.Immun01.13:65-93 (1995).
For the working method that discusses and prepare these antibody in detail of preparing this technology of people's antibody and human monoclonal antibodies, referring to the open text WO 98/24893:WO 92/01047 of for example PCT; WO96/33735; European patent O 598 877; United States Patent (USP) 5,413,923; 5,625,126; 5,633,425; 5,569,825; 5,661,016; 5,545,806; 5,814,318; 5,885,793; 5,916,771; 5,939,598; 6,075,181; With 6,114,598, be allly all intactly incorporated to herein as a reference.In addition for example Abgenix company (Fremont, CA) and Genpharm (San Jose, CA) are used the technology that is similar to aforesaid method that the people's antibody for selected antigen is provided, can to employ company.
The antibody of people completely of identifying selected epi-position can be used the technology that is called " guided selection (guided selection) " to produce.In this minute, selected non-human monoclonal antibodies is that mouse antibodies is for instructing the fully human antibodies of the identical epi-position of selective recognition.(Jespers etc., Bio/technology 12:899-903 (1988)).
And, use technology well known to those skilled in the art, can use again the antibody of polypeptide of the present invention to prepare " simulation ', the antiidiotypic antibody of polypeptide of the present invention.(see for example Greenspan & Bona, FASEB is (5) J.7: 437-444 (1989) and Nissinoff, J.Immunol.147 (8): 2429-2438 (1991)).For example, in conjunction with and competition suppress polypeptide of the present invention polypeptide multimerization and/or with the antibody of the combination of part can be for the preparation of " simulation " polypeptide multimerization and/or in conjunction with the antiidiotypic antibody in territory, and thus in conjunction with also and polypeptide and/or its part.In this and the Fab fragment of antiidiotypic antibody or this antiidiotype can be used for the treatment of method with in and polypeptide ligand.For example, can use this antiidiotypic antibody in conjunction with polypeptide of the present invention and/or in conjunction with its ligand/receptor, and activate thus or seal its biologic activity.
Intrabody be from recombinant nucleic acid molecules, express and through transformation, be trapped in the antibody that (is for example trapped in tenuigenin, endoplasmic reticulum or pericentral siphon) in cell, be usually scFv.Intrabody can be for for example destroying the function of the protein of this intrabody combination.The expression of intrabody can also be cut out in body and be used inducible promoter to regulate by the expression of nucleic acid comprising this intrabody.Intrabody of the present invention can be used means known in the art preparation, such as those methods that disclose and summarize in following document: Chen etc., and Hum.Gene Ther.5:595-601 (1994); Marasco, W.A.Gene Ther.4:11-15 (1997); Rondon and Marasco, Annu.Rev.Microbiol.51; 257-283 (1997); Proba etc., J.Mol.Bi01.275:245-253 (1998); Cohen etc., Oncogene 17:2445-2456 (1998); Ohage and Steipe, J.Mol.Biol.291:1119-1128 (1999); Ohage etc., J.Mol.Biol.291:1 129-1134 (1999): Wirtz and Steipe, Protein Sci.8:2245-2250 (1999): Zhu etc., J.Immunol.Methods 231:207-222 (1999); Institute's citing document wherein.
XenoMouse technology: according to antibody of the present invention preferably by utilizing following transgenic mice to prepare, described transgenic mice has inserted the substantive part of people's antibody generation gene but in the generation of endogenous mouse source antibody, had defect (for example can be from Abgenix Inc., Fremont, the XenoMouse system that CA obtains).Then, these mouse can produce human normal immunoglobulin molecule and antibody and cannot produce mouse source immunoglobulin molecules and antibody.For realizing the technology of this object, be disclosed in patent disclosed herein, application and reference.
In YAC, the mankind site of clone and reconstruct megabasse size provides strong instrument with the ability that is introduced into mouse propagation system, to illustrate the functional ingredient very big or site of mapping roughly and to produce useful human diseases model.And, with the application that mankind's Equivalent replaces this technology in mouse site, also can provide expression and regulation about Human genome product between the growth period, their diseases of participating in communication and their of other system to induce and unique view of process.
The immunity system " humanization " that an important practical application of this strategy is mouse.By in the mouse of human normal immunoglobulin (Ig) site introducing endogenous Ig gene inactivation, mechanism and their effects in B cell development of for the sequencing of research antibody, expressing and assembling provide chance.And this strategy can improve desirable source for preparation total man's monoclonal antibody (Mab), this is an important milestone of wishing towards realizing Antybody therapy human diseases.
Expection human antibody can minimize immunne response and anaphylaxis, and these are that the monoclonal antibody of mouse or mouse-derived is intrinsic, thereby increases thus efficiency and the thoroughness of institute's administration of antibodies.Can expect that human antibody for example, can provide substantial advantage in the treatment that requires the chronic of repetitive administration antibody and recurrent human diseases (cancer).
A kind of method that reaches this object be the people Ig site transformation of using large fragment mouse antibodies prepare aspect defective mouse, expect that this mouse will produce a large amount of people's antibody repertoires and lack mouse antibodies.Large people Ig fragment will be preserved the diversity of large variable gene and generation and the expression that suitably regulates antibody.By utilizing mouse machine make antibody variation and screen and lack the tolerance to human protein, the people's antibody repertoire copying in these mouse should produce the high-affinity antibody for any object antigen (comprising human antigen).Use hybridoma technology, can easily prepare and selection has the specific antigen-specific human monoclonal antibodies of expectation.
This general strategy contacts 1994 disclosed first XenoMouse tMthe preparation of system is illustrated.See Green etc., Nature Genetics 7:13-21 (1994).This XenoMouse tMsystem utilizes yeast artificial chromosome (YACS) transformation, and described YACS contains respectively the reproductive tract conformation fragment at people's heavy chain site and the κ light chain seat of 245kb and 10190kb size, the sequence that it contains core variable region and constant region.The YAC proof that contains people Ig for the rearrangement of antibody and expression is compatible with mouse system, and can substitute the mouse Ig gene of inactivation.This ability by its induction B cell development, the ripe sample people repertoire that produces human antibody and generation antigen-specific human monoclonal antibodies is confirmed.These results are also pointed out, and the introducing at the major part people Ig seat of the V gene that contains larger amt, additional regulatory element and people Ig constant region can substantially be summarized the human body fluid of infection and immunity is replied to distinctive repertoire.Recently, the work of Green etc. expands to by introducing respectively the megabasse size reproductive tract conformation YAC fragment at people's heavy chain seat and κ light chain seat and imports approximately 80% above people's antibody repertoire with generation XenoMouse tMmouse. see the Nature Genetics15:146-156 (1997) such as Mendez, Green and Jakobovits J.Exp.Med.188:483-495 (1998), Green, the U.S. Patent application 08/759 that Journal of Immunological Methods 231:11-23 (1999) and on December 3rd, 1996 submit to, 620, the open of all these is all incorporated herein by reference hereby.
Human anti-mouse antibody (HAMA) replys the industry that causes preparing chimeric or humanized antibody.Although chimeric antibody has He Shu variable region, human constant region, expection can be observed the anti-embedding house antibody of some people (HACA) and reply, especially when long-term or multiple doses are used antibody.Therefore, may expect to provide the complete human antibodies for Familial Acute Myelogenous Leukemia relative new gene (FAMLF) polypeptide, so that impact and/or effect that reduction HAMA or HACA reply.
The special monoclonal antibody for Familial Acute Myelogenous Leukemia relative new gene (FAMLF) polypeptide is used hybridoma technology to prepare.(Kohler etc., Nature 256:495 (1975): Kohler etc., Eur.J.Immunol.6:511 (1976); Kohler etc., Eur.J.Immunol.6:292 (1976); Hammerling etc., < < monoclonal antibody and T quadroma > >, Elsevier, N.Y. 571-681 page (1981)).In brief, use the cellular immunization XenoMOuse of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) expression vector transfection tMmouse.After immunity, extract the splenocyte of this mouse and itself and suitable myeloma cell line are merged.Any suitable myeloma cell line all can be for the present invention.After fusion, the hybridoma that obtains optionally maintains on HAT substratum, then by effective dilution, clones, referring to the description (Gastroenterology 80:225-232 (1981)) of Wands etc.Then the hybridoma analysis obtaining by this selection is identified to secretion can be in conjunction with the clone of the antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) polypeptide.
The present invention relates to immunologic opsonin in conjunction with the complete human antibodies of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) polypeptide, is generally separated.Substantially, with the immunity of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) express cell, from Abgenix, Inc. (Fremont, CA) expresses the XenMouse mouse system (details of immune operation method) of people's antibody; From thering is the mouse of the anti-Familial Acute Myelogenous Leukemia relative new gene of high titre (FAMLF) antibody, reclaim spleen and/or lymph-node cell (containing B cell); And this recovery cell and medullary cell system are merged to prepare immortalization hybridoma cell line.Screening hybridoma cell line produces the special hybridoma cell line for immunogenic antibody to select and to identify.
The present invention includes immunologic opsonin in conjunction with the antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) polypeptide or its fragment, variant or fusion rotein (comprise contain its antibody fragment or variant or consisting of molecule).Familial Acute Myelogenous Leukemia relative new gene (FAMLF) polypeptide that Familial Acute Myelogenous Leukemia relative new gene (FAMLF) polypeptide includes but not limited to or the polypeptide of DNA encoding; Familial Acute Myelogenous Leukemia relative new gene (FAMLF) can be by recombinant expressed coding the nucleic acid of polypeptide prepare.
The polypeptide that immunologic opsonin ground comprises the aminoacid sequence with any heavy chain of at least one expression of cell lines and/or any light chain of at least one expression of cell lines in conjunction with the antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) or its fragment or variant.Immunologic opsonin ground is in conjunction with the antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) or its fragment or variant, the polypeptide that comprises the aminoacid sequence with any one heavy chain VH territory of at least one expression of cell lines and/or any one light chain VL territory of at least one expression of cell lines.The VH territory that antibody of the present invention comprises the same cell system expression that is selected from clone and the aminoacid sequence in VL territory.Antibody of the present invention comprise from the VH territory of different clones and the aminoacid sequence in VL territory.In conjunction with the molecule of Familial Acute Myelogenous Leukemia relative new gene (FAMLF), be also included within the present invention to the antibody fragment in the VH that comprises at least one expression of cell lines and/or VL territory or variant or that formed by them, immunologic opsonin, in the nucleic acid molecule of encode these VH and VL territory, molecule, fragment and/or variant is also included within.
The present invention also provides immunologic opsonin in conjunction with the antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) polypeptide or polypeptide fragment or variant, wherein said antibody comprises following polypeptide or consisting of, described polypeptide, has contained any one in the heavy chain of one or more expression of cell lines, the aminoacid sequence of two, three or more VH CDR.Especially, the invention provides immunologic opsonin in conjunction with Familial Acute Myelogenous Leukemia relative new gene (FAMLF) and comprise following polypeptide or consisting of antibody, described polypeptide has the aminoacid sequence of VH CDR1 contained in the heavy chain of one or more expression of cell lines.Immunologic opsonin ground comprises following polypeptide in conjunction with the antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) or consisting of, described polypeptide, has the aminoacid sequence of the contained VH CDR2 of the heavy chain of one or more expression of cell lines.Immunologic opsonin ground comprises following polypeptide in conjunction with the antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) or consisting of, described polypeptide, has the aminoacid sequence of the contained VH CDR3 of the heavy chain of one or more expression of cell lines.Comprise these antibody or its antibody fragment or variant or by them, formed, immunologic opsonin is also included within the present invention in conjunction with the molecule of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) or Familial Acute Myelogenous Leukemia relative new gene (FAMLF) fragment or its variant, in the nucleic acid molecule of encode equally these antibody, molecule, fragment and/or variant is also included within.
The present invention also provides immunologic opsonin in conjunction with the antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) polypeptide or polypeptide fragment or variant, wherein said antibody comprises following polypeptide or consisting of, described polypeptide, has any one in the light chain of one or more expression of cell lines, two, three or the aminoacid sequence of more VL CDR.Especially, the invention provides immunologic opsonin in conjunction with Familial Acute Myelogenous Leukemia relative new gene (FAMLF) and comprise following polypeptide or consisting of antibody, described polypeptide has the aminoacid sequence of VL CDR1 in the light chain of one or more expression of cell lines.Immunologic opsonin ground comprises following polypeptide in conjunction with the antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) or consisting of, described polypeptide, has the aminoacid sequence of VL CDR2 in the light chain of one or more expression of cell lines.Immunologic opsonin ground comprises following polypeptide in conjunction with the antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) or consisting of, described polypeptide, has the aminoacid sequence of the contained VL CDR3 of the light chain of one or more expression of cell lines.Comprise these antibody or its antibody fragment or variant or by them, formed, immunologic opsonin is also included within the present invention in conjunction with the molecule of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) or Familial Acute Myelogenous Leukemia relative new gene (FAMLF) fragment or variant, in the nucleic acid molecule of encode equally these antibody, molecule, fragment and/or variant is also included within.
The present invention immunologic opsonin is also provided in conjunction with Familial Acute Myelogenous Leukemia relative new gene (FAMLF) polypeptide or the polypeptide fragment of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) or the antibody of variant (comprise contain antibody fragment or its variant or consisting of molecule), one, two, three or more VH CDR and one, two, three or more VL CDR in the heavy chain that wherein said antibody comprises one or more expression of cell lines or light chain, or formed by them.Especially, the invention provides immunologic opsonin in conjunction with the antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) polypeptide or polypeptide fragment or variant, the VH CDR1 of VHCDR and VL CDR and VL CDR1 in the heavy chain that wherein said antibody comprises one or more expression of cell lines or light chain, VH CDR1 and VL CDR2, VH CDR1 and VL CDR3, VH CDR2 and VL CDR1, VH CDR2 and VL CDR2, VH CDR2 and VL CDR3, VH CDR3 and VHCDR1, VH CDR3 and VL CDR2, VH CDR3 and VL CDR3, or their any combination, or described antibody is comprised of them.
Coding is corresponding to the nucleic acid molecule of anti-Familial Acute Myelogenous Leukemia relative new gene (FAMLF) antibody of Xenomouse system source antibody
The present invention also provide code book invention antibody (comprise contain its antibody fragment or variant or consisting of molecule) nucleic acid molecule, it is generally separated.The following antibody of nucleic acid molecule encoding of the present invention (comprise contain its antibody fragment or variant or consisting of molecule), the VII territory of the aminoacid sequence that described antibody comprises any VH territory with the expressed heavy chain of at least one clone and there is the amino acid whose VL territory of the light chain of expression of cell lines shown at least one table 2, or formed by them.The following antibody of nucleic acid molecule encoding of the present invention (comprise contain its antibody fragment or variant or consisting of molecule), the VH territory of the aminoacid sequence that described antibody comprises any VH territory with the expressed heavy chain of at least one clone or there is the amino acid whose VL territory of the light chain of expression of cell lines shown at least one table 2, or formed by them.
The present invention also provide the variant (comprising derivative) that comprises antibody molecule described herein (for example VH territory and/or VL territory) or consisting of antibody, wherein this antibody mediated immunity is specifically in conjunction with Familial Acute Myelogenous Leukemia relative new gene (FAMLF) or its fragment or variant.Standard technique well known by persons skilled in the art can for example cause the site-directed mutagenesis of amino acid replacement and the mutagenesis of PCR mediation for sudden change being introduced in the nucleotide sequence of code book invention molecule, being comprised.Preferably, variant (comprising derivative) coding is less than 50 amino acid replacements, be less than 40 amino acid replacements, be less than 30 amino acid replacements, be less than 25 amino acid replacements, be less than 20 amino acid replacements, be less than 15 amino acid replacements, be less than 10 amino acid replacements, be less than 5 amino acid replacements, be less than 4 amino acid replacements, be less than 3 amino acid replacements or be less than 2 amino acid replacements (with respect to reference to VH territory, be VH CDR1, VH CDR2, VH CDR3, VL territory, i.e. VL CDR1, VL CDR2 or VL CDR3)." conserved amino acid substitutes " refers to amino-acid residue is replaced by the amino-acid residue having with the side chain of similar electric charge.There is the amino-acid residue family existing definition in the prior art with the side chain of similar electric charge.
These families comprise and have basic side chain (Methionin for example, arginine, Histidine), acid side-chain (aspartic acid for example, L-glutamic acid), uncharged polar side chain (glycine for example, l-asparagine, glutamine, Serine, Threonine, tyrosine, halfcystine), non-polar sidechain (L-Ala for example, α-amino-isovaleric acid, leucine, Isoleucine, proline(Pro), phenylalanine, methionine(Met), tryptophane), D branched building block (Threonine for example, α-amino-isovaleric acid, Isoleucine) and aromatic side chain (tyrosine for example, phenylalanine, tryptophane, Histidine) amino acid. or, can be along all or part of encoding sequence, for example pass through saturation mutagenesis, introduce randomly sudden change, and can be with regard to the biologic activity screening institute mutant that obtains for example, mutant with evaluation retentive activity (in conjunction with Familial Acute Myelogenous Leukemia relative new gene (FAMLF) ability).
Immunologic opsonin ground in conjunction with the antibody of the present invention of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) polypeptide or its fragment or variant (comprise contain its antibody fragment or variant or consisting of molecule), comprise following nucleotide sequence coded aminoacid sequence or consisting of, described nucleotide sequence can with the nucleotide sequence hybridization that is complementary to a kind of VH of one or more expression of cell lines or the encoding sequence in VL territory, the condition of described hybridization is stringent condition, for example, with the membrane-bound DNA of filter hybridization at approximately 45 ℃ in 6 * sodium chloride/sodium citrate (SSC), in 0.2 * SSC/0.1%SDS, at about 50-65 ℃, do afterwards one or repeatedly washing, height stringent condition, for example with filter membrane-bound nucleic acid in 6 * SSC at approximately 45 ℃ hybridization, in 0.1 * SSC/0.2%SDS, at approximately 68 ℃, do afterwards one or repeatedly washing, or other tight hybridization conditions well known by persons skilled in the art is (referring to for example Ausubel, the volume such as F.M., 1989, Current Protocols in Molecular Biology, the 1st volume, Green Publishing Associates, Inc., and John Wiley & Sons, Inc., New York, 6.3.1-6.3.6 and 2.10.3 page).The nucleic acid molecule of these antibody of encoding is also included within the present invention.
As well known in the art, there is the polypeptide of similar aminoacid sequence or its fragment or variant and usually there is similar structure and many identical biologic activity.Therefore, immunologic opsonin ground is in conjunction with the antibody of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) polypeptide or Familial Acute Myelogenous Leukemia relative new gene (FAMLF) polypeptide fragment or variant (comprising the molecule that contains its antibody fragment or variant or be comprised of them), comprise have following aminoacid sequence VH territory or consisting of, the aminoacid sequence in the VH territory of the heavy chain that listed at least one clone of described aminoacid sequence and table 2 is expressed has at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% consistence.
Immunologic opsonin ground is in conjunction with Familial Acute Myelogenous Leukemia relative new gene (FAMLF) polypeptide or the fragment of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) polypeptide or the antibody of variant (comprising the molecule that contains its antibody fragment or variant or be comprised of them), comprise have following aminoacid sequence VL territory or consisting of, the aminoacid sequence in the VL territory of the light chain that described aminoacid sequence and at least one clone are expressed has at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% consistence.
The polynucleotide of encoding antibody
Antibody of the present invention (comprising antibody fragment or variant) can be prepared by any currently known methods in this area.For example, be to be understood that according to antibody of the present invention and can in the clone of non-hybridoma cell line, express.For example, can use the coding cDNA of specific antibodies or the sequence of genomic clone transform suitable Mammals or nonmammalian host cell or prepare phage display library.In addition, polypeptide antibody of the present invention can be synthesized or be produced by use recombinant expression system by chemical process.
An approach of preparation antibody of the present invention is VH and/or the VL territory that clone is any or multiple hybridoma cell line is expressed.For from the separated VH of these hybridoma cell lines and VL territory, can use the PCR primer that comprises VH or VL nucleotide sequence from separation, from total RNA of hybridoma cell line, increase VH and the VL sequence of expression.Then can use carrier, the carrier (this sudden change end can be added on the many archaeal dna polymerases that react for PCR the single adenosine acid mutation end complementation of PCR product 5 ' and 3 ' end) for example with the PCR product cloning site being formed by the 5 ' and 3 ' single T Nucleotide overhang, clone PCR products.Then can use ordinary method known in the art to this VH and the order-checking of VL territory.
Clone's VH and VL gene can be placed in to one or more suitable expression vectors.As non-limitative example, can use this VH of PCR primer amplification or the VL territory of the flanking sequence that comprises VH or VL nucleotide sequence, restriction site and protection restriction site.Utilize clone technology well known by persons skilled in the art, the VH territory of this pcr amplification can be cloned into the carrier of expressing suitable constant region for immunoglobulin (for example, respectively for human IgG1 or the IgG4 constant region in VH territory, and for people κ or the λ constant region in κ and λ VL territory).The carrier of preferably, expressing this VH or VL territory comprises and be applicable to the promotor that instructs this heavy chain and light chain to express in selected expression system; Secretion signal; Cloning site for immune globulin variable region, constant region for immunoglobulin; With selective marker as Liu Suanyan NEOMYCIN SULPHATE.This VH and VL territory can also be cloned in the single carrier of expressing necessary constant region.Then, use technology well known by persons skilled in the art (to see such as Guo etc., J.Clin.Endoctinol.Metab.82:925-31 (1997), with Ames etc., J.Immunol.Methods 184:177-86 (1995), they are intactly incorporated to herein as a reference), heavy chain is changed to carrier (conversion vector) and light chain conversion carrier cotransfection and to clone, to produce, express full length antibody as the stable or instantaneous clone of IgG.
The present invention also provides the polynucleotide of the nucleotide sequence that comprises code book invention polypeptide and its fragment.The present invention is also included in the polynucleotide of (for example defined) under tight or lower tight hybridization conditions and the multi-nucleotide hybrid of the following antibody of coding above, wherein preferably described antibody be specifically in conjunction with the antibody of polypeptide of the present invention, preferably in conjunction with thering is the polypeptide of aminoacid sequence of sequence < bis-> or the antibody of the polypeptide of preservation clones coding.
Determining of the acquisition of these polynucleotide and the nucleotide sequence of these polynucleotide can realize by any currently known methods in this area.For example, if the nucleotide sequence of antibody is known, can be from the polynucleotide of this antibody of oligonucleotide assembling coding of chemosynthesis (for example, Kutmeier etc., the method that BioTechniques 17:242 (1994) describes), cylinder, this comprises the overlapping oligonucleotide of the part of the synthetic sequence that contains this antibody of encoding, these oligonucleotide are annealed and connected, the oligonucleotide then connecting by pcr amplification.
Or, can prepare from the nucleic acid of appropriate sources the polynucleotide of encoding antibody.If can not obtain containing the clone of nucleic acid of specific antibodies of encoding, but the sequence of this antibody molecule is known, encoding the nucleic acid of immunoglobulin (Ig) can chemosynthesis, or use can with the synthetic primer of this sequence 3 ' and the hybridization of 5 ' end by pcr amplification from appropriate sources (for example from produce from or separated any tissue or cell of certainly expressing this antibody, as expressed antibody cDNA library or cDNA library or the nucleic acid of the hybridoma of antibody of the present invention through selection, preferred poly A+RNA) obtain, or by using the special oligonucleotide probe for specific gene sequence, for example from the cDNA of this antibody of cDNA library identification code, clone.Then, use any method of knowing in this area that the amplification of nucleic acid producing by PCR is cloned in reproducible cloning vector.
Once measure nucleotide sequence and the corresponding aminoacid sequence of this antibody, can use this area to be used for operating the well-known process of nucleotide sequence, as recombinant DNA technology, site-directed mutagenesis, the nucleotide sequence of these antibody of operation such as PCR (is shown in such as being described in the technology in Publication about Document: Sambrook etc., 1990, molecular cloning laboratory manual (Molecular Cloning, Alaboratory Manual) the 3rd edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, the volume such as NY and Ausubel, 1998, Current Pro ' tocols in M01ecular Bi010gy, John wiley & sons, NY, both are all intactly incorporated to herein as a reference), the antibody with preparation with different aminoacids sequence, for example produce amino acid replacement, disappearance and/or insertion.
Can be by well known method, for example by the known amino acid sequence comparison with other heavy chain and variable region of light chain to determine sequence hypervariable region, the aminoacid sequence that checks heavy chain and/or variable region of light chain is identified the sequence of complementary determining region (CDR).Use conventional recombinant DNA technology, one or more CDR can be inserted in framework region, for example, insert in people framework region with humanization non-human antibody, referring to above description.Framework region can be naturally occurring or total framework region, preferably people framework region (referring to such as Claothia etc., the people framework region that J.Mol.Biol.278:457-479 (1998) lists).The antibody of the polynucleotide encoding specific combination polypeptide of the present invention of preferably preparing by built up construction district and CDR.Preferably, as discussed above, can in framework region, carry out one or more amino acid replacements, and preferred amino acid substitutes the combination that improves antibody and its antigen.In addition, can use these methods to cause to participate in amino acid replacement or the disappearance of one or more variable region cysteine residues of intrachain disulfide bond, to produce the antibody molecule of the one or more intrachain disulfide bonds of disappearance.Other change of these polynucleotide is also included within the present invention and belongs to those skilled in the art's scope.
For some application, the external affinity maturation of antibody of the present invention for example, what come in handy is that the heavy chain of one or more antibody of the present invention and light chain VH and VL territory are expressed as to single-chain antibody or Fab fragment in phage display library.For example, can use phage display library, the coding VH of one or more antibody of the present invention and the cDNA in VL territory are expressed with all possible combination, thereby allow to select with preferably for example, in conjunction with feature (affinity improving or the shutdown rate of raising) the VH/VL combination in conjunction with Familial Acute Myelogenous Leukemia relative new gene (FAMLF) polypeptide.In addition, especially, the VH of VH and VL section---one or more antibody of the present invention and VL Yu CDR district, can suddenly change in vitro.VH and the VL territory expression in phage display library with the CDR of " sudden change " makes to select with preferably for example, in conjunction with feature (affinity improving or the shutdown rate of raising) the VH/VL combination in conjunction with Familial Acute Myelogenous Leukemia relative new gene (FAMLF) polypeptide.
In phage display method, functional antibodies domain views is on the surface of the phage particle with their polynucleotide sequence of coding.Particularly, for example, from animal cDNA library (cDNA library of people or mouse lymphoid tissue) or synthetic cDNA library amplification coding VH and the DNA sequence dna in VL territory.By PCR, through scFv joint, the DNA in coding VH and VL territory is coupled together and is for example cloned into, in phagemid vector (PCANTAB 6 or pComb 3 HSS).By electroporation, use this carrier to transform intestinal bacteria, and infect this intestinal bacteria with helper phage.For the phage of these methods typically filobactivirus as fd and M13.This VH and VL territory conventionally with phage gene III or gene VIII restructuring fusion.Can use antigen, the for example antigen of mark or the antigen of being combined or being caught by it with solid surface or pearl, screening or the phage of identifying the antigen binding domain of expressing binding purposes antigen (for example Familial Acute Myelogenous Leukemia relative new gene (FAMLF) polypeptide or its fragment).Can include but not limited to for the preparation of the example of the phage display method of antibody of the present invention to be disclosed in as those in Publication about Document: Brinkman etc., J.Immunol.Methods 182:41-50 (1995); Ames etc.
Can use by the gene with the mouse antibodies molecule of suitable antigen-specific is developed to technology (Morrison etc., the Proc.Natl.Acad.Sci.81:851-855 (1984) for the preparation of " chimeric antibody " together with having the gene splicing of human antibody molecules of suitable biologic activity; Neuberger etc., Nature 312:604-608 (1984); Takeda etc., Nature 314:452-454 (1985)).As discussed above, chimeric antibody is the molecule with the different piece that derives from different animals species, for example, have and derive from the variable region of mouse mAb and those antibody of human normal immunoglobulin constant region, as humanized antibody.
Or, can adopt technology (United States Patent (USP) 4,946,778 described for the preparation of single-chain antibody; Bird, Science242:423-42 (1988); Huston etc., Proc.Natl.Acad.Sci.USA 85:5879-5883 (1988); With Ward etc., Nature 334:544-54 (1989)) to prepare single-chain antibody.By heavy chain and light chain Fv district fragment are connect and cause single chain polypeptide to form single-chain antibody through amino acid bridging.Also can use the technology (Skerra etc., Science 242:1038-1041 (1988)) of assembling function Fv fragment in large intestine bar mattress.
The preparation method of FAMLF monoclonal antibody specific is provided, antibody of the present invention can be prepared by any method for the synthesis of antibody known in the art, especially chemosynthesis, intracellular immunity (being intrabody technology) or preferably recombination and expression techniques.The method of Dispersal risk includes but not limited to other method that hybridoma technology, EBV transform and discuss and the use of recombinant DNA technology herein, antibody of the present invention or its fragment, derivative, sees following discussion.Once by animal, chemosynthesis or recombinant expressed generation after antibody molecule of the present invention, can to it, carry out purifying by any method for purifying immunoglobulin (Ig) known in the art, the example of these methods have chromatography (for example ion-exchange, affine, in particular for the affinity chromatography of the specific antigen after protein purification A, and size exclusion column chromatography), centrifugal, difference dissolves or any other standard technique for protein purification.In addition, antibody of the present invention or its fragment can merge and be beneficial to purifying with allogeneic polypeptide sequence described herein or known in the art.FAMLF specific antibody provided by the invention can be for immunology correlation analysis, treatment technology.These technology are including, but not limited to Western Bloting analysis, immunoturbidimetry, Enzyme Linked Immunoadsorbent Assay (ELISA), immunohistochemical methods, flow cytometry, laser co-focusing immunoassay, co-immunoprecipitation analysis.
The invention still further relates to the expression vector that the variant of FAMLF monoclonal antibody specific or the recombinant expressed requirement of analogue (for example heavy chain of antibody of the present invention or light chain or single-chain antibody of the present invention) build the polynucleotide that contain this antibody of encoding.Once obtain after code book invention antibody molecule or heavy chain of antibody or light chain or their the part polynucleotide of (preferably containing heavy chain or variable region of light chain), can use technology well known in the art for the preparation of the carrier that produces this antibody molecule by recombinant DNA technology.Therefore the polynucleotide that, this paper describes the nucleotide sequence that contains encoding antibody by expression are prepared method of protein.Method well known to those skilled in the art can be for building the expression vector that contains antibody coding sequence and suitably transcribe and translate control signal.These methods comprise for example interior genetic recombination of extracorporeal recombinant DNA technology, synthetic technology and body.Therefore, the invention provides the replicable vector that comprises nucleotide sequence that be operably connected with promotor, code book invention antibody molecule or its heavy chain or light chain or heavy chain or variable region of light chain.These carriers can comprise the nucleotide sequence of encoding antibody molecule constant region, and the variable region of antibody can be cloned in this carrier for expressing complete heavy chain or light chain.
The present invention includes by recombination form and merge or puted together (comprising covalency and non-covalent puting together) by chemical mode the antibody that polypeptide of the present invention (or its part, preferably at least 10 of this polypeptide, 20,30,40,50,60,70 or 80 amino acid) produces fusion rotein.This fusion is not necessarily direct, also can be undertaken by joint sequence.Antibody can the special antigen for non-polypeptide of the present invention (or its part, preferably at least 10 of this polypeptide, 20,30,40.50,60,70 or 80 amino acid).For example, can be by polypeptide of the present invention and the special antibody for specific cells surface receptor are merged or puted together, and use in this antibody body or externally by polypeptide target of the present invention, to specific cells, be.Polypeptide of the present invention and/or antibody (comprising its fragment or variant) can and the N of heterologous protein (for example immunoglobulin Fc polypeptide or human serum albumin polypeptide) or C-terminal merge.Antibody of the present invention can also and albumin (including but not limited to recombination human serum albumin) merge, obtain chimeric polyeptides.The polynucleotide of code book invention fusion rotein are also included within the present invention.These fusion roteins can for example be conducive to purifying and can increase Half-life in vivo.The antibody that merges with polypeptide of the present invention or put together also can adopt methods known in the art in vitroimmunoassay and purification process.
The present invention also comprises the composition that comprises the polypeptide of the present invention that merges with the antibody domain of non-variable region or put together.For example, polypeptide of the present invention can or be puted together with antibody Fc district or its meromixis.The antibody moiety merging with polypeptide of the present invention can comprise the arbitrary combination of constant region, hinge area, CH1 territory, CH2 territory and CH3 territory or all territories or its part.These polypeptide can also merge or put together formation polymer with above-mentioned antibody moiety.For example, and the Fc part that merges of polypeptide of the present invention can form dimer by the disulfide linkage between two Fc parts.More much higher aggressiveness form can be by preparing the meromixis of this polypeptide and IgA and IgM.The method that polypeptide of the present invention and antibody moiety is merged or put together is known in the art.
As discussed above, can be by using means known in the art and above-mentioned antibody moiety to merge or puting together to increase the Half-life in vivo of this polypeptide or for immunoassay corresponding to the polypeptide of polypeptide, polypeptide fragment or the variant of preservation clones coding polypeptide.And the polypeptide of cloning coded polypeptide corresponding to preservation can merge or put together with above-mentioned antibody moiety and is beneficial to purifying.The polypeptide of the present invention that merges with the antibody with two body structures (due to IgG) that disulfide linkage is connected or put together also can be than simple monomeric secreted protein or protein fragments in combination with neutralize aspect other molecule more effective.In many cases, the Fc part in fusion rotein is useful in treatment and diagnosis, therefore can cause the pharmacokinetic property for example improving.Or, after fused protein expression, detection and purifying, may expect to remove this Fc part.For example, when fusion rotein is used as immunizing antigen, this Fc part may hinder treatment and diagnosis.On drug discovery, for example for high-throughput screen and analyze to identify the antagonist of hIL-5, by human protein hIL-5 and Fc meromixis.
And, antibody of the present invention or its fragment and flag sequence can be merged as being beneficial to the peptide of purifying.This marker amino acid sequence is six Histidine peptides, this label for example providing in pQE carrier (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91311), and especially in them, many can business purchase, obtains.Six Histidines make purified fusion protein easily.For other useful peptide tag of purifying, include but not limited to " HA " label, its epi-position corresponding to influenza hemagglutinin protein (Wilson etc., Cell 37:767 (1984)), and " flag " label.
The present invention also comprises antibody or its fragment that territory diagnosis or therapeutical agent are puted together.These antibody can be in diagnosis for for example monitoring the generation of tumour or progress as a part for clinical trial program, for example, to determine the efficiency of given therapeutics.Can be by by this antibody and the favourable detection of detectable substance coupling.The example of detectable substance comprises the active paramagnetic metal ion of various enzymes, prothetic group, fluorescent substance, luminophore, noclilucence material, radioactivity material, the positron emitting metal that uses multiple positron emission tomography and non-radioactive.Detectable substance can be directly with antibody (or its fragment) or indirectly for example, use art technology and antibody coupling or put together by intermediate (joint known in the art).The example of suitable enzyme comprises horseradish peroxidase, alkaline phosphatase, D tilactase or acetylcholinesterase; The example of suitable prothetic group mixture comprises Streptavidin/vitamin H and avidin/biotin; Suitably the example of fluorescent substance comprises Umbelliferone, luciferin, Fluorescein Isothiocyanate, rhodamine, dichlorotriazine base amine luciferin, dansyl chloride or phycoerythrobilin; The example of luminophore comprises luminol,3-aminophthalic acid cyclic hydrazide; The example of noclilucence material comprises luciferase, luciferin, aequorin; The example of suitable radioactivity material comprise iodine, carbon ( 14c), sulphur etc.
Familial Acute Myelogenous Leukemia relative new gene of the present invention (FAMLF) and/or Familial Acute Myelogenous Leukemia relative new gene (FAMLF) SV polypeptide with for polypeptide coupling radiation metal ion (is included but not limited to 111in, 177lu, 90y, 153sm, 166ho) useful macrocyclic chelants connects.This macrocyclic chelants is Isosorbide-5-Nitrae, 7,10-tetraazacyclododecanand-N, N ', N ", N " '-tetraacethyl (DOTA).DOTA is connected by linkers with FAMLF of the present invention and/or FAMLF SV polypeptide.Being used for the example of the linkers of DOTA and polypeptide coupling is that this area is conventionally known.In addition, United States Patent (USP) 5,652,361 and 5,756,065 discloses the sequestrant that can put together with antibody and their preparation and application, hereby they is intactly incorporated herein by reference.Although United States Patent (USP) 5,652,361 and 5,756,065 concentrates on sequestrant and antibody is puted together, and those skilled in the art can easily change wherein disclosed method and make sequestrant and other conjugation of polypeptides.
Antibody conjugates of the present invention can be for modifying the biologically of appointment, and therapeutical agent or drug moiety should not be construed as and be limited to classical chemotherapeutic.For example, drug moiety can be protein or the polypeptide with expectation biologic activity.These protein comprise that for example toxin is as toxalbumin, ricin A, false unit cell mattress extracellular toxin or diphtheria toxin; For example tumour necrosis factor, interferon-alpha, interferon-β, nerve growth factor, Thr6 PDGF BB, tissue plasminogen activator, apoptosis agent are as TNF-q, TNF-β, AIM I, AIM II, FasL for protein, and VEGI, thromobotic agent or anti-angiogenic agent are as angiostatin or endostatin; Or biological response modifier for example lymphokine, interleukin-11 (" IL-I "), interleukin-22 (" IL-2 "), interleukin 6 (" IL-6 "), rHuGM-CSF (" GM-CSF "), granulocyte colony-stimulating factor (" G-CSF ") or other somatomedin.
Can also make antibody be connected with solid support, this is particularly useful for immunoassay or purification of target antigen.This solid support includes but not limited to glass, Mierocrystalline cellulose, polyacrylamide, nylon, poly-the third ethene, polyethylene chlorine or polypropylene.
These treatment parts are known with the technology of antibody coupling, see such as Arnon etc., the monoclonal antibody of the immunotargeting of medicine " in the cancer therapy for ", < < monoclonal antibody and cancer therapy > > (Monoclonal Antiboides and Cancer Therapy), Reisfeld etc. (volume), pp243-56 (Alan R.Liss, Inc.1985), Hellstrom etc., " for the antibody of drug delivery ", the drug delivery > > (Controlled Drug Delivery) (the 2nd edition) that < < is controlled, Robinson etc. (volume) pp623-53 (Marcel Dekker, Inc.1987), Thorpe, " antibody carrier of cytotoxic agent in cancer therapy: summary ", < < monoclonal antibody ' 84: biology and clinical application > > (Monoclonal Antibodies ' 84:Biological and Clinical Applications), Pinchera etc. (volume), pp 475-506 (1985): " analysis of radio-labeled Antybody therapy purposes in cancer therapy, result, and prospect ", < < is for the monoclonal antibody > > (Monoclonal Antibodies for Cancer Detection and Therapy) of cancer detection and treatment, Baldwin etc. (volume), pp 303-16 (Academic Press 1985), with Thorpe etc., " antibody-toxin conjugate cut standby and cytotoxicity ", Immunol.Rev.62:119-58 (1982).
Or, antibody and two anti-puting together can be formed to the assorted conjugate (heteroconjugate) of antibody, referring to the United States Patent (USP) 4,676,980 of Segal, it is intactly incorporated herein by reference.
Can use separately during as therapeutical agent with the antibody for the treatment of part coupling or not coupling or associational cells virulence factor and/or cytokine together with use.
Antibody of the present invention can be for carrying out immunophenotype somatotype to clone and biological sample.The translation product of gene of the present invention can be used as cell-specific mark, or is more specifically used as the cell marking of differential expression when particular cell types growth and/or ripe different steps.The monoclonal antibody of the combination of pointing to defined epitope or showing will allow screening to express the cell mass of this mark.When using monoclonal antibody screening to express the cell mass of this mark, multiple technologies can be used, comprise that " elutriation " and Flow Cytometry that antibody that magnetic resolution, use and the solid substrate (being plate) that use the coated magnetic bead of antibody to carry out adheres to carries out (be shown in for example United States Patent (USP) 5,985,660; With Morrison etc., Cell, 96:737-49 (1999)).
These technology make to select specific cells colony, those that for example can for example, find in hematologic malignancies (the remaining disease (minimal residual disease) of the Minimum Residual of acute leukemic patient is (MRD)), and " non-autologous " cell in graft is to prevent graft versus host disease (GVHD).For example, or these technology allow screening can experience hemopoietic stem cell and the ancester cell of propagation and/or differentiation, those that can find in human cord blood.
Antibody of the present invention can be analyzed by any currently known methods in this area the combination of its immunologic opsonin.Operable immunoassay includes but not limited to use competitiveness and the noncompetitive analytical system of following technology, the example of described technology has BIAcore to analyze, FACS (fluorescence activated cell sorting art) analyzes, immunofluorescence, immunocytochemical method, western trace, radioimmunoassay, ELISA (enzyme-linked immunosorbent assay), " sandwich " immunoassay, immuno-precipitation, precipitin reaction, GDP reaction, immunodiffusion(ID) is analyzed, agglutination test, complement fixation test (CFT), immunoradiometric assay(IRMA), fluorescence immunoassay, a-protein immunoassay, but this is only several examples of enumerating.These mensuration are conventional and are well known in the artly (to see such as Ausubel etc. and compile 1994, Current Protocols in Molecular Biology, Vol.1, John Wiley & Sons, Inc., New York, it is intactly incorporated to herein as a reference).Exemplary immunization assay method is briefly described below (but not being intended to be construed as limiting).
Immunoprecipitation working method generally comprises (is for example adding protein phosphatase and/or proteinase inhibitor, EDTA, PMSF, AKOLINE, vanadic acid sodium) lysis buffer is as RIPA damping fluid (1%NP-40 or Triton X-100, 1% Sodium desoxycholate, 0.1% SDS, 0.15M NaCl, 0.01M sodium phosphate (pH 7.2), lysing cell group 1%Trasylol), to cell lysate, add object antibody, in 4 ℃, hatch for some time (for example 1-4 hour), to cell lysate, add albumin A and/or Protein G Sepharose pearl, hatch approximately 1 hour or longer for 4 ℃, in lysis buffer, wash these pearls, and these pearls are reappeared and are suspended in SDS/ sample buffer.The ability of object antibody mediated immunity precipitation specific antigen can be evaluated by for example Western engram analysis.Those skilled in the art should instruct can modified increase antibody and the combination of antigen reduce the parameter (for example with sepharose pearl in advance clean cell lysate) of background.For the further discussion of immunoprecipitation working method, referring to such as Ausubel etc., 1994, Current Protocols in Molecular Biology, V01.1, John Wiley & Sons, Inc., New York, 10.16.1.
Western engram analysis generally comprises prepares protein sample, at upper this protein sample of electrophoresis of polyacrylamide gel (for example, according to the 8%-20% SDS-PAGE of the molecular weight of antigen), protein sample is transferred to film as nitrocellulose from polyacrylamide gel, on PVDF or nylon membrane, for example, in sealing damping fluid (PBS with 3%BSA or skimmed milk) closing membrane, for example, in lavation buffer solution (PBS-Tween 20) washing film, use is diluted in primary antibodie (object antibody) closing membrane in sealing damping fluid, in lavation buffer solution, wash film, use for example, with enzyme substrates (horseradish peroxidase or alkaline phosphatase) or radioactivity molecule (for example 32p or 125i) two anti-(antibody of identification primary antibodie, as anti-human antibody) closing membrane of puting together washs film in lavation buffer solution, and the existence of detectable antigens.Those skilled in the art can change guidance the parameter that increases detection signal and reduce background noise.For the further discussion of western trace working method, see such as (volumes) 1994 such as Ausubel CurrentProtocols in Mulecular Biology, V01.1, John Wiley & Sons, Inc., New York, 10.8.1.
ELISA comprises and prepares antigen, hole with these antigen coated 96 hole microtiter plates, in hole, add the object antibody of for example, puting together as enzyme substrates (horseradish peroxidase or alkaline phosphatase) with detectable compounds and hatch for some time the existence of detectable antigens.In ELISA, object antibody needn't be puted together with detectable compounds; On the contrary, can be to two anti-(the identifying purpose antibody) that add in hole with detectable compounds coupling.And, substitute and use antigen coated hole, can be coated with hole with antibody.In the case, can add object antigen in coated hole after, add with detectable compounds put together two anti-.Those skilled in the art can change to increase the parameter of detection signal and other variant of ELISA known in the art by instructing.For the further discussion of ELISA, referring to (volumes) 1994 such as Ausubel, Current Protocols in Molecular Biology, V01.1, Jolln Wiley & Sons, Inc., New York, 11.2.1.
The binding affinity of antibody and antigen and the shutdown rate of antibody-AI can be measured by competitive binding analysis.An example of competitive binding analysis is radioimmunoassay, and it is included under the unlabelled antigen that has increasing amount and makes labelled antigen (for example 3h or 125and the detection antibody of being combined with labelled antigen I) and object antibody incubation.Object antibody can be determined from the data of Scatchard mapping analysis to the affinity of Familial Acute Myelogenous Leukemia relative new gene (FAMLF) and in conjunction with shutdown rate.Also can use radioimmunoassay to determine the competition anti-with two.In the case, by Familial Acute Myelogenous Leukemia relative new gene (FAMLF) and coupling tagged compound (for example 3h or 125the compound of I mark) object antibody is hatched under the unmarked two anti-existence of increasing amount.This type of competitive assay between two kinds of antibody also can be for determining that two kinds of antibody are in conjunction with identical or different epi-positions.
BIAcore dynamic analysis is used to determine the combination opening and closing speed of antibody (comprising antibody fragment or its variant) and Familial Acute Myelogenous Leukemia relative new gene (FAMLF) or Familial Acute Myelogenous Leukemia relative new gene (FAMLF) fragment.BIAcore dynamic analysis comprises to be analyzed the chips incorporate of antibody and surface having fixed Familial Acute Myelogenous Leukemia relative new gene (FAMLF) and dissociates.
Other side of the present invention, because technology herein discloses, is apparent to those skilled in the art.
Beneficial effect of the present invention: the discovery of FAMLF full length gene cDNA sequence of the present invention, complete opening code-reading frame, the clone of FAMLF full length gene cDNA, the specific antibody of human gene FAMLF are developed the discovery of immune peptide epi-position used and the invention of FAMLF protein specific antibody, and all these work are that the research and development of the antibody of leukemia specific gene diagnosis from now on, protein chip, gene chip, genomic medicine lay the foundation.This project research, for developing leukemia new drug, improves leukemia diagnosis accuracy rate and result for the treatment of, and improving the leukemic curative ratio in Fujian Province has important effect, has potential great social and economic effects.The present invention contributes to in-depth explanation leukemia that the Molecular Biology Mechanism of development occurs, for gene diagnosis and the gene therapy of leukemia and other malignant tumours lays the foundation.This research tool has the following advantages:
1, novelty: there is not yet the report of the acute myeloid leukemia family (seeing Figure 20) that sickness rate is so high, scale is so large at present both at home and abroad, the domestic report that there is not yet Familial Acute Myelogenous Leukemia relative new gene clone.
2, creativeness: the cDNA total length that clones Familial Acute Myelogenous Leukemia relative new gene, successfully dope the opening code-reading frame of this new gene, invent this gene differential expression primer, invent the specific monoclonal antibody for this new gene, and verifying that by Western Bloting this genetic expression opening code-reading frame used is consistent with the opening code-reading frame of prediction, application single stage method RT-PCR and Western Bloting find the high expression level low expression in normal people in leukaemic of this gene.
3, practicality: cloning this new full length gene cDNA sequence, determining opening code-reading frame and invent on the basis of this analysis of gene differential expression primer, protein-specific antibody, can further design the target site of acute myeloid leukemia gene therapy, develop the gene diagnosis kit, gene chip, the protein chip that comprise this gene, and promote the application clinically of the expressed protein-specific antibody of this gene.
Accompanying drawing explanation
Fig. 1 is the cDNA sequence chart of FAMLF gene of the present invention.
Fig. 2 is the coding protein sequence chart of FAMLF gene FAMLF of the present invention.
Fig. 3 is EST zywB-87 of the present invention (GenBank number of registration: CV973101) PCR detects electrophorogram.
1 EST zywB-87 PCR detected result 2 negative controls
Visible have a clear single band between 500-750bp, and negative control is without band
Fig. 4 is the first round 5 ' RACE PCR electrophorogram of the present invention.
M DNAMarker 2,000 1 first round 5 ' RACE PCR 2 negative controls
Fig. 5 of the present invention second takes turns nido 5 ' RACE PCR electrophorogram.
M DNAMarker 2,000 1 second takes turns nido 5 ' RACE PCR 2 negative controls
Fig. 6 is 3 ' RACE PCR electrophorogram of the present invention.
M DNAMarker 6,000 13 ' RACE PCR, 2 negative controls
Fig. 7 is that ORF of the present invention analyzes socket figure.
Fig. 8 is NCBI/Blastn retrieval figure of the present invention.
Fig. 9 is the new gene electric daughter chromosome of FAMLF of the present invention location map.
Figure 10 is protein hydrophobic skeleton diagram of the present invention.
Figure 11 is protein function domain analyses result of the present invention one figure.
Figure 12 is protein function domain analyses result of the present invention two figure.
Figure 13 is the expression electrophorogram of FAMLF gene of the present invention between part acute myeloid leukemia patient and normal people.
The outer normal control of normal control 8-9 family in the outer acute myeloid leukemia patient 6-7 family of Patients with Acute Myeloid Leukemia 3-5 family in 1 DNA maker (DL2000) 2 familys
Internal reference segment is 251bp, and object segment is 175bp, and result shows that the expression of FAMLF gene in patient is apparently higher than normal people
Figure 14 is that FAMLF of the present invention is at the expression electrophorogram of U937, Raj and Ca46 cell strain.
M DNAMarker DL 2,000 1 U937 cell strain 2 Raj cell strain 3 Ca46 cell strain 4 Shi-1 cell strains
Internal reference segment is that 251bp object segment is that 522bp result shows that FAMLF all has compared with high expression level in above-mentioned cell strain
Figure 15 is that FAMLF of the present invention is at the expression electrophorogram of acute monocytic leukemia, melanoma, liver cancer, Hela cell strain.
M DNAMarker DL 2,000 1 positive controls (patient OneStep RT-PCR amplification)
2 Acute Monocytic Leukemia Cell Line strain 3 melanoma cell strain 4 hepatoma cell strains
5 Hela cell strain internal reference segments are that 251bp object segment is 522bp
Result shows that FAMLF expresses in Acute Monocytic Leukemia Cell Line strain, in melanochrome, hepatoma cell strain, does not express
Figure 16 is the prepared monoclonal antibody figure for FAMLF of Western Bloting checking of the present invention.
This antibody of the 1st, 33-1-3R3 (PA), diluting 250 times 2 is this antibody of 33-1-3R3 * (PA), thinning ratio be 50 wherein GAPDH antibody and Actin antibody as positive control
Figure 17 is that Western Bloting analyzes the expression figure of FAMLF in leukemia NB4, U937, K562, myeloma cell line U266, CEM, leukemia H160 cell, lymphoma cell strain CA46, Jurkat cell strain.
Figure 18 is that Western Bloting analyzes the expression figure (5 positive contrasts, 1,2,3,4,6 be clinical leukemia patient) of FAMLF in leukemia patient
Figure 19 is that Western Bloting of the present invention analyzes the expression figure of FAMLF in normal people.(1 positive contrast, 2,3,4,5,6 is normal people)
Figure 20 is Fujian Province of the present invention acute myeloid leukemia high density family family tree.
Embodiment
Below in conjunction with drawings and Examples, describe the present invention:
Should be understood that these embodiment are only not used in and limit the scope of the invention for the present invention is described.The experimental technique of unreceipted actual conditions in the following example, according to normal condition as people such as sanlbrook, molecular cloning: laboratory manual (New York:cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Embodiment 1: by sMART-RACE technology, clone FAMLF full length gene sequence
1) EST zywB-87 (GenBank number of registration: CV973101) sequence check and correction
1.1) by EST zywB-87 and genome alignment
Networking http:// genome.ucsc.edu/cgi-bin/hgBlat? command=starteST zywB-87 and human genomic sequence are compared, obtain following result:
Alignment?of?YourSeq?and?chr1：197136247-197173157
Click?on?links?in?the?frame?to?the?left?to?navigate?through?the?alignment.Matching?bases?in?cDNA?and?genomic?sequences?are?colored?blue?and?capitalized.Light?blue?bases?mark?the?boundaries?of?gap?s?in?either?sequence(often?splice?sites).
cDNA?YourSeq
acgcggggAC?AGGAGCAAGG?GATGTCTGAG?CACAAGTGGC?TGAGTTCCGA 50
GTGACTTTAT?GAAGCACTTT?CTACCTTCCT?CTCCGGCATG?AAAACAGGGA 100
TTCTGCACCT?GCATCATGGA?CAGTCTGGCA?AAAGCCTCTG?CTCTGCCTCC 150
GGGGACAAGA?AACTAGAGCA?AATAACCGcT?TTGAAATTAG?ATCCTGGCgA 200
AATTACCcAC?AATCAATGgt?ggaaactgaa?aggagaaTGA?TTTAAATCTT 250
CAATGACAGT?TGT
Aim sequence is positioned at karyomit(e) 197136247-197173157 section No. 1, and wherein the representative of capitalization sequence is correctly mated with genome, the representative of lowercase sequence and genome mispairing
1.2) according to genome alignment result, adopt primer-design software Oligo 6.0 design check and correction upstream primer F39, check and correction downstream primer R591:
Upstream primer F39:5 ' AGTGGCACCAAGATGCTTA 3 ',
Downstream primer R591:5 ' CCCTATGGATTGTTGAACTGG 3 ',
1.3) use the PrimeSTAR of TaKaRa company tMhS DNA Polymerase reagent, the PCR that concrete operations are carried out EST zywB-87 according to the protocol of the said firm detects, and get 5mlPCR product, 2% agarose electrophoresis, observations (the results are shown in Figure the electrophorogram of 3 zywB-87 gene), visible have a clear single band between 500-750bp, and negative control is without band, and all the other 45ul send Invitrogen company direct Sequencing.
1.4) EST zywB-87 PCR product direct Sequencing result
PCR product is through Invitrogen company direct Sequencing, and sequencing result is as follows:
1 CGAAGCGTCT?CATGGAAGCC?AGTCTCCTCT?AATGTGTATT
TTGGTGCCCT?GTCTGCTGGT
61 TCGCCTAAGT?GATGTGGCAT?ACATTTGATG?AAAGGACAGT
AAATGACATC?AATTATAAAA
121 GACATCTACT?AATGAGAGGA?AGAAGAGGAA?GAGAGAGAAA
TTGAAAAAAAGAATAAGAAA
181 TTCTCTGAAA?TGGAAACAGC?AAAGCACTTT?GATTGAACTA
AAAGAAATGA?CGTACCTTAA
241 TCATGCCCTA?ATTTTAGGGT?ACCACCAACC?AAGCTACTCA?CTCTTCTTTG
GAAAGATGAC
301 GTGTTTCTTC?AACTTCTGTA?CAACTGTCAT?TGAAGATTTA?AATCAATCTC
CCTTCAGTTT
361 CCATCATTGA?TTGTTGGTAA?TTTTGCCAGG?ATCTCTGTAC?AAAACAAAAC
AAAAAGATAT
421 TATGTGAAAC?TCAGGCCATG?CTGAGCAAAT?TAGCTGAAAT?TTATTTTTAT
CCTCTTATGG
481 GGATGTTTTC?CAGTTCAACA?ATCCATAGGGA
1.5) sequence EST zywB-87 proofreaies and correct result
By above sequencing result and genome sequence and the contrast of EST zywB-87 original series, find that the order-checking of EST zywB-87 original series has part mistake, correct sequence is as follows:
1 ACAGGAGCAA?GGGATGTCTG?AGCACAAGTG?GCTGAGTTCC
GAGTGACTTT?ATGAAGCACT
61 TTCTACCTTC?CTCTCCGGCA?TGAAAACAGG?GATTCTGCAC?CTGCATCATG
GACAGTCTGG
121 CAAAAGCCTC?TGCTCTGCCT?CCGGGGACAA?GAAACTAGAG
CAAATAACCG?TTTTGAAATT
181 AGATCCTGGC?AAAATTACCA?ACAATCAATG?ATGGAAACTG
AAGGGAGATT?GATTTAAATC
241 TTCAATGACA?GTTGT
2) utilize 5 of Clontech ' end RACE test kit to make 5 of FAMLF gene ' end RACE, and use primer-design software Oligo 6.0 according to EST zywB-87 sequences Design 5 ' the RACE primer of having proofreaied and correct.
2.1) 5 ' RACE primer
GSP1：5’AATCAATCTCCCTTCAGTTTCCATC?3’
NGSP1：5’TCTCCCTTCAGTTTCCATCA?3’
2.2) 5 ' RACE PCR electrophoresis result is shown in Fig. 4, Fig. 5
2.3) nido 5 ' RACE PCR product direct Sequencing result
Nido 5 ' RACE PCR product is through Invitrogen company direct Sequencing, and sequencing result is as follows:
1 TTTCAAACGG?TTATTTGCTC?TAGTTTCTTG?TCCCCGGAGG
CAGAGCAGAG?GCTTTTGCCA
181 AGCTGTACTA?TCTGCAGTTC?TCCCCGCGTA?CTCTGCGTTG?ATACCACTGC
TTGCCCTATA
241 GTGAGTCGTA?TTAGA
3) utilize 3 of Clontech ' end RACE test kit to make 3 of FAMLF gene ' end RACE, and use primer-design software Oligo 6.0 according to EST zywB-87 sequences Design 3 ' the RACE primer of having proofreaied and correct.
3.1) 3 ' RACE primer
GSP2：5’AAGCACTTTCTACCTTCCTCTC?3’
3.2) 3 ' RACE PCR electrophoresis result is shown in Fig. 6
3.3) 3 ' RACE PCR product direct Sequencing result
3 ' RACE PCR product is longer, and it is logical that reaction can not be surveyed, and through 4 continuous Warlking order-checkings, obtains its full length sequence as follows:
1 ATGCATCATG?GAAGTCTGGT?AAAAGCCTCT?GCTCTGCCTC
CGGGGACAAG?AAACTAGAGC
61 AAATAACCGT?TTTGAAATTA?GATCCTGGCA?AAATTACCAA?CAATCAATGA
TGGAAACTGA
601 TAACCAAACA?ACATACCTAT?GAAAATAGAT?CAGTAAGGCT
TTGAGAAACATTCTTAAGTA
661 AAATCTGTAA?AGCATCTTTG?CATTTTTTTT?CAAGAAAGAC?CTCCAGGTAA
ATGATGGCTT
2041 GTTCTGTAGT?TTTAACCAGA?ACAAAGGGAT?TACCCAGAAG
AAAAGAAGGT?AAGCTATTTC
2101 ATCAGTTTTG?GTGGAAATCA?GAAGTTTTTT?TTTCTATTAT?TAGCTTTGTA
TTCTTAAAAA
2161 AAAAAAAAAA?AAAAAAAAAA?AAAA
4) cDNA full length sequence splicing result
According to the est sequence of proofreading and correct, 5 '-RACE sequence, 3 '-RACE sequence, adopts DNAMAN software to carry out the splicing of cDNA full length sequence, and the cDNA sequence total length of splicing is as follows:
1 AGAACTGCAG?ATAGTACAGC?TTCCACAGGA?GCAAGGGATG
TCTGAGCACA?AGTGGCTGAG
61 TTCCGAGTGA?CTTTATGAAG?CACTTTCTAC?CTTCCTCTCC
GGCATGAAAA?CAGGGATTCT
121 GCACCTGCAT?CATGGACAGT?CTGGCAAAAG?CCTCTGCTCT
GCCTCCGGGG?ACAAGAAACT
1201?GGGAAGAAGA?CACTTCTGCG?TCTGACAGTG?AATCAGGCTC
CCAGTTTTGA?AGATGTGCTG
1261?TAGGTAGTTC?TCGCTGAATC?CATTTCCCAG?TTGGTTTCTA?TTCCCCGCCC
CATTCCTGTG
2161?TCACAGTTCT?GTAGTTTTAA?CCAGAACAAA?GGGATTACCC
AGAAGAAAAG?AAGGTAAGCT
2221?ATTTCATCAG?TTTTGGTGGA?AATCAGAAGT?TTTTTTTTCT?ATTATTAGCT
TTGTATTCTT
2281?AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
5) the new gene registering result of FAMLF
New gene is through application, staff by American National information biology center GenBank examines, obtain nucleic acid number of registration: EF413001, protein number of registration: ABN58747 is Homo sapiens familial acute myelogenous leukemia related factor (being called for short FAMLF) by definite designation.
The bioinformatic analysis of embodiment 2:FAMLF and function prediction
1) full-length cDNA analytical results
Application NCBI/ORF Finder program ( http:// www.ncbi.nlm.nih.gov/gorf/gorf.html) analyze its ORF encoder block, the results are shown in Figure 7.The sequence of the cDNA of FAMLF is as follows:
1 AGAACTGCAG?ATAGTACAGC?TTCCACAGGA?GCAAGGGATG?TCTGAGCACA
AGTGGCTGAG 60
61 TTCCGAGTGA?CTTTATGAAG?CACTTTCTAC?CTTCCTCTCC?GGCATGAAAA?CAGGGATTCT
120
121 GCACCTGCAT?CATGGACAGT?CTGGCAAAAG?CCTCTGCTCT?GCCTCCGGGG
ACAAGAAACT 180
181 AGAGCAAATA?ACCGTTTTGA?AATTAGATCC?TGGCAAAATT?ACCAACAATC?AATGATGGAA
240
241 ACTGAAGGGA?GATTGATTTA?AATCTTCAAT?GACAGTTGTA?CAGAAGTTGA?AGAAACACGT 300
301 CATCTTTCCA?AAGAAGAGTG?AGTAGCTTGG?TTGGTGGTAC?CCTAAAATTA?GGGCATGATT
360
361 AAGGTACGTC?ATTTCTTTTA?GTTCAATCGA?AGTGCTTTGC?TGTTTCCATT?TCAGAGAATT
420
421 TCTTATTCTT?TTTTTCAATT?TCTCTCTCTT?CCTCTTCTTC CTCTCATTAG?TAGATGTCTT
480
481 TTATAATTGA?TGTCATTTAC?TGTCCTTTCA?TCAAATGTAT?GCCACATCAC?TTAGGCGAAC
540
541 CAGCAGACAG?GGCACCAAAA?TACACATTAG?AGGAGACTGG?CTTCCATGAG
ACGCTTCGAC 600
601 TGTCTCATCG?GGGCACTTGT?AATAAGCATC?TTGGTGCCAC?TGAATGCAAT?GCTGTATTCA
660
661 AATAATAGCT?TTCATCTTCA?CTCTTTTTAA?ATATAAAAGT?AAACCTTGAA?GCCCTTTGAA
720
721 GGACCTAACC?AAACAACATA?CCTATGAAAA?TAGATCAGTA?AGGCTTTGAG?AAACATTCTT
780
781 AAGTAAAATC?TGTAAAGCAT?CTTTGCATTT?TTTTTCAAGA?AAGACCTCCA?GGTAAATGAT
840
841 GGCTTTTAAT?AAGACACATG?ACAATCTCAA?TTACAAGAAT?CATTAGTGTG?TGTCCTGTGC
900
901 GCCATTTTAT?GTTCCCAGCA?GGATATATCT?TTTCTCGTCT?AGGGTTTCCA?GGGCTGTCTA
960
961 CTGTTCTCTA?TGTGTAAAAC?GTATTTAAGT?GTTCCCCCAA?TGCTGCACTA?ATGTTGAAAC
1020
1021 AAAACAAAAC?AAAAACGAAG?AAACCTTTGT?CAAGTGGTCA?GACAGACTGG
AACTAGAGGA 1080
1081 TTATAGGTAA?GAGAGATAAA?ATGAAGGGTT?GAAAGCTATA?ATTTCTATTT?ATGTGGTGGC
1140
1141 AACCAAATCA?GCTGTTGGAG?TCAGGCAATT?TAAAGATGTG?GCTACTGGAG?CTCAGAGTCT
1200
1201 GGGAAGAAGA?CACTTCTGCG?TCTGACAGTG?AATCAGGCTC?CCAGTTTTGA?AGATGTGCTG
1260
1261 TAGGTAGTTC?TCGCTGAATC?CATTTCCCAG?TTGGTTTCTA?TTCCCCGCCC?CATTCCTGTG
1260
1321 TCCCCACACT?TTCCACTTGA?TTTTACCTCT?TTGACAATTC?TATATTTTAC?TTTCCTTCCT
1320
1381 CTCATTCCCC?TTTTCCCACC?CCCTTTTTTT?ACTGTAGTTC?TTGGCCTCTG?ACTACTGTTC
1380
1441 CATGCTGGAT?GTCCCCAGAA?AATAGAGTAT?GTTTAGAAAG?GAGACAGTGC?ATCTCAGAAG
1440
1501 GGCCTCCCCA?GTCCACTAGT?CCATTTTTTA?ATGTGTTGTG?CTCTATGGGT?GTCAGGAATA
1560
1561 TTTGTAGATG?AAGTAATTTG?TGGCATGAAT?TTTGATAGAA?GCAGGATCAC?CAACAAAATG
1620
1621 ATAAATGTAG?GTACCTGTCT?ACCTTGCATA?ATATTCACTA?TGATCTTGAG?AATTTCAATG
1680
1681 TATAATTTGT?CTTTATTCTT?ATTTTTCATT?AGAATTAACA?GAATCTCAGA?GCTGGTAGAA
1740
1741 AGTATAGAAA?CTGTATATAC?AACTCTCATA?TTCAGATGAA?GAAAATGATG?CACAAAAAAT
1800
1801 CAACTGTCCT?AAGCCATTTA?GCTTGTCTAT?AAGTGCTGTT?GGCTTAATTA?TAGTTTTGCA
1860
1861 TATATTTAGG?CAAAGAAAAT?ACTTTCTCAG?AAACTGGTTA?GGACTGTTTG?AGAAGAAATA
1920
1921 TAATCATCAA?AATATATACA?CAGTAAAATG?TAACCGTCCA?TCATTCAACA?TAGGCAAGAA
1980
1981 TATATATTGA?ATTGCCTGAG?TGTATTATTC?GTATAGCAAA?ACTTACTTGA?ATTTCTAATA
2040
2041 AATCTTCTGA?CCTCTGTATA?TGTATAAAAT?ATATAAACCA?ACCAAATTCT?GTACATAAAT
2100
2101 ATATTTTTGG?ATACCAGTAC?AATCCCTATT?TCACTTTTGT?GTATTCCAGT?TATTTATTAC
2160
2161 TCACAGTTCT?GTAGTTTTAA?CCAGAACAAA?GGGATTACCC?AGAAGAAAAG
AAGGTAAGCT 2220
2221?ATTTCATCAG?TTTTGGTGGA?AATCAGAAGT?TTTTTTTTCT?ATTATTAGCT?TTGTATTCTT
2280
2281 AAAAAAAAAA?AAAAAAAAAA?AAAAAAAAAA?AAA
2303
NCBI/ORF Finder program finds that this sequence has complete ORF encoder block in+1 phase place, between 1531-1779 Nucleotide, 82 the amino acid whose protein of encoding, the terminator codon TAG that has same framework in first ATG upstream of open reading frame, there is terminator codon TGA in the downstream of coding framework, 3 ' end has polyA tail and AATAAA tailing signal, shows that this cDNA is full-length cDNA.
2) sequence similarity analytical results is shown in Fig. 8
3) new gene electric daughter chromosome positioning result is shown in Fig. 9
Networking http://genome.ucsc.edu/ carries out the assignment of genes gene mapping, finds that the assignment of genes gene mapping is in karyomit(e) 1q31.3.
4) genome structure is determined
Networking http:// genome.ucsc.edu/cgi-bin/hgBlat? command=startcarrying out genome structure determines, find that this gene contains 2 exons, 1 intron, first exon is 204bp, and second exon is 2076bp, and intron is 38964bp, site, intron exon boundary meets GT-AG rule, promoter element is initial sub-Inr, meets-1 and classifies CA rule as with+1 two site nucleotides sequence, and CAAT box is contained in transcripting start point upstream-75 district.
5) new gene coded protein character function prediction
5.1) coded protein basic physical and chemical predicts the outcome
The amino acid residue sequence of learning this protein according to opening code-reading frame is:
1 MCCALWVSGI?FVDEVICGMN?FDRSRITNKM?INVGTCLPCI
41 IFTMILRISM?YNLSLFLFFI?RINRISELVE?SIETVYTTLI?FR 82
Application ProtParam instrument ( http:// expasy.org/tools/protparam.html) to analyze this protein molecular quality be 9554.5, iso-electric point (pI) is 7.60, molecular formula is C 434h 693n 107o 114s 10, optical extinction coefficient is 8730M -1cm -1(280nm), the transformation period is 30h (external mammals skein cell), and unstability index is 37.75, it is generally acknowledged that this albumen is stable, and hydrophobicity index is 122.32, overall average wetting ability 0.888.
5.2) protein hydrophobic profile analysis
Application ProtScale instrument (www.expasy.org/tools/protscale.html) carries out protein hydrophobic profile analysis (the results are shown in Figure 10)
5.3) protein function domain analyses result
Networking http:// smart.embl-heidelberg.de/, the functional domain (seeing Figure 11, Figure 12) that analysing protein is possible:
Find that 1-17 amino acid region contains signal peptide, 29-51 amino acid region may be cross-film district, 52-74 amino acid region contains LRR_SD22 functional domain, and 75-82 amino acid region is inherent intrinsic disordered structure district, and 2-39 amino acid region may be also BowB structural domain.
6) FAMLF gene between patient and the normal people of family, the Differential expression analysis of U-937, HL-60, CA-46, RAGJ, SHI-1, Hela, acute monocytic leukemia, melanoma, hepatoma cell strain
6.1) use primer-design software Oligo 6.0 according to cDNA sequences Design Differential expression analysis primers F 17, the R539 of this gene:
Upstream primer F17:5 ' AAGCACTTTCTACCTTCCTCTC 3 '
Downstream primer R539:5 ' TCTCCCTTCAGTTTCCATCA 3 '
6.2) with β 2aCTIN is that internal reference carries out OneStep RT-PCR reaction, reaction system:
Figure BDA0000140494840000301
Reaction parameter:
50℃?30min
95℃?15min
94 ℃ of 30sec circulate 35 times
52℃?30sec
72℃?30sec
At 4 ℃, keep
Get respectively 5ul PCR product, 2% agarose electrophoresis, observations (seeing Figure 13, Figure 14, Figure 15), electrophorogram is reached a conclusion: Figure 13 shows that internal reference segment is 251bp, object segment is 175bp, and result shows that the expression of FAMLF gene in patient is apparently higher than normal people; Figure 14 shows that internal reference segment is 251bp, and object segment is 522bp, and result shows that FAMLF all has compared with high expression level in above-mentioned cell strain U937 cell strain, Raj cell strain, Ca46 cell strain, Shi-1 cell strain; Figure 15 result shows that FAMLF gene expresses in Acute Monocytic Leukemia Cell Line strain, in melanochrome, hepatoma cell strain, does not express, and FAMLF gene can detect as malignant tumour contains human gene FAMLF test kit; And the coded polypeptide of human gene FAMLF and polynucleotide can be in preparing leukemia cell medicine application.
Embodiment 3: the clone of people's gene FAMLF full-length cDNA
According to the sequence of people's gene FAMLF, design pair of primers F82 and R1974, for increasing, comprise the FAMLF full length gene cDNA amplification condition of signal skin sequence: 95 ℃ of sex change 15min; Then with 94 ℃ of 30s, 58 ℃ of 1min, the program loop of 72 ℃ of 30s (total length 2min) 35 times; Last 72 ℃ are extended 7min.PCR product adopts direct Sequencing checking, and is cloned on carrier pMD18-T.Its exactness is identified in PCR and order-checking.DNA fragmentation reclaims and uses the glue of Shanghai Sheng Gong company to reclaim test kit, and plasmid extraction is used the plasmid extraction test kit of Shanghai Sheng Gong company, and intestinal bacteria transform the heat-shocked method that adopts.Concrete steps are shown in < < molecular cloning > >.Determined dna sequence shows: the DNA sequence dna of PCR product is identical with the 82-1974bp shown in sequence table <210>1.(seeing described in Fig. 1)
Embodiment 4-1: the development of people's gene FAMLF specific monoclonal antibody A
1) according to the sequence application software of gene FAMLF, design and synthesize immune epitope polypeptide [this polypeptide is positioned at the 2nd to the 16th amino-acid residue (CALWVSGIFVDEVI-NH2) of the protein of this genes encoding] 20mg, its purity 92%, reaches the requirement of this experiment after testing.
2) this polypeptide is connected to upper keyhole limpet hemocyanin (KLH) and bovine serum albumin (BSA), two signs are respectively used to Immunological purification and the ELISA monitoring of follow-up antibody.
3) above-mentioned KLH, BSA are connected to the respectively immune Liang Zhi of polypeptide New Zealand white rabbit.
4) by the immune New Zealand of above-mentioned labeling polypeptide white rabbit, and monitor sero-fast progress until its titre is greater than at 10,000 o'clock by ELISA, the blood of New Zealand white rabbit is all released to the extraction for antibody A.
5) by affinity purification, extract the antibody A in serum, obtain the antibody A 7ml that concentration is 1.3mg/ml.
6) antibody A (the results are shown in Figure 16) of extracting by Western Bloting checking, Figure 16 reaches a conclusion: 1,33-1-3R3 (PA), the the 4th to the 16th the corresponding polypeptide fragment-CALWVSGIFVDEVI-NH2 of amino-acid residue for the protein of this genes encoding), this antibody, dilutes 250 times; 2, this antibody of 33-1-3R3 * (PA), thinning ratio is 50, wherein GAPDH antibody and Actin antibody are as positive control, the concrete steps of Western Bloting are shown in < < molecular cloning > >, and result shows the antibody of successfully preparing for FAMLF; 3, confirm that first FAMLF is the human gene of the about 8kD protein of coding.
Embodiment 4-2: the development of people's gene FAMLF specific monoclonal antibody B
1) according to the sequence application software of gene FAMLF, design and synthesize immune epitope polypeptide [this polypeptide is positioned at the 17th to the 29th amino-acid residue (CGMNFDRSRITNK-NH2) of the protein of this genes encoding] 20mg, its purity 84%, reaches the requirement of this experiment after testing.
2) this polypeptide is connected to upper keyhole limpet hemocyanin (KLH) and bovine serum albumin (BSA), two signs are respectively used to Immunological purification and the ELISA monitoring of follow-up antibody.
3) above-mentioned KLH, BSA are connected to the respectively immune Liang Zhi of polypeptide New Zealand white rabbit.
4) by the immune New Zealand of above-mentioned labeling polypeptide white rabbit, and monitor sero-fast progress until its titre is greater than at 10,000 o'clock by ELISA, the blood of New Zealand white rabbit is all released to the extraction for antibody B.
5) by affinity purification, extract the antibody B in serum, obtaining concentration is the antibody B 4ml of 0.1mg/ml.
6) the antibody B extracting by Western Bloting checking equally, result shows the antibody B successfully preparing for FAMLF.
Embodiment 4-3: the development of people's gene FAMLF specific monoclonal antibody C
1) according to the sequence application software of gene FAMLF, design and synthesize immune epitope polypeptide [this polypeptide is positioned at the 61st to the 77th amino-acid residue (C-RINRISELVESIETVYT-NH2) of the protein of this genes encoding] 20mg, its purity calculates 83% after testing, reaches the requirement of this experiment.
2) this polypeptide is connected to upper keyhole limpet hemocyanin (KLH) and bovine serum albumin (BSA), two signs are respectively used to Immunological purification and the ELISA monitoring of follow-up antibody.
3) above-mentioned KLH, BSA are connected to the respectively immune Liang Zhi of polypeptide New Zealand white rabbit.
4) by the immune New Zealand of above-mentioned labeling polypeptide white rabbit, and monitor sero-fast progress until its titre is greater than at 10,000 o'clock by ELISA, the blood of New Zealand white rabbit is all released to the extraction for antibody C.
5) by affinity purification, extract the antibody C in serum, obtaining concentration is the antibody C 7ml of 1.7mg/ml.
6) the antibody C extracting by Western Bloting checking equally, result shows the antibody C successfully preparing for FAMLF.
Embodiment 5: the application of people's gene FAMLF specific monoclonal antibody
By Western Blot, at protein level, the expression in cell strain, clinical leukaemic and normal people of people FAMLF gene is carried out to quantitative analysis (the results are shown in Figure 17, Figure 18, Figure 19), reach a conclusion: 1, antibody A, for the 2nd to the 16th the corresponding polypeptide fragment of amino-acid residue (CALWVSGIFVDEVI-NH2) of the protein of this genes encoding, this antibody is for detecting the expressed protein FAMLF of new gene by Western Bloting; 2, the protein high expression level in many cell strains relevant to leukemia that shows the new genes encoding of FAMLF by WesternBloting scientific discovery result, high expression level in the clinical leukaemic of part, in normal people, do not express, FAMLF is the new gene relevant to human leukemia; The present invention has prepared by current techique the test kit that contains human gene FAMLF that FAMLF gene detects as malignant tumour, test kit adopts universal method to detect, result shows all have compared with high expression level in containing U937 cell strain, Raj cell strain, Ca46 cell strain, Shi-1 cell strain, in leukemia NB4, U937, K562, myeloma cell line U266, leukemia H160 cell, lymphoma cell strain CA46, have compared with high expression level, can detect and contain acute monocytic leukemia cell line and CA46.The polypeptide that human gene is coded and polynucleotide can be in preparing leukemia cell medicine application.
By lot of experiments, obtain Fujian Province's acute myeloid leukemia high density family family tree as shown in figure 20.
Figure IDA00001632706200011
Figure IDA00001632706200021
Figure IDA00001632706200031

Claims (2)

1. the specific antibody of a human gene FAMLF is developed immune peptide epi-position used:
CGMNFDRSRITNK-NH2。
2. for the specific antibody of immune peptide epi-position claimed in claim 1.
CN201210056172.1A 2010-02-05 2010-02-05 New immune epitope for specific antibody of human new gene FAMLF, and preparation and application of antibody Expired - Fee Related CN102617710B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201210056172.1A CN102617710B (en) 2010-02-05 2010-02-05 New immune epitope for specific antibody of human new gene FAMLF, and preparation and application of antibody

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201210056172.1A CN102617710B (en) 2010-02-05 2010-02-05 New immune epitope for specific antibody of human new gene FAMLF, and preparation and application of antibody

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
CN2010101075793A Division CN101838650B (en) 2010-02-05 2010-02-05 Development and applications of new human gene FAMLF in human gene recombination, malignant tumor gene detection and specific monoclonal antibody

Publications (2)

Publication Number Publication Date
CN102617710A CN102617710A (en) 2012-08-01
CN102617710B true CN102617710B (en) 2014-05-07

Family

ID=46557959

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201210056172.1A Expired - Fee Related CN102617710B (en) 2010-02-05 2010-02-05 New immune epitope for specific antibody of human new gene FAMLF, and preparation and application of antibody

Country Status (1)

Country Link
CN (1) CN102617710B (en)

Also Published As

Publication number Publication date
CN102617710A (en) 2012-08-01

Similar Documents

Publication Publication Date Title
CN101854946B (en) Recombinant monoclonal antibodies and corresponding antigens for colon and pancreatic cancers
TWI655209B (en) Antibody against human plan death (PROGRAMMED DEATH) ligand 1 (PD-L1)
ES2848052T3 (en) Single Agent Anti-PD-L1 and PD-L2 Dual Binding Antibodies and Methods of Use
US8404233B2 (en) Neutralizing monoclonal antibody against human DLL4
RU2623122C2 (en) Monoclonal antibodies and methods for their application
CN107098970B (en) Antibodies that bind to intracellular PRL-1 or PRL-3 polypeptides
CN110267678A (en) Anti- MIC antibody and application method
EP3130674A1 (en) Antibodies that specifically block the biological activity of a tumor antigen
US20030096285A1 (en) Identifying anti-tumor targets or agents by lipid raft immunization and proteomics
TW201837056A (en) B7-h3 antibody, antigen-binding fragment thereof and medical application thereof
KR20080059449A (en) Therapeutic agent
KR20190082815A (en) Neutralizing anti-TL1A monoclonal antibody
CN110914304A (en) CD96 antibody, antigen binding fragment thereof and medical application
KR20220140568A (en) Human monoclonal antibody against severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)
US6316600B1 (en) Methods for the production of chicken monoclonial antibodies
AU2021297856A9 (en) Anti-CD73 antibody and use thereof
US20230391886A1 (en) Compositions and methods for muc18 targeting
WO2018085431A1 (en) Filamin a binding proteins and uses thereof
CN115298216A (en) Antibody or antigen binding fragment thereof, preparation method and medical application thereof
KR20100034720A (en) Pauf-specific human monoclonal antibody, pharmaceutical composition for treating cancer comprising the same and method for detecting cancer using the same
CN101838650B (en) Development and applications of new human gene FAMLF in human gene recombination, malignant tumor gene detection and specific monoclonal antibody
CN112812179B (en) High-affinity high-specificity anti-CMTM 6 monoclonal antibody and application thereof
CN102617710B (en) New immune epitope for specific antibody of human new gene FAMLF, and preparation and application of antibody
JP2007106716A (en) Monoclonal antibody specifically reacting with isg15 protein, hybridoma producing the same and method for detecting cancer and virus infection
JP2009096716A (en) Treatment of autoimmune disease by anti-ccl20 antibody

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20140507

Termination date: 20160205