CN102617710A - New immune epitope for specific antibody of human new gene FAMLF, and preparation and application of antibody - Google Patents

Abstract

The invention discloses a new immune epitope for a specific antibody of a human new gene FAMLF, and preparation and application of an antibody. The human new gene FAMLF is a polynucleotide sequence of cDNA of a new gene related to familial acute myeloid leukemia and a complete open reading frame; and the comprised amino acid residue sequences corresponding to two immune epitopes are as follows respectively: one immune epitope sequence code is SEQ ID NO: 1, and the other immune epitope sequence code is SEQ ID NO: 2. The immune epitope and the specific antibody thereof provided by the invention lay the foundation for research and development of future leukemia specific gene diagnostic antibodies, protein chips, gene chips and gene medicines. For developing anti-leukemic new drugs, improving the diagnosis accuracy and the treatment effect of leukemia, and improving the cure rate of leukemia in Fujian Province, the immune epitope and the specific antibody thereof have an important role and potentially significant social and economic benefits. The immune epitope and the specific antibody thereof provided by the invention lay the foundation for genetic diagnosis and gene therapy of leukemia and other malignancies.

Description

The newly-increased immune epitope of human gene FAMLF specific antibody and Antibody Preparation and application

Patented claim of the present invention is to be that 2010.02.05, application number are 201010107579.3, denomination of invention is divided an application for " human gene FAMLF is in the development and the application of people's gene reorganization, malignant tumour gene test, monoclonal antibody specific " patented claim to the applying date.

Technical field

The present invention relates to a kind of field of medicaments; Relate in particular to human gene (FAMLF) the full length DNA sequence, construct this full length gene cDNA T clone, design to the PCR primer of the sequence specific amplification region of this gene and develop to the expressed proteic specific monoclonal property antibody of this gene, the field is following under the segmentation:

(1) molecular biology category.

(2) Antibody Preparation research field.

(3) clinical blood disease research field.

Background technology

Along with the completion of the Human Genome Project, human genome is learned research and has been realized from the genomic backward comprehensive transformation of structure gene group, the sequence of the chromosomal overwhelming majority in 24 in the human genome (except that minority at interval) clear and definite.Estimate a nearly 20000-25000 gene in the human genome.Accomplishing genome sequence mensuration becomes the historic beginning of cracking human inheritance's secret, and ensuing task is arduous more, mainly is to accomplish following target at present: the one, discern, separate, identify and clone all genes (only cloning more than 10,000 now); The 2nd, get function and the interaction between the gene and the mutual relationship of each gene clear.Have scientist to estimate, to 21 century later, gene therapy might be moved towards the clinical application wonderful stage, for human health is made significant contribution.And malignant tumour becomes first-selected sick kind of gene therapy owing to its high incidence and mortality ratio, and the clone of tumor-related gene will provide target spot for the gene therapy of malignant tumour, be one of important foundation of gene therapy.

White blood disease is one of modal malignant tumour of blood system; Estimate the leukemic sickness rate of China annual 2.71/10 ten thousand; Die from nearly 40,000 people of leukaemic every year, the DFS rate only reached about 20% in 5 years, and intractable recurrent white blood disease incidence is on the rise.Leukemic biological behaviour is complicated and changeable, and does not illustrate as yet on the molecular biology basis of pathogenesis and generation, development.Clinically leukemic prevention, treatment, prognosis are judged still to lack effective means, bone marrow transplantation patient's curative ratio only about 40%, mortality ratio is still high at present.

Genetics research in recent years shows that white blood disease is the polygene related neoplasms, in the world to the major progress of white blood disease fundamental research, is from the research to the white blood disease genes involved greatly.Some results of study show that oncogene such as bcr/abl, c-myc, bcl-1, tal-1, RARa, CAN, MLL, NUP98 and white blood disease incidence and development have closely related.Leukemic research focus is concentrated on clone and evaluation to the white blood disease genes involved abroad, mainly through making up general genomic library or the cDNA library row filter of going forward side by side, but its specificity is not high, and the screening positive rate is lower.Fujian Province's white blood disease sickness rate is higher than the whole nation, leukaemic's large contingent, and the leukemia gene aboundresources, especially the white blood disease high density family is seen more, its lymphoblastic leukaemia genetic gene has unique researching value.The familial white blood disease is a kind of malignant tumour of blood system, is again a kind of and the disease inherited genetic factors height correlation, and its gene have unique researching value.We rose white blood disease high density family in mountain area, Fujian Province (the family collection of illustrative plates is seen accompanying drawing one) in 1981; Aspect researchs such as genetics, cytogenetics have been carried out; At present the member of seminar was carrying out on the basis of correlative study this acute leukemia high density family genetic mechanism in the past, use and suppress subtractive hybridization (SSH) equimolecular biology techniques, with IV-18 patient's marrow as Tester; Normal people's marrow is as Driver; Successfully make up familial acute myeloid leukemia cDNA inhibition subtractive library, used Differential Screening technology screening and identify the library, confirmed 28 positive difference expression genes of gene; Positive colony is delivered order-checking; Sequencing result submits to GenBank to carry out the homology compare of analysis, has found EST segment and the relevant new EST fragment of white blood disease of 11 the unknowns of the relevant known of white blood disease of 17 variant expression, and 11 new EST fragments are all successfully registered at the gene pool GENBANK of America NI H.Through single stage method sxemiquantitative RT-PCR examination, find that wherein 4 new EST fragments are expressed and in the normal people, hang down at marrow series leukemia philtrum high expression level.Choose zywB-87 (the GenBank number of registration: CV973101),, successfully cloned the pairing new gene cDNA total length of zywB-87 of variant expression in 4 through electronic cloning and SMART-RACE technology; This assignment of genes gene mapping is in karyomit(e) 1q31.3; CDNA total length 2313bp, 82 the amino acid whose protein of encoding contain signal peptide; Be rich in leucine repeating unit (LRR_SD22), functional zone such as inherent intrinsic disordered structure territory.Blast retrieval FAMLF is the new gene of Unknown Function, is included by GenBank, and is named as FAMLF, and the nucleic acid number of registration does EF413001, the protein number of registration does ABN58747The expression of the new expression of gene FAMLF in the acute myeloid leukemia patient in the normal people; Difference has statistical significance (P＜0.01); Predict that through bioinformatic analysis new gene FAMLF is positioned cytolemma probably, participate in some proteic phosphorylation in the cell means of information transmission; The high expression level of FAMLF possibly cause the continuous activation of cell proliferation signal, the perhaps inhibition of apoptosis signal, thus cause the generation of malignant tumour.And the method for having cloned through T-A successfully constructs the T clone who comprises FAMLF full length gene cDNA; Successfully developed to FAMLF protein-specific monoclonicity antibody; Protein high expression level in the acute myeloid leukemia patient of verifying out this new genetic expression through Western Bloting hangs down expression in the normal people, during the correlation function of FAMLF gene is further being studied and confirmed.

This achievement in research makes full use of, brings into play the unique advantage of this family genetics resource, and the clinical potential application prospect of combining closely is inquired into research targetedly to the clone of white blood disease genes involved.Lay the foundation for developing white blood disease specific gene medicine, gene diagnosis chip, diagnosis antibody from now on.This Project Study improves leukemia diagnosis accuracy rate and result of treatment for developing the leukemia new drug, and improving the leukemic curative ratio in Fujian Province has important effect, and potential important social and economic benefit are arranged.

Summary of the invention:

The objective of the invention is to propose a kind of newly-increased immune epitope and Antibody Preparation and application of human gene FAMLF specific antibody.

The technical scheme that the present invention adopted is: 1, the used immune peptide epi-position of the specific antibody of human gene FAMLF development: SEQ ID NO:1 CGMNFDRSRITNK-NH2; 2, be directed against the specific antibody of above-mentioned immune peptide epi-position.3, the used immune peptide epi-position of the specific antibody of human gene FAMLF development: SEQ ID NO:2CRINRISELVESIETVYT-NH2; 4, be directed against the specific antibody of above-mentioned immune peptide epi-position.

Content of the present invention includes but not limited to: the complete opening code-reading frame sequence of the full length cDNA sequence of familial acute myeloid leukemia relative new gene (FAMLF), FAMLF gene; Also comprise the used primer of clone's FAMLF gene, the recombinant vectors that comprises the FAMLF gene, the sequence (detection gene) of analyzing the needed FAMLF gene efficient of FAMLF gene differential expression specific amplified, its sequence specific amplification region (sequence characterized amplified region, immune peptide epitope sequences SEQ ID NO:1 that PCR primer SCAR), preparation FAMLF gene monoclonal antibody are used and sequence SEQID NO:2, to the expressed proteinic monoclonal antibody specific of FAMLF gene and they related application in fields such as fundamental research, gene diagnosis, gene quality.They are achieved in that

1, uses inhibition subtractive hybridization (SSH) equimolecular biology techniques; With the marrow of the white blood disease high density family patient IV-18 of Fujian Province as Tester; Normal people's marrow is as Driver; Successfully make up familial acute myeloid leukemia cDNA inhibition subtractive library, used Differential Screening technology screening and identify the library, confirmed 28 positive difference expression genes of gene; Positive colony is delivered order-checking; Sequencing result submits to GenBank to carry out the homology compare of analysis, has found EST segment and the relevant new EST fragment of white blood disease of 11 the unknowns of the relevant known of white blood disease of 17 variant expression, and 11 new EST fragments are all successfully registered at the gene pool GENBANK of America NI H.

2,, find that wherein 4 new EST fragments are expressed and in the normal people, hang down at marrow series leukemia philtrum high expression level through single stage method sxemiquantitative RT-PCR examination.Choose zywB-87 (the GenBank number of registration: in 4 CV973101) through electronic cloning and SMART-RACE technology; (the GenBank number of registration: CV973101) pairing new gene cDNA total length, this assignment of genes gene mapping be in karyomit(e) 1q31.3, cDNA total length 2313bp successfully to have cloned the zywB-87 of variant expression; 82 the amino acid whose protein of encoding; Contain signal peptide, be rich in leucine repeating unit (LRR_SD22), functional zone such as inherent intrinsic disordered structure territory.Blast retrieval FAMLF is the new gene of Unknown Function, is included by GenBank, and is named as FAMLF, and the nucleic acid number of registration does EF413001, the protein number of registration does ABN58747

3, predict that through bioinformatic analysis new gene FAMLF is positioned cytolemma probably, participate in some proteic phosphorylation in the cell means of information transmission; The high expression level of FAMLF possibly cause the continuous activation of cell proliferation signal, the perhaps inhibition of apoptosis signal, thus cause the generation of malignant tumour.The expression of the new expression of gene FAMLF in the acute myeloid leukemia patient in the normal people, difference has statistical significance (P＜0.01).

4, extract mRNA in the mononuclearcell of the patient IV-18 bone marrow fluid from Fujian Province's white blood disease high density family; FAMLF gene order according to above-mentioned discovery; Design, synthetic primer; Through RT-PCR amplification, T-A clone, construct the T clone of the FAMLF full length cDNA sequence of codified 82 amino-acid residues.

5, see according to the opening code-reading frame sequence of the FAMLF gene of above-mentioned discovery; Design, the synthetic expressed proteinic immune epitope polypeptide of this gene; Immunity New Zealand white rabbit; Prepare to this proteic specific monoclonal property antibody, and use the activity of this antibody of Western Bloting checking.

6, the FAMLF gene is at the expression analysis of mRNA level: according to the cDNA sequence of the FAMLF gene of above-mentioned discovery; The primer of design, synthetic this gene is analyzed the differential expression between acute myeloid leukemia and normal people of this gene through single stage method RT-PCR.

7, the FAMLF gene is at the expression analysis of protein level: use the FAMLF monoclonal antibody specific of foregoing invention, through Western Bloting the differential expression between acute myeloid leukemia and normal people of this gene is analyzed.

Find that through single stage method RT-PCR, Western Bloting the expression level of FAMLF in acute myeloid leukemia is higher than its expression level the normal people, its difference has statistical meaning.The high expression level of FAMLF possibly cause the continuous activation of cell proliferation signal, the perhaps inhibition of apoptosis signal, thus cause the generation of malignant tumour.

The present invention provides used polypeptide epitope sequence SEQ ID NO:1 of producer gene FAMLF monoclonal antibody specific and sequence SEQ ID NO:2.

The invention still further relates to and polypeptide epitope sequence SEQ ID NO:1 and the corresponding polynucleotide sequence of sequence SEQ ID NO:2.Polynucleotide can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna, synthetic or through DNA that genetically engineered obtained.DNA can be strand or double-stranded.The polynucleotide sequence of encoding mature polypeptide can be identical with the coding region sequence shown in sequence table SEQ ID NO:1 and the SEQ ID NO:2 or the varient of degeneracy.The pairing polynucleotide of mature polypeptide of code sequence tabulation sequence SEQ ID NO:1 and SEQ ID NO:2 comprise: the encoding sequence that has only mature polypeptide; The encoding sequence of mature polypeptide and various additional code sequence; Encoding sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence.DNA can be coding strand or noncoding strand.

The invention still further relates to the varient of polynucleotide, its coding has the polypeptide of identical aminoacid sequence or segment, analogue and the verivate of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it possibly be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing the function of its encoded polypeptides in fact.

The invention still further relates to the sense-rna (antisense) of on FAMLF sequence information basis, deriving, designing, siRNA (small interfering RNA), ribozyme (ribozyme), triple strand dna and form deoxy-oligonucleotide (triple helix-forming oligo-nucleotides, gene therapy product such as TFO).

The special polynucleotide sequence of coding human recombination FAMLF of the present invention can obtain with several different methods.For example, separate polynucleotide with hybridization technique well known in the art.These technology including, but not limited to: 1) with probe and genome or the hybridization of cDNA library to detect homologous polynucleotide sequence and 2) antibody screening of expression library to be to detect the clone's with common structure characteristic polynucleotide passage.

Other polypeptide of the present invention relates to the polypeptide of immunologic opsonin ground binding sequence sequence SEQ ID NO:1 and SEQ ID NO:2 or preservation clones coding, their antibody and the T cell antigen receptor (TCR) of polypeptide fragment or variant and/or epi-position of the present invention (to be used to measure specific antibody-antigen bonded immunoassay definite through well known).

Known this basic antibody structure unit comprises the tetramer.Each tetramer is made up of two pairs of identical polypeptied chains, and every pair has one " light chain " (about 25kDa) and one " heavy chain " (about 50-70kDa).The aminoterminal of each bar chain partly comprises about 100 to 110 or more a plurality of amino acid whose variable region, and it mainly is responsible for antigen recognition.The carboxyl terminal of each bar chain has partly been stipulated constant region, and it mainly is responsible for effector function.Human light chain is divided into κ and lambda light chain, and heavy chain is divided into μ, δ, γ, α or ε, and respectively the isotype of antibody is defined as IgM, IgD, IgG, IgA and IgE.The variable region of every pair of light chain/heavy chain forms antibody combining site.

Therefore, complete IgG antibody has two binding sites.Except difunctional or bi-specific antibody, these two binding sites are identical.

These chains all show identical general structure, the conservative relatively framework region (FR) that promptly couples together through three hypervariable regions (being called complementary determining region or CDR again).CDR from every pair of heavy chain and light chain arranges through framework region, makes to combine with specific epitopes.Hold the end to C, light chain and heavy chain IncFlds FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4 from N.The proteinic sequence (National Institutes of Health, Bethesda, the Md that have immune meaning according to Kabat.

Dual specific or bifunctional antibody be have two different heavy chains/light chains to the artificial hybrid antibody of two different binding sites.Bi-specific antibody can be through the several different methods preparation, and these methods comprise the fusion hybridoma or connect Fab ' fragment.In addition, bi-specific antibody can form " diabodies ".

Antibody of the present invention includes, but are not limited to polyclone, mono-clonal, polyspecific, the mankind, humanization or chimeric antibody, single-chain antibody; The Fab fragment, and F (ab ') fragment, through the fragment of Fab expression library generation; Antiidiotype (anti-Id) antibody (comprising the anti-Id antibody that for example is directed against antibody of the present invention); The antibody that produces in the cell (that is, intrabodies) and the fragment of above-mentioned all combination epi-position.Term " antibody " is used in reference to the immunologic competence part or the fragment of immunoglobulin molecules and immunoglobulin molecules in this article, promptly contains the molecule of the antigen binding site of immunologic opsonin conjugated antigen.Immunoglobulin molecules of the present invention can be any type (for example IgG, IgE, IgM, IgD, IgA and IgY), type (for example IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) or the subclass of immunoglobulin molecules.

Most preferably, antibody is human antigen-binding antibody fragment of the present invention, includes but not limited to the Fvs (sdFv) that Fab, Fab ' and F (ab ') 2, Fd, strand Fvs (scFv), single-chain antibody, disulfide linkage are connected and comprises VL or the fragment in VH territory.The antigen-binding antibody fragment comprises single-chain antibody, can only comprise the variable region or also comprise following all or part: hinge area, CH1, CH2 and CH3 territory.The present invention also comprises the Fab of any combination that comprises variable region and hinge area, CHI, CH2 and CH3 territory.Antibody of the present invention can comprise birds and mammal from any animal-origin.Preferably, this antibody is people, mouse (for example mouse and rat), donkey, sheep, rabbit, goat, cavy, camel, horse or chicken.Among this paper, " mankind " antibody comprises the antibody of the aminoacid sequence with human immunoglobulin, comprises that separation is from the human normal immunoglobulin library or separate from the antibody of not expressing one or more human immunoglobulin transgenic animal of endogenous immunoglobulin.Antibody of the present invention can be monospecific, dual specific, tri-specific or more polyspecific.Multi-specificity antibody can have specificity for the different epi-positions of polypeptide of the present invention, maybe can have specificity to polypeptide of the present invention and to allos epi-position such as the many skins of allos or solid support material.

Antibody of the present invention can be described or stipulates according to the epi-position of the present invention of its identification or specific combination or polypeptide portion.This epi-position or polypeptide portion can be by regulations described herein, for example through N end and C end position, stipulate through the size of continuous amino acid residue.Preferred epi-position of the present invention comprises: sequence SEQ ID NO:2 encoded polypeptides.The present invention includes the polynucleotide of these epi-positions of coding.Of the present invention in addition more preferably epi-position comprise corresponding to the born of the same parents' outer shroud of familial acute myeloid leukemia relative new gene of the present invention (FAMLF) or the peptide of its fragment and variant, the for example amino acid of sequence SEQ ID NO:2 encoded polypeptides.

Antibody of the present invention also can be described or stipulates according to its cross reactivity.Comprise any other analogue of debond polypeptide of the present invention, straight antibody to homologue, homologue.In conjunction with being also included within the present invention with the antibody of the polypeptide of polypeptide of the present invention at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 65%, at least 60%, at least 55%, at least 50% consistent (using method known in the art and described herein to calculate).Discord is also included among the present invention with the polypeptide bonded antibody of polypeptide less than of the present invention 95%, less than 90%, less than 85%, less than 80%, less than 75%, less than 70%, less than 65%, less than 60%, less than 55%, less than 50% consistent (using method calculating known in the art and described herein).

Antibody of the present invention (comprise contain antibody fragment or its variant or by its molecule of forming) can combine people family impatient property marrow series leukemia relative new gene (FAMLF), polypeptide or the polypeptide fragment or the variant of coded polypeptide of sequence SEQ ID NO:2 and/or monkey familial acute myeloid leukemia relative new gene (FAMLF) in immunologic opsonin ground.Preferably, antibody mediated immunity of the present invention combines with human familial acute myeloid leukemia relative new gene (FAMLF) specifically.Preferably, antibody mediated immunity of the present invention combines with the familial acute myeloid leukemia relative new gene (FAMLF) of people and monkey specifically.And; Preferably; Antibody mediated immunity of the present invention combines people family impatient property marrow series leukemia relative new gene (FAMLF) and mouse familial acute myeloid leukemia relative new gene (FAMLF) more preferably specifically; Antibody mediated immunity of the present invention combines with people family impatient property marrow series leukemia relative new gene (FAMLF) specifically, and wherein this antibody has higher affinity to people family impatient property marrow series leukemia relative new gene (FAMLF) comparison mouse familial acute myeloid leukemia relative new gene (FAMLF).

As non-limitative example, if the antibody and the first antigen bonded dissociation constant (K _D) less than antibody for the second antigenic K _DThe time, can think that this antibody preferentially combines first antigen.

Antibody of the present invention can also be described or define according to itself and polypeptide bonded affinity of the present invention.Preferred binding affinity comprises having less than 5 * 10 ^-2M, 10 ^-2M, 5 * 10 ^-3M, 10 ^-3M, 5 * 10 ^-4M, 10 ^-4Those of the dissociation constant of M or Kd.Preferred binding affinity comprises having less than 5 * 10 ^-5M, 10 ^-5M, 5 * 10 ^-6M, 10 ^-6M, 5 * 10 ^-7M, 10 ^-7M, 5 * 10 ^-8M or 10 ^-8Those of the dissociation constant of M or Kd.Even preferred binding affinity comprises having less than 5 * 10 ^-9M, 10 ^-9M, 5 * 10 ^-10, 10 ^-10M, 5 * 10 ^-11M, 10 ^-11M, 5 * 10 ^-12M, 10 ^-12M, 5 * 10 ^-13M, 10 ^-13M, 5 * 10 ^-14M, 10 ^-14M, 5 * 10 ^-14M or 10 ^-15Those of the dissociation constant of M or Kd.

The present invention also provides competition ground to suppress antibody and epi-position bonded antibody of the present invention, and this is used for confirming that through known in the art any method of competitive bonded immunoassay for example described herein is definite.This antibody competition property ground suppresses at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 60% or at least 50% epi-position combination.

Antibody of the present invention can be as the agonist or the antagonist of polypeptide of the present invention.For example, the present invention includes and destroy receptor/ligand and the interactional antibody of polypeptide of the present invention partially or completely.Preferably, antibody of the present invention combines with the disclosed epitope of this paper or its part.The invention is characterized in receptor specific antibody and ligand specificity's antibody.The present invention is a characteristic not hinder part to combine but stop the receptor specific antibody of receptor activation also.Receptor activation (being the signal transmission) can be confirmed through described herein or other technology known in the art.For example, can detect the phosphorylation (for example tyrosine or serine/threonine) of acceptor or its substrate, confirm receptor activation through using immunoprecipitation and western engram analysis (seeing above-mentioned) subsequently.

The invention still further relates to and not only stop part to combine but also stop receptor specific antibody and identification receptor one ligand complex of receptor activation and the antibody of unconjugated acceptor of specific recognition or unconjugated part not preferably.Equally, the present invention also comprises the neutralizing antibody that combines and stop part and receptors bind with part, and combines to stop receptor activation thus with part but the antibody that do not stop part and receptors bind.The present invention also comprises the antibody of activated receptor.These antibody can be used as receptor stimulant and work, and promptly through for example inducing receptor dimerizationization, strengthen or activate the BA of the ligand-mediated receptor activation of all or part.These antibody can be confirmed as agonist, antagonist or the inverse agonist of BA (particular biological that comprises the disclosed peptide of the present invention of this paper is active).Above-mentioned antibody agonist can use the means known in the art preparation.

Immunologic opsonin ground combines the antibody of familial acute myeloid leukemia relative new gene (FAMLF) or its fragment or variant, comprises the polypeptide of aminoacid sequence of any light chain of any heavy chain with the anti-familial acute myeloid leukemia of the present invention relative new gene (FAMLF) antibody expression expression of cell lines and/or the anti-familial acute myeloid leukemia of the present invention relative new gene (FAMLF) antibody expression expression of cell lines.Immunologic opsonin ground combines the antibody of familial acute myeloid leukemia relative new gene (FAMLF) or its fragment or variant, comprises the polypeptide of aminoacid sequence in any one light chain VL territory of any one heavy chain VH territory with the anti-familial acute myeloid leukemia of the present invention relative new gene (FAMLF) antibody expression expression of cell lines and/or the anti-familial acute myeloid leukemia of the present invention relative new gene (FAMLF) antibody expression expression of cell lines.Antibody of the present invention comprises the VH territory of the single anti-familial acute myeloid leukemia relative new gene of the present invention (FAMLF) antibody expression expression of cell lines and the aminoacid sequence in VL territory.Antibody of the present invention comprises the expressed VH territory of the present invention's two kinds of anti-familial acute myeloid leukemias of difference relative new gene (FAMLF) antibody expression clone and the aminoacid sequence in VL territory.The present invention also comprises following molecule; Said molecule comprise immunologic opsonin ground combine familial acute myeloid leukemia relative new gene (FAMLF), the VH of the anti-familial acute myeloid leukemia of the present invention relative new gene (FAMLF) antibody expression expression of cell lines and/or the antibody fragment or the variant in VL territory; Or form by it, the present invention also comprises the nucleic acid molecule of these VH of coding and VL territory, molecule, fragment and/or variant.

The present invention also provides immunologic opsonin ground to combine the antibody of familial acute myeloid leukemia relative new gene (FAMLF) polypeptide or polypeptide fragment or variant; Wherein said antibody comprises following polypeptide or is made up of following polypeptide, and this polypeptide has the aminoacid sequence of in the heavy chain of one or more anti-familial acute myeloid leukemia relative new gene (FAMLF) antibody expression expression of cell lines of the present invention any one, two, three or more a plurality of VH CDR.

Especially; The present invention provide comprise following polypeptide or form by following polypeptide, immunologic opsonin ground combines the antibody of familial acute myeloid leukemia relative new gene (FAMLF), said polypeptide to have the aminoacid sequence of VH CDR1 in the heavy chain of one or more anti-familial acute myeloid leukemia relative new gene (FAMLF) antibody expression expression of cell lines of the present invention.Immunologic opsonin ground combines the antibody of familial acute myeloid leukemia relative new gene (FAMLF) to comprise following polypeptide or is made up of it, and wherein said polypeptide has the aminoacid sequence of VH CDR2 in the heavy chain of one or more anti-familial acute myeloid leukemia relative new gene (FAMLF) antibody expression expression of cell lines of the present invention.Immunologic opsonin ground combines the antibody of familial acute myeloid leukemia relative new gene (FAMLF) to comprise following polypeptide or is made up of it, and wherein said polypeptide has the aminoacid sequence of VH CDR3 in the heavy chain of one or more anti-familial acute myeloid leukemia relative new gene (FAMLF) antibody expression clone of the present invention Yuan Da.Comprise these antibody or antibody fragment or its variant and immunologic opsonin ground and combine the molecule of familial acute myeloid leukemia relative new gene (FAMLF) or familial acute myeloid leukemia relative new gene (FAMLF) fragment or its variant to be also included within the present invention, in the nucleic acid molecule of encode equally these antibody, molecule, fragment and/or variant is also included within.

The present invention also provides immunologic opsonin ground to combine the antibody of familial acute myeloid leukemia relative new gene (FAMLF) polypeptide or polypeptide fragment or variant; Wherein said antibody comprises following polypeptide or is made up of it, and said polypeptide has the aminoacid sequence of in the light chain of one or more anti-familial acute myeloid leukemia relative new gene (FAMLF) antibody expression expression of cell lines of the present invention any one, two, three or more a plurality of VL CDR.Especially; The present invention provide comprise following polypeptide or form by following polypeptide, immunologic opsonin ground combines the antibody of familial acute myeloid leukemia relative new gene (FAMLF), said polypeptide to have the aminoacid sequence of VL CDR1 in the light chain of one or more anti-familial acute myeloid leukemia relative new gene (FAMLF) antibody expression expression of cell lines of the present invention.Immunologic opsonin ground combines the antibody of familial acute myeloid leukemia relative new gene (FAMLF) to comprise following polypeptide or is made up of it, and wherein said polypeptide has the aminoacid sequence of VLCDR2 in the light chain of one or more anti-familial acute myeloid leukemia relative new gene (FAMLF) antibody expression expression of cell lines of the present invention.Immunologic opsonin ground combines the antibody of familial acute myeloid leukemia relative new gene (FAMLF) to comprise following polypeptide or is made up of it, and wherein said polypeptide has the aminoacid sequence of VL CDR3 in the light chain of one or more anti-familial acute myeloid leukemia relative new gene (FAMLF) antibody expression clone of the present invention Yuan Da.Comprise these antibody or antibody fragment or its variant and immunologic opsonin ground and combine the molecule of familial acute myeloid leukemia relative new gene (FAMLF) or familial acute myeloid leukemia relative new gene (FAMLF) fragment or its variant to be also included within the present invention, in the nucleic acid molecule of encode equally these antibody, molecule, fragment and/or variant is also included within.

The present invention also provides the antibody that immunologic opsonin ground combines familial acute myeloid leukemia relative new gene (FAMLF) polypeptide or familial acute myeloid leukemia relative new gene (FAMLF) polypeptide fragment or variant (comprise contain antibody fragment or variant or by its molecule of forming); Wherein said antibody comprises, two, three or more a plurality of VH CDR and, two, three or more a plurality of VL CDR in expressed heavy chain of one or more anti-familial acute myeloid leukemia relative new gene (FAMLF) antibody expression clones of the present invention or the light chain, or is made up of them.Especially; The present invention provides immunologic opsonin to combine the antibody of familial acute myeloid leukemia relative new gene (FAMLF) polypeptide or polypeptide variants or variant; Wherein said antibody comprises VH CDR1 and VL CDR1, VH CDR1 and VL CDR2, VH CDR1 and VL CDR3, VH CDR2 and VL CDR1, VH CDR2 and VL CDR2, VHCDR2 and VL CDR3, VH CDR3 and VH CDR1, VH CDR3 and VL CDR2, VH CDR3 and VL CDR3 or their any combination of VH CDR and VL CDR in expressed heavy chain of one or more anti-familial acute myeloid leukemia relative new gene (FAMLF) antibody expression clones of the present invention or the light chain, or is made up of them.In these combinations one or more come from the single anti-familial acute myeloid leukemia relative new gene of the present invention (FAMLF) antibody expression clone.Fragment or the variant or the molecule that be made up of it, immunologic opsonin familial acute myeloid leukemia relative new gene (FAMLF) that comprise these antibody are also contained in the present invention, in the nucleic acid molecule of encode equally these antibody, molecule, fragment or variant is also included within.

The present invention also provides the nucleic acid molecule of code book invention antibody (comprise contain antibody fragment or its variant or by its molecule of forming), generally is isolated nucleic acid molecule.The following antibody of nucleic acid molecule encoding of the present invention (comprise contain antibody fragment or its variant or by its molecule of forming); Said antibody comprises VH territory and the VL territory of aminoacid sequence of the light chain with the anti-familial acute myeloid leukemia of the present invention relative new gene (FAMLF) antibody expression expression of cell lines of aminoacid sequence in any VH territory of the heavy chain with the anti-familial acute myeloid leukemia of the present invention relative new gene (FAMLF) antibody expression expression of cell lines, or is made up of them.The following antibody of nucleic acid molecule encoding of the present invention (comprise contain antibody fragment or its variant or by its molecule of forming); Said antibody comprise the heavy chain with the anti-familial acute myeloid leukemia of the present invention relative new gene (FAMLF) antibody expression expression of cell lines any VH territory aminoacid sequence the VH territory or have the VL territory of aminoacid sequence of the light chain of the anti-familial acute myeloid leukemia of the present invention relative new gene (FAMLF) antibody expression expression of cell lines, or form by them.

The variant (comprising verivate) that comprises antibody molecule described herein (for example VH territory and/or VL territory) also is provided in the present invention or by its antibody of forming, wherein this antibody mediated immunity combines familial acute myeloid leukemia relative new gene (FAMLF) or its fragment or variant specifically.Can use standard technique well known by persons skilled in the art to suddenly change and introduce in the nucleotide sequence of code book invention molecule, these technology comprise site-directed mutagenesis and the PCR mediated mutagenesis that for example causes amino acid replacement.Preferably, this variant (comprising verivate) coding is less than 50 amino acid replacements, is less than 40 amino acid replacements, is less than 30 amino acid replacements, is less than 25 amino acid replacements, is less than 20 amino acid replacements, is less than 15 amino acid replacements, is less than 10 amino acid replacements, is less than 5 amino acid replacements, is less than 4 amino acid replacements, is less than 3 amino acid replacements or is less than 2 amino acid replacements (with respect to for VH territory, VH CDR1, VH CDR2, VH CDR3, VL territory, VL CDR1, VL CDR2 or VL CDR3)." conserved amino acid substitutes " is meant amino-acid residue is replaced by the amino-acid residue that has with the side chain of similar electric charge.Has the existing in the prior art definition of amino-acid residue family with the side chain of similar electric charge.These families comprise and have basic side chain (Methionin for example; L-arginine; Histidine); Acid side-chain (aspartic acid for example; L-glutamic acid); Uncharged polar side chain (glycocoll for example; L-asparagine; Stimulina; Serine; Threonine; Tyrosine; Halfcystine); Non-polar sidechain (L-Ala for example; Xie Ansuan; Leucine; Isoleucine; Phenylalanine(Phe); Methionine(Met); Tryptophane); β branched building block (Threonine for example; Xie Ansuan; Isoleucine) and aromatic side chain (tyrosine for example; Phenylalanine(Phe); Tryptophane; Histidine) amino acid.Perhaps; Can be along all or part of encoding sequence; For example introduce sudden change randomly through saturation mutagenesis, and can be with regard to the two mutants of the BA screening institute two mutants that obtains with evaluation retentive activity (ability that for example combines familial acute myeloid leukemia relative new gene).

Immunologic opsonin ground combines the antibody of the present invention (comprise contain its antibody fragment or variant or by its molecule of forming) of familial acute myeloid leukemia relative new gene (FAMLF) polypeptide or its fragment or variant; Comprise following nucleotide sequence coded aminoacid sequence or form by it; The nucleotide sequence hybridization of said nucleotide sequence and the encoding sequence in VH that is complementary to one or more anti-familial acute myeloid leukemia relative new gene (FAMLF) antibody expression expression of cell lines of the present invention or VL territory; The condition of said hybridization is a stringent condition; As with filter membrane combine DNA in 6 * sodium chloride/sodium citrate (SSC), to hybridize under about 45 ℃, work one or repeatedly washing under about 50-65 ℃ in 0.2 * SSC/0.1%SDS afterwards; Highly stringent condition as with the filter membrane bind nucleic acid is hybridized under about 45 ℃ in 6 * SSC, work one or repeatedly washing under about 68 ℃ in 0.1 * SSC/0.2%SDS afterwards; Or other tight hybridization conditions well known by persons skilled in the art.The nucleic acid molecule of these antibody of encoding is also included within the present invention.

As well known in the art, polypeptide or its fragment or variant with similar aminoacid sequence usually have similar structure and many identical BAs.Therefore; Immunologic opsonin ground combines the antibody (comprising the molecule that contains its antibody fragment or variant or be made up of them) of familial acute myeloid leukemia relative new gene (FAMLF) polypeptide or familial acute myeloid leukemia relative new gene (FAMLF) polypeptide fragment or variant; Comprise VH territory with following aminoacid sequence or be made up of it, the aminoacid sequence in the VH territory of the heavy chain that the anti-familial acute myeloid leukemia of said aminoacid sequence and the present invention relative new gene (FAMLF) antibody expression clone is expressed has at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% consistence.

Immunologic opsonin ground combines the fragment of familial acute myeloid leukemia relative new gene (FAMLF) polypeptide or familial acute myeloid leukemia relative new gene (FAMLF) polypeptide or the antibody of variant (comprising the molecule that contains its antibody fragment or variant or be made up of them); Comprise VL territory with following aminoacid sequence or be made up of it, the aminoacid sequence in the VL territory of the light chain that the anti-familial acute myeloid leukemia of said aminoacid sequence and the present invention relative new gene (FAMLF) antibody expression clone is expressed has at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% consistence.

The present invention also comprises the antibody (comprising the molecule that contains its antibody fragment or variant or be made up of them) that has one or more identical biological properties with one or more antibody described herein.So-called " biological property " is meant the external or activity in vivo or the character of antibody, as combining the ability of familial acute myeloid leukemia relative new gene (FAMLF) (for example being expressed in the fragment or the variant of familial acute myeloid leukemia relative new gene (FAMLF), the chimeric familial acute myeloid leukemia of film relative new gene (FAMLF) and/or the familial acute myeloid leukemia relative new gene (FAMLF) of cell surface); Basically suppress or destruction familial acute myeloid leukemia relative new gene (FAMLF) and familial acute myeloid leukemia relative new gene (FAMLF) part bonded ability: the downward modulation cell surface is attend the ability of family's impatient property marrow series leukemia relative new gene (FAMLF) expression of polypeptides; Suppress or destroy the ability of the BA of familial acute myeloid leukemia relative new gene (FAMLF) mediation.Randomly, the identical epi-position of at least a antibodies specifically mentioned of antibody of the present invention and this paper.This epi-position combines to use assay method known in the art to confirm.

With the antibody of familial acute myeloid leukemia relative new gene (FAMLF) (comprising the molecule that contains its antibody fragment or variant or be made up of them), said antibody comprised the part (for example VHCDR1, VH CDR2, VH CDR3, VL CDR1, VL CDR2 and/or VL CDR3) in antibody VH of the present invention or VL territory or is made up of it during the present invention also provided.For example, the antibody of " in familial acute myeloid leukemia relative new gene (FAMLF) or its fragment or variant " can be to reduce or thoroughly destroy the antibody that familial acute myeloid leukemia relative new gene (FAMLF) or its fragment or variant combine the ability of its part; And/or thoroughly destroy or suppress the antibody that familial acute myeloid leukemia relative new gene (FAMLF) signal transmits cascade.In with the antibody of familial acute myeloid leukemia relative new gene (FAMLF), comprise the polypeptide of aminoacid sequence, or form by it with antibody VH territory of the present invention or its fragment or variant and antibody VL territory of the present invention or its fragment or variant.In with the antibody of familial acute myeloid leukemia relative new gene (FAMLF), comprise have monospecific antibody of the present invention many skins of aminoacid sequence of VH territory and VL territory or its fragment or variant of (or scFv or Fab fragment), or form by it.In with familial acute myeloid leukemia relative new gene (FAMLF)) antibody, comprise the polypeptide of aminoacid sequence, or form by it with antibody VH territory of the present invention or its fragment or variant.In with the antibody of familial acute myeloid leukemia relative new gene (FAMLF), comprise the polypeptide of aminoacid sequence, or form by it with antibody VL territory of the present invention or its fragment or variant.In with the antibody of familial acute myeloid leukemia relative new gene (FAMLF) or its fragment or variant, comprise the polypeptide of aminoacid sequence, or form by it with antibody VH of the present invention CDR territory or its fragment or variant.In with the antibody of familial acute myeloid leukemia relative new gene (FAMLF) or its fragment or variant, comprise the polypeptide of aminoacid sequence, or form by it with antibody VH of the present invention CDR3 territory or its fragment or variant.In with the antibody of familial acute myeloid leukemia relative new gene (FAMLF) or its fragment or variant, comprise the polypeptide of aminoacid sequence, or form by it with antibody VLCDR territory of the present invention or its fragment or variant.In with the antibody of familial acute myeloid leukemia relative new gene (FAMLF) or its fragment or variant, comprise the polypeptide of aminoacid sequence, or form by it with antibody VL of the present invention CDR3 territory or its fragment or variant.The nucleic acid molecule of these antibody of encoding is also included within the present invention.

The present invention also provides the antibody (comprise contain its antibody fragment or variant or by its molecule of forming) of the cell surface expression (measuring through any currently known methods in this area, for example the facs analysis assay method) of downward modulation familial acute myeloid leukemia relative new gene (FAMLF).As a kind of non-limiting hypothesis, this downward modulation possibly be the result of familial acute myeloid leukemia relative new gene (FAMLF) internalization of antibody induction.Said antibody comprises the part (for example VH CDR1, VH CDR2, VH CDR3, VL CDR1, VL CDR2, VL CDR3) of VH or VL territory or its fragment or the variant of the aminoacid sequence with antibody of the present invention or is made up of it.The antibody of cell surface expression of downward modulation familial acute myeloid leukemia relative new gene (FAMLF) comprises the polypeptide of the aminoacid sequence with antibody VH territory of the present invention or its fragment or variant and antibody VL territory of the present invention or its fragment or variant or is made up of it.

The antibody of cell surface expression of downward modulation familial acute myeloid leukemia relative new gene (FAMLF) comprises to have from the polypeptide of the aminoacid sequence of the VH territory of monospecific antibody of the present invention (or scFv or Fab fragment) and VL territory or its fragment or variant or by it and forms.The antibody of cell surface expression of downward modulation familial acute myeloid leukemia relative new gene (FAMLF) comprises the polypeptide of the aminoacid sequence with antibody VH territory of the present invention or its fragment or variant or is made up of it.The antibody of cell surface expression of downward modulation familial acute myeloid leukemia relative new gene (FAMLF) comprises the polypeptide of the aminoacid sequence with antibody VL territory of the present invention or its fragment or variant or is made up of it.The antibody of cell surface expression of downward modulation familial acute myeloid leukemia relative new gene (FAMLF) comprises the polypeptide of the aminoacid sequence with antibody VH CDR3 of the present invention or its fragment or variant or is made up of it.The antibody of cell surface expression of downward modulation familial acute myeloid leukemia relative new gene (FAMLF) comprises the polypeptide of the aminoacid sequence with antibody VLCDR3 of the present invention or its fragment or variant or is made up of it.The nucleic acid molecule of these antibody of encoding is also included within the present invention.

The present invention also provides increases the active antibody of familial acute myeloid leukemia relative new gene (FAMLF) (comprise contain its antibody fragment or variant or by its molecule of forming), and said antibody comprises the part (for example VH CDR1, VH CDR2, VH CDR3, VL CDR1, VL CDR2, VL CDR3) of VH with antibody of the present invention or VL territory or its fragment or variant or is made up of it.Increase the active antibody of familial acute myeloid leukemia relative new gene (FAMLF), comprise the polypeptide of aminoacid sequence or form by it with antibody VH territory of the present invention or its fragment or variant and antibody VL territory of the present invention or its fragment or variant.Increase the active antibody of familial acute myeloid leukemia relative new gene (FAMLF), comprise to have and form from the polypeptide of the aminoacid sequence of the VH territory of monospecific antibody of the present invention (or scFv or Fab fragment) and VL territory or its fragment or variant or by it.Increase the active antibody of familial acute myeloid leukemia relative new gene (FAMLF), comprise the polypeptide of aminoacid sequence or form by it with antibody VH territory of the present invention or its fragment or variant.Increase the active antibody of familial acute myeloid leukemia relative new gene (FAMLF), comprise the polypeptide of aminoacid sequence or form by it with antibody VL territory of the present invention or its fragment or variant.Increase the active antibody of familial acute myeloid leukemia relative new gene (FAMLF), comprise the polypeptide of aminoacid sequence or form by it with VH CDR territory or its fragment or variant.Increase the active antibody of familial acute myeloid leukemia relative new gene (FAMLF), comprise the polypeptide of aminoacid sequence or form by it with antibody VH CDR3 of the present invention or its fragment or variant.Increase the active antibody of familial acute myeloid leukemia relative new gene (FAMLF), comprise the polypeptide of aminoacid sequence or form by it with antibody VL of the present invention CDR city or its fragment or variant.Increase the active antibody of familial acute myeloid leukemia relative new gene (FAMLF), comprise the polypeptide of aminoacid sequence or form by it with antibody VL CDR3 of the present invention or its fragment or variant.The nucleic acid molecule of these antibody of encoding is also included within the present invention.

The present invention also provides and comprises that immunologic opsonin ground combines antibody (comprise and contain its antibody fragment or variant) and the heterologous polypeptide of familial acute myeloid leukemia relative new gene (FAMLF) or by its fusion rotein of forming.Preferably, the heterologous protein with the antibody fusion is useful or useful for target familial acute myeloid leukemia relative new gene (FAMLF) express cell for function.Fusion rotein of the present invention comprises following polypeptide or its fragment or variant and allogeneic polypeptide sequence or is made up of them, and said polypeptide has the aminoacid sequence in any one or more VH of antibody of the present invention territory or the aminoacid sequence in any one or more VL of antibody of the present invention territory.Fusion rotein of the present invention comprises following polypeptide or its fragment or variant and allogeneic polypeptide sequence, and said polypeptide has any, two, three or the aminoacid sequence of more a plurality of VH CDR or any, two, three or the aminoacid sequence of more a plurality of VL CDR of antibody of the present invention of antibody of the present invention.This fusion rotein comprises following polypeptide or its fragment or variant and allogeneic polypeptide sequence; Wherein said polypeptide has the aminoacid sequence of antibody VH CDR3 of the present invention, and this fusion rotein can combine familial acute myeloid leukemia relative new gene (FAMLF) in immunologic opsonin ground.Fusion rotein comprises following polypeptide or its fragment or variant and allogeneic polypeptide sequence, and wherein said polypeptide has the aminoacid sequence at least one VH territory of antibody of the present invention and the aminoacid sequence at least one VL territory of antibody of the present invention.Preferably, the VH of fusion rotein and VL territory are corresponding to monospecific antibody of the present invention (or scFv or Fab fragment).Fusion rotein of the present invention comprises following polypeptide or its fragment or variant and allogeneic polypeptide sequence or is made up of them, and said polypeptide has any, two, three or the aminoacid sequence of more a plurality of VH CDR and any, two, three or the aminoacid sequence of more a plurality of VL CDR of antibody of the present invention of antibody of the present invention.Preferably, two, three, four, five, six among these VH CDR or the VL CDR or more a plurality of corresponding to monospecific antibody of the present invention (or scFv or Fab fragment).The nucleic acid molecule of these fusion roteins of encoding is also included within the present invention.

Antibody of the present invention can be used for comprising external and intravital diagnosis and treat-ment such as but not limited to purifying, detection and target polypeptide of the present invention.For example, can these antibody be used for immunoassay quantitatively and qualitatively to measure the level of biological sample polypeptide of the present invention.

Antibody of the present invention can give individuality with the mode of passive immunization.Perhaps, can use polypeptide of the present invention to carry out epitope mapping to identify this antibody institute bonded epi-position.The epi-position of identifying in this way can for example be used as vaccine candidate object again, promptly is used for immune body and causes the familial acute myeloid leukemia relative new gene (FAMLF) to crude form.

As in greater detail following, antibody of the present invention can use separately or use with other combination of compositions.Can also these antibody domain heterologous polypeptides be merged at N or C end through recombination form, or make these antibody and polypeptide or other compsn put together (comprising covalency and non-covalent puting together) through chemical mode.For example, antibody of the present invention can be used molecule and effector molecule such as heterologous polypeptide, medicine, radionuclide or the toxin fusion of marking through recombination form and in test experience or put together.

Antibody of the present invention comprises the for example verivate through this antibody covalent attachment any kind molecule is modified.For example; But do not constitute restriction; This antibody derivatives comprises through the antibody of modifying, and derivatize, the proteolyze that the example of said modification has glycosylation, acetylize, PEGization (pegylation), phosphorylation, amidation, carry out through known protection/blocking groups cuts, is connected with cell ligand or other albumen etc.Many chemically modifieds can be carried out through known technology, include but not limited to that the metabolism of special chemical chop, acetylize, formylation, tunicamycin is synthetic etc.In addition, this verivate can also contain one or more nonclassical amino acids.

Antibody of the present invention can produce through any suitable currently known methods in this area.Can be to the antigenic polyclonal antibody of purpose through several different methods preparation well known in the art.For example, can polypeptide of the present invention be applied to multiple host animal, include but not limited to rabbit, mouse, rat etc., contain special serum generation to this antigenic polyclonal antibody to induce.According to host species; Can use multiple adjuvant to strengthen this immunne response, these adjuvants include but not limited to human adjuvant such as the BCG (BCG-CWS) and the corynebacterium parvum (Corynebacterium parvum) of freund's adjuvant (completely with incomplete), mineral rubber such as white lake, surfactant such as SUNLECITHIN A, poly alcohol, polyanion, peptide, oiliness emulsion, keyhole limpet hemocyanin, dinitrophenol(DNP) and potentially useful.These adjuvants are well known in the art.

Monoclonal antibody can use extensive multiple technologies known in the art to prepare, and these technology comprise uses hybridoma, reorganization, display technique of bacteriophage or their combination.For example, can use hybridoma technology, comprise known in the art and like Harlow etc., antibody: laboratory manual (Cold Spring Harbor Laboratory Press, the 2nd edition, 1988); Hammerling etc., (Elsevier, N.Y.1981) hybridoma technology of instruction prepares monoclonal antibody in (said reference is intactly incorporated this paper into as a reference) for monoclonal antibody and T quadroma 563-581.Term " monoclonal antibody " is meant and derives from monospecific polyclonal, comprises eucaryon, protokaryon or bites mattress body clone's antibody, but not refer to its preparation method.

The method of using hybridoma technology preparation and screening specific antibody is conventional with well known in the art.Can use polypeptide of the present invention or express the cellular immunization mouse of this peptide.In case detect immunne response, promptly in the serum of mouse, detect specially to behind this antigenic antibody, gather in the crops spleen and the separating Morr. cell of mouse.Through knowing technology these splenocytes and any suitable myeloma cell are merged then.Through limiting dilution screening and clone hybridization knurl.Analyze hybridoma through methods known in the art then, to seek the cell that secretion can combine the antibody of polypeptide of the present invention.Can produce the ascites that generally contains high-level antibody through using positive hybridoma clone immune mouse.

Therefore; The antibody that the present invention provides the preparation monoclonal antibody method and produces through this method; Said method comprises the hybridoma of cultivating secretion antibody of the present invention; Wherein preferably this hybridoma is can combine the hybridoma of the antibody of polypeptide of the present invention to clone through separating from using splenocyte and the myeloma cell of the mouse of antigen immune of the present invention to merge generation, and screen then the hybridoma that merges generation to seek secretion.

Another well-known process of the human B clone of preparation polyclone and mono-clonal is to use Epstein-Barr virus (EBV) to transform.The working method of the B clone that preparation EBV transforms is that this area is known usually; Current Protocols in Immunology (volume such as Coligan for example; 1994, John Wiley&Sons, the 7.22nd working method that chapter is given of NY) (intactly incorporating this paper hereby into as a reference).The source of the B cell that is used to transform is human peripheral normally, but the B cell that is used to transform also can derive from other source, includes but not limited to the tissue of lymphoglandula, tonsilla, spleen, tumor tissues and infection.Generally before EBV transforms, tissue is processed single-cell suspension liquid.In addition, can take steps to remove or inactivation contains the T cell in the sample of B cell, because can suppress the B cell immortalityization that EBV causes from the T cell of anti-EBV antibody serum positive individuals with physics.Generally, contain the sample of human B cell, and cultivate 3-4 week with the EBV inoculation.The typical case source of EBV is the culture supernatants of B95-8 clone.Generally can when finishing, during cultivation observe the physics sign that EVB transforms in 3-4 week.Through phase microscope, transformant can show as greatly, becomes clear, crinosity and tendency are assembled and be cell cluster closely.At first, EBV system generally is polyclonal.Yet through secular cell cultures, EBV system can displacement be monoclonal or polyclonal owing to the quick growth of the selectivity of particular B cell clone.Perhaps, can with polyclone EBV transform be subclone (for example cultivating) through limiting dilution or make it to merge with suitable fusion partners and the limiting dilution bed board with acquisition mono-clonal B clone.For the EBV transformation cell lines, suitable fusion partners comprises mouse myeloma cell line (for example SP2/O, X63-Ag8.653), hetero hybridoma cells system (people * mouse: for example SPAM-8, SBC-H20 and CB-F7) and human cell line (for example GM 1500, SKO-007, RPMI 8826 and KR-4).Therefore, the present invention also provides the method for preparation to polypeptide of the present invention or its segmental polyclone or monoclonal human antibody, and this method comprises that EBV transforms human B cell.

The antibody fragment of identification specific epitopes can produce through known technology.For example, Fab of the present invention and F (ab ') 2 fragments can be through using for example papoid (producing the Fab fragment) or stomach en-(produce F (ab ') 2 fragments of enzyme) the proteolyze immunoglobulin molecules produces.F (ab ') 2 fragments contain the CH1 district of variable region, constant region of light chain and heavy chain.

For example, antibody of the present invention also can use the multiple mattress body display library of biting known in the art to produce.In biting mattress body display method, the functional antibodies territory be illustrated in have coding its polynucleotide sequence bite mattress body particulate surface.This bites the mattress body can be used for showing the antigen binding domain from repertoire or combinatorial antibody library (for example people or mouse) expression.Can use antigen, the antigen of applying marking or combine with solid surface or pearl or for example by its antigen of catching, select or identify express the antigenic antigen binding domain of binding purposes bite the mattress body.The mattress body of biting that is used for these methods typically is a filobactivirus, comprises fd and M13, and there are gene III of recombination form and phage or the stable Fv antibody domain of Fab, Fv or disulfide linkage that gene VIII albumen merges in the combination territory of phage expression.The example that can be used for preparing the phage display method of antibody of the present invention comprises those that are disclosed in following document: Brinkman etc., J.Immunol.Methods 182:41-50 (1995); Ames etc., J.Immunol.Methods 184:177-186 (1995); Kettleborough etc., Eur.J.Immunol.24:952-958 (1994); Persic etc., Gene 187:9-18 (1997); Burton etc., Advances in Immunology 57:191-280 (1994); PCT applies for PCT/GB9I/01134; The open text WO90/02809 of PCT; WO 91/10737; WO 92/01047:WO 92/18169; WO 93/11236:WO 95/15982:20 95/20401; With USP 5,698,426; 5,223,409; 5,403,484; 5,580,717; 5,427,908; 5,750,753; 5,821,047; 5,571,698; 5,427,908; 5,516,637; 5,780,225; 5,658,727; 5,733,743 and 5,969,108; All all intactly incorporate this paper into as a reference.

People's antibody is particularly suitable for treating human patients completely.People's antibody can be through several different methods known in the art preparation, comprises the above-mentioned mattress body display method of biting of using the antibody library that derives from the human normal immunoglobulin sequence to carry out.See for example USP 4,444,887 and 4,716,111; With the open text WO 98/46645 of PCT, WO 98/50433, and WO 98/24893, and WO 98/16654, and WO 96/34096, WO 96/33735 and WO 91/10741; All all intactly incorporate this paper into as a reference.

Can also use can not the endogenous immune jujube albumen of expressive function property but but the transgenic mice of expressing human immunoglobulin gene prepares people's antibody.For example, can in mouse embryo stem cell, introduce people's heavy chain and light chain immunoglobulin gene mixture randomly or through homologous recombination.Perhaps, can in mouse embryo stem cell, introduce people variable region, constant region and diversity region and people's heavy chain and light chain gene.Can be individually or when introducing the human normal immunoglobulin site, cause the afunction of murine heavy chain and light chain immunoglobulin gene through homologous recombination.Especially, the homozygous deletion in JH district can stop endogenous antibody to produce.The embryonic stem cell of this modification and it is injected in the blastocyst to produce gomphosis mouse increases.Raise gomphosis mouse then to produce the offspring of isozygotying of expressing human antibody.Use selected antigen with normal way, for example this transgenic mice of all or part of immunity of polypeptide of the present invention.Use conventional hybridization knurl technology to obtain to this antigenic monoclonal antibody from this immune transgenic mice.The human normal immunoglobulin transgenic that transgenic mice comprises is reset in the B cell differentiation procedure, and subsequently through classification conversion and somatic mutation.Thus, use this technology can prepare treatment and go up useful IgG, IgA, IgM and IgE antibody.About the summary of this technology of preparation people antibody, see Lonberg and Huszar, Int.Rev.Immun01.13:65-93 (1995).

For this technological working method that goes through and prepare these antibody of preparation people's antibody and human monoclonal antibodies, referring to the open text WO 98/24893:WO 92/01047 of for example PCT; WO96/33735; European patent O 598 877; USP 5,413,923; 5,625,126; 5,633,425; 5,569,825; 5,661,016; 5,545,806; 5,814,318; 5,885,793; 5,916,771; 5,939,598; 6,075,181; With 6,114,598, all intactly incorporate this paper into as a reference.In addition, can employ company for example Abgenix company (Fremont, CA) and Genpharm (San Jose CA) uses the technology be similar to aforesaid method to provide to selected antigenic people's antibody.

The antibody of people completely of discerning selected epi-position can use the technology that is called " guiding is selected (guided selection) " to produce.Selected non-human monoclonal antibodies is that mouse antibodies is used to instruct the fully human antibodies of selecting the identical epi-position of identification in this divides.(Jespers etc., Bio/technology 12:899-903 (1988)).

And, use technology well known to those skilled in the art, can use again polypeptide of the present invention Antibody Preparation " simulation ', the antiidiotypic antibody of polypeptide of the present invention.(see for example Greenspan&Bona, FASEB is (5) J.7: 437-444 (1989) and Nissinoff, J.Immunol.147 (8): 2429-2438 (1991)).For example, in conjunction with and competition suppresses the polypeptide multimerization of polypeptide of the present invention and/or can be used for preparation " simulation " polypeptide multimerization with the bonded antibody of part and/or combines the antiidiotypic antibody in territory, and be used for combination thus also and polypeptide and/or its part.Should in the Fab fragment of antiidiotypic antibody or this antiidiotype can be used for remedy with and polypeptide ligand.For example, can use this antiidiotypic antibody combination polypeptide of the present invention and/or combine its ligand/receptor, and activate or seal its BA thus.

Intrabody is from recombinating that nucleic acid molecule is expressed and through transforming the antibody that is trapped in (for example being trapped in tenuigenin, endoplasmic reticulum or pericentral siphon) in the cell, usually being scFv.Intrabody can be used for for example destroying the proteinic function of this intrabody bonded.The expression of intrabody can also use inducible promoter to regulate through cutting out at the expression of nucleic acid that comprises this intrabody in the body.Intrabody of the present invention can use the means known in the art preparation, for example open and summary those methods in following document: Chen etc., Hum.Gene Ther.5:595-601 (1994); Marasco, W.A.Gene Ther.4:11-15 (1997); Rondon and Marasco, Annu.Rev.Microbiol.51; 257-283 (1997); Proba etc., J.Mol.Bi01.275:245-253 (1998); Cohen etc., Oncogene 17:2445-2456 (1998); Ohage and Steipe, J.Mol.Biol.291:1119-1128 (1999); Ohage etc., J.Mol.Biol.291:1 129-1134 (1999): Wirtz and Steipe, Protein Sci.8:2245-2250 (1999): Zhu etc., J.Immunol.Methods 231:207-222 (1999); Institute's citing document wherein.

XenoMouse technology: according to antibody of the present invention preferably through utilizing following transgenic mice preparation; Said transgenic mice has inserted the substantive part of people's antibody generation gene but on the production of antibodies of endogenous mouse source, had defective (for example can be from Abgenix Inc.; Fremont, the XenoMouse system that CA obtains).Then, these mouse can produce human normal immunoglobulin molecule and antibody and can't produce mouse source immunoglobulin molecules and antibody.Be used for realizing that the technology of this purpose is disclosed in the disclosed patent of this paper, application and reference.

The human site of clone and reconstruct megabasse size provides strong tool with the ability that is introduced into mouse propagation system in YAC, to illustrate greatly or the functional ingredient in the site of mapping roughly and produce useful human diseases model.And this The Application of Technology that replaces the mouse site with human Equivalent also can provide about the expression of Human genome product between the growth period and adjusting, they induce the unique view with process with the disease of the communication of other system and their participations.

The immunity system " humanization " that an important practical application of this strategy is a mouse.In the mouse with human normal immunoglobulin (Ig) site introducing endogenous Ig gene inactivation, mechanism and their effects in the B cell development of expressing and assembling for the sequencing of research antibody provide chance.And this strategy can improve the ideal source for preparation total man's monoclonal antibody (Mab), and this is towards an important milestone that realizes that the Antybody therapy human diseases is hoped.

The expection human antibody can minimize immunne response and anaphylaxis, and these are monoclonal antibody institute inherent of mouse or mouse-derived, thereby increase the efficient and the thoroughness of institute's administration of antibodies thus.Can expect that human antibody can provide substantial advantage in the treatment that requires the chronic of repetitive administration antibody and recurrent human diseases (for example cancer).

A kind of method that reaches this purpose be to use big segmental people Ig site transformation mouse antibodies prepare aspect defective mouse, expect that this mouse will produce a large amount of people's antibody repertoires and lack mouse antibodies.Big people Ig fragment will be preserved the variety of big variable gene and suitably regulated production of antibodies and expression.Through utilizing the mouse machine to make the antibody variation and screen and lack the tolerance to human protein, the people's antibody repertoire that in these mouse, duplicates should produce the high-affinity antibody to any purpose antigen (comprising the human antigen).The use hybridoma technology can easily prepare and selection has the specific antigen-specific human monoclonal antibodies of expectation.

This general strategy is got in touch 1994 disclosed first XenoMouse ^TMThe preparation of system is illustrated.See Green etc., Nature Genetics 7:13-21 (1994).This XenoMouse ^TMSystem utilizes yeast artificial chromosome (YACS) to transform, and said YACS contains 245kb and the people's heavy chain site of 10190kb size and the reproductive tract conformation fragment at κ light chain seat respectively, and it contains the sequence of core variable region and constant region.The YAC proof that for the rearrangement of antibody and expression, contains people Ig is compatible with the mouse system, and can substitute the mouse Ig gene of inactivation.This induces the ripe appearance people's repertoire of B cell development, generation human antibody and the ability of generation antigen-specific human monoclonal antibodies to be confirmed by it.These results also point out, and the introducing that contains the major part people Ig seat of the V gene of larger amt, additional regulatory element and people Ig constant region can be summarized infecting and people's body fluid of immunity is replied distinctive repertoire basically.Recently, the megabasse size reproductive tract conformation YAC fragment that expands to through introducing people's heavy chain seat and κ light chain seat respectively of the work of Green etc. imports about 80% above people's antibody repertoire with generation XenoMouse ^TMMouse. see Nature Genetics15:146-156 (1997) such as Mendez; Green and Jakobovits J.Exp.Med.188:483-495 (1998); Green; The U.S. Patent application 08/759,620 that Journal of Immunological Methods 231:11-23 (1999) and on December 3rd, 1996 submit to, the open of all these all incorporated into as a reference hereby.

Human anti-mouse antibody (HAMA) replys the industry that causes preparing chimeric or humanized antibody.Although chimeric antibody has human constant region and mouse variable region, expection can be observed the anti-embedding house antibody of some people (HACA) and reply, especially when long-term or multiple doses use antibody.Therefore, possibly expect to provide complete human antibodies, so that influence and/or effect that reduction HAMA or HACA reply to familial acute myeloid leukemia relative new gene (FAMLF) polypeptide.

Special monoclonal antibody to familial acute myeloid leukemia relative new gene (FAMLF) polypeptide is to use the hybridoma technology preparation.(Kohler etc., Nature 256:495 (1975): Kohler etc., Eur.J.Immunol.6:511 (1976); Kohler etc., Eur.J.Immunol.6:292 (1976); Hammerling etc., " monoclonal antibody and T quadroma ", Elsevier, N.Y. 571-681 page or leaf (1981)).In brief, with familial acute myeloid leukemia relative new gene (FAMLF) expression vector cells transfected immunity XenoMOuse ^TMMouse.After the immunity, extract the splenocyte of this mouse and itself and suitable myeloma cell line are merged.Any suitable myeloma cell line all can be used for the present invention.After the fusion, the hybridoma that obtains is optionally kept on the HAT substratum, clones through effective dilution then, referring to the description (Gastroenterology 80:225-232 (1981)) of Wands etc.Then the hybridoma that obtains through this selection is analyzed to identify that secretion can combine the clone of the antibody of familial acute myeloid leukemia relative new gene (FAMLF) polypeptide.

The present invention relates to the complete human antibodies that immunologic opsonin ground combines familial acute myeloid leukemia relative new gene (FAMLF) polypeptide, generally is isolating.Basically be, with the immunity of familial acute myeloid leukemia relative new gene (FAMLF) express cell from Abgenix, Inc. (Fremont, CA) the XenMouse mouse of expressing human antibody system (details of immune operation method); Reclaim spleen and/or LNC (containing the B cell) from mouse with the anti-familial acute myeloid leukemia of high titre relative new gene (FAMLF) antibody; And this is reclaimed cell merge to prepare the immortalization hybridoma cell line with medullary cell system.The screening hybridoma cell line produces special hybridoma cell line to immunogenic antibody to select and to identify.

The present invention includes immunologic opsonin ground and combine the antibody (comprise contain its antibody fragment or variant or by its molecule of forming) of familial acute myeloid leukemia relative new gene (FAMLF) polypeptide or its fragment, variant or fusion rotein.Familial acute myeloid leukemia relative new gene (FAMLF) polypeptide that familial acute myeloid leukemia relative new gene (FAMLF) polypeptide includes but not limited to or the polypeptide of dna encoding; Familial acute myeloid leukemia relative new gene (FAMLF) can prepare through the nucleic acid of recombinant expressed encoded polypeptides.

The polypeptide of the aminoacid sequence of any heavy chain that immunologic opsonin ground combines the antibody of familial acute myeloid leukemia relative new gene (FAMLF) or its fragment or variant to comprise to have at least a expression of cell lines and/or any light chain of at least a expression of cell lines.Immunologic opsonin ground combines the antibody of familial acute myeloid leukemia relative new gene (FAMLF) or its fragment or variant, comprises the polypeptide of aminoacid sequence in any light chain VL territory of any heavy chain VH territory with at least a expression of cell lines and/or at least a expression of cell lines.Antibody of the present invention comprises the VH territory of the same cell system expression that is selected from clone and the aminoacid sequence in VL territory.Antibody of the present invention comprise from VH territory and the aminoacid sequence in VL territory of different clones.Comprise the VH of at least a expression of cell lines and/or the antibody fragment or molecule variant or that form by them, immunologic opsonin ground combination familial acute myeloid leukemia relative new gene (FAMLF) in VL territory and be also included within the present invention, in the nucleic acid molecule of encode these VH and VL territory, molecule, fragment and/or variant is also included within.

The present invention also provides immunologic opsonin ground to combine the antibody of familial acute myeloid leukemia relative new gene (FAMLF) polypeptide or polypeptide fragment or variant; Wherein said antibody comprises following polypeptide or is made up of it, and said polypeptide has any one, two, three or the aminoacid sequence of more a plurality of VH CDR contained in the heavy chain of one or more expression of cell lines.Especially; The present invention provides immunologic opsonin ground to combine familial acute myeloid leukemia relative new gene (FAMLF) and comprises following polypeptide or by its antibody of forming, said polypeptide has the aminoacid sequence of VH CDR1 contained in the heavy chain of one or more expression of cell lines.Immunologic opsonin ground combines the antibody of familial acute myeloid leukemia relative new gene (FAMLF) to comprise following polypeptide or is made up of it, and said polypeptide has the aminoacid sequence of the contained VH CDR2 of the heavy chain of one or more expression of cell lines.Immunologic opsonin ground combines the antibody of familial acute myeloid leukemia relative new gene (FAMLF) to comprise following polypeptide or is made up of it, and said polypeptide has the aminoacid sequence of the contained VH CDR3 of the heavy chain of one or more expression of cell lines.Comprise these antibody or its antibody fragment or variant or form by them, immunologic opsonin combines the molecule of familial acute myeloid leukemia relative new gene (FAMLF) or familial acute myeloid leukemia relative new gene (FAMLF) fragment or its variant to be also included within the present invention, in the nucleic acid molecule of encode equally these antibody, molecule, fragment and/or variant is also included within.

The present invention also provides immunologic opsonin ground to combine the antibody of familial acute myeloid leukemia relative new gene (FAMLF) polypeptide or polypeptide fragment or variant; Wherein said antibody comprises following polypeptide or is made up of it, and said polypeptide has in the light chain of one or more expression of cell lines the aminoacid sequence of any one, two, three or more a plurality of VL CDR.Especially; The present invention provides immunologic opsonin ground to combine familial acute myeloid leukemia relative new gene (FAMLF) and comprises following polypeptide or by its antibody of forming, and said polypeptide has the aminoacid sequence of VL CDR1 in the light chain of one or more expression of cell lines.Immunologic opsonin ground combines the antibody of familial acute myeloid leukemia relative new gene (FAMLF) to comprise following polypeptide or is made up of it, and said polypeptide has the aminoacid sequence of VL CDR2 in the light chain of one or more expression of cell lines.Immunologic opsonin ground combines the antibody of familial acute myeloid leukemia relative new gene (FAMLF) to comprise following polypeptide or is made up of it, and said polypeptide has the aminoacid sequence of the contained VL CDR3 of the light chain of one or more expression of cell lines.Comprise these antibody or its antibody fragment or variant or form by them, immunologic opsonin combines the molecule of familial acute myeloid leukemia relative new gene (FAMLF) or familial acute myeloid leukemia relative new gene (FAMLF) fragment or variant to be also included within the present invention, in the nucleic acid molecule of encode equally these antibody, molecule, fragment and/or variant is also included within.

The present invention also provides immunologic opsonin ground to combine the polypeptide fragment of familial acute myeloid leukemia relative new gene (FAMLF) polypeptide or familial acute myeloid leukemia relative new gene (FAMLF) or the antibody of variant (comprise contain antibody fragment or its variant or by its molecule of forming); Wherein said antibody comprises the heavy chain of one or more expression of cell lines or, two, three or more a plurality of VH CDR and, two, three or more a plurality of VL CDR in the light chain, or is made up of them.Especially; The present invention provides immunologic opsonin ground to combine the antibody of familial acute myeloid leukemia relative new gene (FAMLF) polypeptide or polypeptide fragment or variant; Wherein said antibody comprises VH CDR1 and VL CDR1, VH CDR1 and VL CDR2, VH CDR1 and VL CDR3, VH CDR2 and VL CDR1, VH CDR2 and VL CDR2, VH CDR2 and VL CDR3, VH CDR3 and VHCDR1, VH CDR3 and VL CDR2, VH CDR3 and VL CDR3 or their any combination of VHCDR and VL CDR in heavy chain or the light chain of one or more expression of cell lines, or said antibody is made up of them.

Coding is corresponding to the nucleic acid molecule of anti-familial acute myeloid leukemia relative new gene (FAMLF) antibody of Xenomouse system source antibody

The present invention also provides the nucleic acid molecule of code book invention antibody (comprise contain its antibody fragment or variant or by its molecule of forming), is isolating as the one of which.The following antibody of nucleic acid molecule encoding of the present invention (comprise contain its antibody fragment or variant or by its molecule of forming); Said antibody comprises the VII territory and the amino acid whose VL territory with light chain of expression of cell lines shown at least a table 2 of the aminoacid sequence in any the VH territory with the expressed heavy chain of at least a clone, or is made up of them.The following antibody of nucleic acid molecule encoding of the present invention (comprise contain its antibody fragment or variant or by its molecule of forming); Said antibody comprise any the VH territory with the expressed heavy chain of at least a clone aminoacid sequence the VH territory or have the amino acid whose VL territory of the light chain of expression of cell lines shown at least a table 2, or form by them.

The variant (comprising verivate) that comprises antibody molecule described herein (for example VH territory and/or VL territory) also is provided in the present invention or by its antibody of forming, wherein this antibody mediated immunity combines familial acute myeloid leukemia relative new gene (FAMLF) or its fragment or variant specifically.Standard technique well known by persons skilled in the art can be used for sudden change is introduced the nucleotide sequence of code book invention molecule, comprises the site-directed mutagenesis and the PCR mediated mutagenesis that for example cause amino acid replacement.Preferably; Variant (comprising verivate) coding is less than 50 amino acid replacements, be less than 40 amino acid replacements, be less than 30 amino acid replacements, be less than 25 amino acid replacements, be less than 20 amino acid replacements, be less than 15 amino acid replacements, be less than 10 amino acid replacements, be less than 5 amino acid replacements, be less than 4 amino acid replacements, be less than 3 amino acid replacements or be less than 2 amino acid replacements (with respect to reference to the VH territory; Be VH CDR1, VH CDR2, VH CDR3; VL territory, i.e. VL CDR1, VL CDR2 or VL CDR3)." conserved amino acid substitutes " is meant amino-acid residue is replaced by the amino-acid residue that has with the side chain of similar electric charge.Has the existing in the prior art definition of amino-acid residue family with the side chain of similar electric charge.

These families comprise the amino acid of have basic side chain (for example Methionin, l-arginine, Histidine), acid side-chain (for example aspartic acid, L-glutamic acid), uncharged polar side chain (for example glycocoll, l-asparagine, Stimulina, Serine, Threonine, tyrosine, halfcystine), non-polar sidechain (for example L-Ala, Xie Ansuan, leucine, Isoleucine, proline(Pro), phenylalanine(Phe), methionine(Met), tryptophane), D branched building block (for example Threonine, Xie Ansuan, Isoleucine) and aromatic side chain (for example tyrosine, phenylalanine(Phe), tryptophane, Histidine). perhaps; Can be along all or part of encoding sequence; For example pass through saturation mutagenesis; Introduce sudden change randomly, and can be with regard to the two mutants of the BA screening institute two mutants that obtains with evaluation retentive activity (ability that for example combines familial acute myeloid leukemia relative new gene (FAMLF)).

Immunologic opsonin ground combines the antibody of the present invention (comprise contain its antibody fragment or variant or by its molecule of forming) of familial acute myeloid leukemia relative new gene (FAMLF) polypeptide or its fragment or variant; Comprise following nucleotide sequence coded aminoacid sequence or form by it; Said nucleotide sequence can with the nucleotide sequence hybridization of the encoding sequence in a kind of VH that is complementary to one or more expression of cell lines or VL territory; The condition of said hybridization is a stringent condition; For example with filter membrane bonded DNA about 45 ℃ of hybridization down in 6 * sodium chloride/sodium citrate (SSC), work one or repeatedly washing under about 50-65 ℃ in 0.2 * SSC/0.1%SDS afterwards; The height stringent condition is for example with the about 45 ℃ of hybridization down in 6 * SSC of filter membrane bonded nucleic acid, work one or repeatedly washing under about 68 ℃ in 0.1 * SSC/0.2%SDS afterwards; Or other tight hybridization conditions well known by persons skilled in the art is (referring to for example Ausubel, volumes such as F.M., 1989; Current Protocols in Molecular Biology, the 1st volume, Green Publishing Associates; Inc. and John Wiley&Sons, Inc.; New York, 6.3.1-6.3.6 and 2.10.3 page or leaf).The nucleic acid molecule of these antibody of encoding is also included within the present invention.

As well known in the art, polypeptide or its fragment or variant with similar aminoacid sequence usually have similar structure and many identical BAs.Therefore; Immunologic opsonin ground combines the antibody (comprising the molecule that contains its antibody fragment or variant or be made up of them) of familial acute myeloid leukemia relative new gene (FAMLF) polypeptide or familial acute myeloid leukemia relative new gene (FAMLF) polypeptide fragment or variant; Comprise VH territory with following aminoacid sequence or be made up of it, the aminoacid sequence in the VH territory of the heavy chain that the listed at least a clone of said aminoacid sequence and table 2 is expressed has at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% consistence.

Immunologic opsonin ground combines the fragment of familial acute myeloid leukemia relative new gene (FAMLF) polypeptide or familial acute myeloid leukemia relative new gene (FAMLF) polypeptide or the antibody of variant (comprising the molecule that contains its antibody fragment or variant or be made up of them); Comprise VL territory with following aminoacid sequence or be made up of it, the aminoacid sequence in the VL territory of the light chain that said aminoacid sequence and at least a clone are expressed has at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% consistence.

The polynucleotide of encoding antibody

Antibody of the present invention (comprising antibody fragment or variant) can be through any currently known methods preparation in this area.For example, be to be understood that according to antibody of the present invention and can in the clone of non-hybridoma cell line, express.For example, can use the cDNA of coding antibodies specific or the sequence of genomic clone to transform suitable Mammals or nonmammalian host cell or preparation phage display library.In addition, polypeptide antibody of the present invention is can be through chemical process synthetic or through using recombinant expression system to produce.

An approach of preparation antibody of the present invention is VH and/or the VL territory that any or multiple hybridoma cell line of clone is expressed.For from these hybridoma cell lines separation VH and VL territory, can use the PCR primer that comprises VH or VL nucleotide sequence from separating VH and the VL sequence that amplification is expressed from total RNA of hybridoma cell line.Can use carrier then; The carrier (this sudden change end can be added on the single adenosine acid mutation end complementation of PCR product 5 ' and 3 ' end with the many archaeal dna polymerases that are used for the PCR reaction) that for example has the PCR product cloning site of forming by 5 ' and 3 ' the single T Nucleotide overhang, clone PCR products.Can use ordinary method known in the art to this VH and the order-checking of VL territory then.

Can clone's VH and VL gene be placed one or more suitable expression vectors.As non-limitative example, can use this VH of PCR primer amplification or the VL territory of the flanking sequence that comprises VH or VL nucleotide sequence, restriction site and protection restriction site.Utilize clone technology well known by persons skilled in the art; Can the VH territory of this pcr amplification be cloned into the carrier of expressing suitable constant region for immunoglobulin (for example be used for the human IgG1 or the IgG4 constant region in VH territory respectively and be used for κ and the people κ in λ VL territory or λ constant region).The carrier of preferably, expressing this VH or VL territory comprises and is fit to instruct this heavy chain and light chain expression promoter in selected expression system; Secretion signal; The cloning site that is used for immune globulin variable region, constant region for immunoglobulin; With selective marker such as Xin Meisu.Can also this VH and VL territory be cloned in the single carrier of expressing necessary constant region.Then; Use technology well known by persons skilled in the art (to see for example Guo etc.; J.Clin.Endoctinol.Metab.82:925-31 (1997) and Ames etc., J.Immunol.Methods 184:177-86 (1995); Intactly incorporate them into this paper as a reference), heavy chain is changed in carrier (conversion vector) and light chain conversion carrier cotransfection to the clone to produce the stable or instantaneous clone of expressing full length antibody such as IgG.

The present invention also provides the polynucleotide that comprise code book invention polypeptide and its segmental nucleotide sequence.The present invention also is included in the polynucleotide of (for example preceding text are defined) and the multi-nucleotide hybrid of the following antibody of coding under the tight or low tight hybridization conditions, and wherein preferably said antibody is to combine the antibody of polypeptide of the present invention specifically, preferably combine to have the antibody of polypeptide of polypeptide or preservation clones coding of the aminoacid sequence of sequence < two >.

Confirming of the acquisition of these polynucleotide and the nucleotide sequence of these polynucleotide can be through any currently known methods realization in this area.For example, if the nucleotide sequence of antibody is known, then can be (for example from the polynucleotide of this antibody of the oligonucleotide of chemosynthesis assembling coding; Kutmeier etc.; The method that BioTechniques 17:242 (1994) describes), tube, this comprises the overlapping oligonucleotide of the part of synthesizing the sequence that contains this antibody of encoding; With these oligonucleotide annealing and connection, the oligonucleotide that connects through pcr amplification then.

Perhaps, can be from the polynucleotide of the nucleic acids for preparation encoding antibody of appropriate sources.If can not obtain containing the clone of nucleic acid of antibodies specific of encoding; But the sequence of this antibody molecule is known; Then encode the nucleic acid of Tegeline can chemosynthesis or use can with the synthetic primer of this sequence 3 ' and 5 ' terminal hybridization through pcr amplification from appropriate sources (for example from producing certainly or separating any tissue or the cell of expressing this antibody certainly; As through the antibody cDNA library of the hybridoma of select expressing antibody of the present invention or cDNA library or nucleic acid, preferred poly A+RNA) obtain; Or through using special oligonucleotide probe to specific gene sequence, for example the cDNA of this antibody of identification code clones from the cDNA library.Then, use any method of knowing in this area to be cloned into through the amplification of nucleic acid that PCR produces in the reproducible cloning vector.

In case measured the nucleotide sequence and the corresponding aminoacid sequence of this antibody, the well-known process that promptly can use this area to be used to operate nucleotide sequence (is seen the technology that for example is described in the following document: Sambrook etc. like the nucleotide sequence of these antibody of operation such as recombinant DNA technology, site-directed mutagenesis, PCR; 1990, molecular cloning laboratory manual (Molecular Cloning, Alaboratory Manual) the 3rd edition; Cold Spring Harbor Laboratory, Cold Spring Harbor, volumes such as NY and Ausubel; 1998, Current Pro ' tocols in M01ecular Bi010gy, John wiley&sons; NY; Both all intactly incorporate this paper into as a reference), the antibody so that preparation has the different aminoacids sequence for example produces amino acid replacement, disappearance and/or insertion.

Can for example compare to confirm the sequence hypervariable region through the known amino acid sequence with other heavy chain and variable region of light chain through well known method, the aminoacid sequence of inspection heavy chain and/or variable region of light chain is identified the sequence of complementary determining region (CDR).Use conventional recombinant DNA technology, can one or more CDR be inserted in the framework region, for example insert in people's framework region with the humanization non-human antibody, referring to above description.Framework region can be naturally occurring or total framework region, preferred people's framework region (referring to for example Claothia etc., people's framework region that J.Mol.Biol.278:457-479 (1998) lists).Preferably pass through the antibody of the polynucleotide encoding specific combination polypeptide of the present invention of built up construction district and CDR preparation.Preferably, as discussed above, can in framework region, carry out one or more amino acid replacements, and preferred amino acid substitutes raising antibody and its antigenic combination.In addition, can use these methods to cause to participate in the amino acid replacement or the disappearance of one or more variable region cysteine residues of intrachain disulfide bond, to produce the antibody molecule of the one or more intrachain disulfide bonds of disappearance.Other changes of this polynucleotide is also included within the present invention and belongs to those skilled in the art's scope.

Use for some, the external affinity maturation of antibody of the present invention for example, what come in handy is that the heavy chain of one or more antibody of the present invention and light chain VH and VL territory are expressed as single-chain antibody or Fab fragment in phage display library.For example; Can use phage display library; The VH of one or more antibody of the present invention of coding and the cDNA in VL territory are expressed with all possible combination, thereby allow to select VH/VL combination with preferred combination characteristic (affinity that for example improves or the shutdown rate of raising) combination familial acute myeloid leukemia relative new gene (FAMLF) polypeptide.In addition, especially, the VH of VH and VL section---one or more antibody of the present invention and the CDR district in VL territory can suddenly change external.VH and the VL territory expression in phage display library with the CDR of " sudden change " makes can select the VH/VL combination that combines familial acute myeloid leukemia relative new gene (FAMLF) polypeptide with preferred combination characteristic (affinity that for example improves or the shutdown rate of raising).

In the phage display method, the functional antibodies domain views is on the surface of the phage particle that has the polynucleotides encoding them sequence.Particularly, the dna sequence dna in (the for example cDNA library of people or mouse lymphoid tissue) or synthetic cDNA amplified library coding VH and VL territory from animal cDNA library.Couple together and be cloned in the phagemid carrier (for example PCANTAB 6 or pComb 3 HSS) through will the encode DNA in VH and VL territory of scFv joint through PCR.Use this carrier transformed into escherichia coli through electroporation, and infect these intestinal bacteria with helper phage.The phage that is used for these methods typically is filobactivirus such as fd and M13.This VH and VL territory common and phage gene III or gene VIII reorganization fusion.Can use antigen; The antigen of mark or combine or by its antigen of catching screening or the phage of identifying the antigen binding domain of expressing binding purposes antigen (for example familial acute myeloid leukemia relative new gene (FAMLF) polypeptide or its fragment) with solid surface or pearl for example.The example that can be used for preparing the phage display method of antibody of the present invention includes but not limited to be disclosed in those of following document: Brinkman etc., J.Immunol.Methods 182:41-50 (1995); Ames etc.

Can use the gene of the mouse antibodies molecule through will having suitable antigen-specific develop technology (Morrison etc., the Proc.Natl.Acad.Sci.81:851-855 (1984) that is used for preparing " chimeric antibody " with gene splicing with human antibody molecules of suitable BA together; Neuberger etc., Nature 312:604-608 (1984); Takeda etc., Nature 314:452-454 (1985)).As discussed above, chimeric antibody is the molecule with the different piece that derives from the different animals species, for example has the variable region that derives from mouse mAb and those antibody of human normal immunoglobulin constant region, like humanized antibody.

Perhaps, technology (USP 4,946,778 that can adopt description to be used to prepare single-chain antibody; Bird, Science242:423-42 (1988); Huston etc., Proc.Natl.Acad.Sci.USA 85:5879-5883 (1988); With Ward etc., Nature 334:544-54 (1989)) with the preparation single-chain antibody.Connect through the amino acid bridging through Fv district fragment and to cause single chain polypeptide to form single-chain antibody heavy chain and light chain.Also can use the segmental technology of assembling function property Fv in large intestine bar mattress (Skerra etc., Science 242:1038-1041 (1988)).

The preparation method of FAMLF monoclonal antibody specific is provided, and antibody of the present invention can be through any method preparation that is used for synthetic antibody known in the art, especially chemosynthesis, intracellular immunity (being the intrabody technology) or recombination and expression techniques preferably.The method for preparing antibody includes but not limited to hybridoma technology, EBV transforms and this paper discusses other method and the use of recombinant DNA technology, antibody of the present invention or its fragment, verivate, sees following discussion.In case through animal, chemosynthesis or recombinant expressed produced antibody molecule of the present invention after; Can carry out purifying to it through any method that is used for the purifying Tegeline known in the art; The example of these methods has chromatography (for example IX, affine, in particular for the affinity chromatography and the size exclusion column chromatography of the specific antigen after the protein purification A), centrifugal, difference dissolving or any other to be used for the standard technique of protein purification.In addition, antibody of the present invention or its fragment can be beneficial to purifying with allogeneic polypeptide sequence fusion described herein or known in the art.FAMLF specific antibody provided by the invention can be used for immunology correlation analysis, treatment technology.These technology are including, but not limited to Western Bloting analysis, immunoturbidimetry, Enzyme Linked Immunoadsorbent Assay (ELISA), immunohistochemical methods, flow cytometry, laser co-focusing immunoassay, co-immunoprecipitation analysis.

The recombinant expressed requirement that the invention still further relates to variant or the analogue (the for example heavy chain of antibody of the present invention or light chain or single-chain antibody of the present invention) of FAMLF monoclonal antibody specific makes up the expression vector of the polynucleotide that contain this antibody of encoding.In case after having obtained the polynucleotide of code book invention antibody molecule or heavy chain of antibody or light chain or their part (preferably containing heavy chain or variable region of light chain), then can use technology preparation well known in the art to be used to produce the carrier of this antibody molecule through recombinant DNA technology.Therefore, this paper has described the polynucleotide that contain the nucleotide sequence of encoding antibody through expression and has prepared method of protein.Method well known to those skilled in the art can be used to make up the expression vector that contains antibody coding sequence and suitably transcribe and translate wave.These methods comprise the for example interior genetic recombination of extracorporeal recombinant DNA technology, synthetic technology and body.Therefore, the present invention provides the replicable vector that comprises nucleotide sequence that be operably connected with promotor, code book invention antibody molecule or its heavy chain or light chain or heavy chain or variable region of light chain.These carriers can comprise the nucleotide sequence of encoding antibody molecule constant region, and can the variable region of antibody be cloned into heavy chain or the light chain that is used for The expressed in this carrier.

The present invention includes through the recombination form fusion or through chemical mode and puted together (comprising covalency and non-covalent puting together) antibody that polypeptide of the present invention (or its part, preferably at least 10 of this polypeptide, 20,30,40,50,60,70 or 80 amino acid) produces fusion rotein.This fusion is not necessarily directly, also can carry out through joint sequence.Antibody can special antigen to non-polypeptide of the present invention (or its part, preferably at least 10 of this polypeptide, 20,30,40.50,60,70 or 80 amino acid).For example, can be through polypeptide of the present invention and special antibody to the specific cells surface receptor being merged or put together, and use in this antibody body or externally with polypeptide target of the present invention to specific cells be.Polypeptide of the present invention and/or antibody (comprising its fragment or variant) can and the N of heterologous protein (for example immunoglobulin Fc polypeptide or human serum albumin polypeptide) or C-terminal merge.Antibody of the present invention can also and BSA (including but not limited to RHA) merge, obtain chimeric polyeptides.The polynucleotide of code book invention fusion rotein are also included within the present invention.These fusion roteins can for example help purifying and can increase the transformation period in the body.The antibody that merges with polypeptide of the present invention or put together also can adopt methods known in the art to be used for external immunoassay and purification process.

The present invention also comprises the compsn that comprises the polypeptide of the present invention that merges with the antibody domain of non-variable region or put together.For example, polypeptide of the present invention can or be puted together with antibody Fc district or its meromixis.The antibody moiety that merges with polypeptide of the present invention can comprise the arbitrary combination of constant region, hinge area, CH1 territory, CH2 territory and CH3 territory or all territories or its part.These polypeptide can also merge or put together the formation polymer with above-mentioned antibody moiety.For example, and the Fc part that merges of polypeptide of the present invention can form dimers through the disulfide linkage between two Fc parts.Higher multimeric forms can prepare through the meromixis with this polypeptide and IgA and IgM.The method that polypeptide of the present invention and antibody moiety is merged or put together is known in the art.

As discussed above, can be corresponding to the polypeptide of polypeptide, polypeptide fragment or the variant of preservation clones coding polypeptide through using means known in the art and above-mentioned antibody moiety to merge or puting together with the transformation period in the body that increases this polypeptide or be used for immunoassay.And the polypeptide of cloning coded polypeptide corresponding to preservation can merge or put together and is beneficial to purifying with above-mentioned antibody moiety.The polypeptide of the present invention that merges with antibody or put together with two body structures that disulfide linkage is connected (because IgG) also can than simple monomeric secreted protein or protein fragments combine and other molecule that neutralizes aspect more effective.In many cases, the Fc part in the fusion rotein is useful in treatment and diagnosis, therefore can cause the pharmacokinetic property that for example improves.Perhaps, behind fused protein expression, detection and purifying, possibly expect to remove this Fc part.For example, when fusion rotein was used as immunizing antigen, this Fc part possibly hinder treatment and diagnosis.On drug discovery, for example analyze to identify the antagonist of hIL-5, with human protein hIL-5 and Fc meromixis for the screening of high-throughput ground.

And, can antibody of the present invention or its fragment and flag sequence be merged like the peptide that is beneficial to purifying.This marker amino acid sequence is six Histidine peptides, this label that for example provides in the pQE carrier (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91311), and especially many can commercially the purchase obtains in them.The feasible purified fusion protein easily of six Histidines.Include but not limited to " HA " label for other useful peptide tag of purifying, its epi-position (Wilson etc., Cell 37:767 (1984)) and " flag " label corresponding to influenza hemagglutinin protein.

The present invention also comprises antibody or its fragment that territory diagnosis or therapeutical agent are puted together.These antibody can in diagnosis, be used for for example monitoring tumour generation or progress and as the part of clinical trial program, for example to confirm the efficient of given remedy.Can be through with this antibody and the favourable detection of detectable substance coupling.The example of detectable substance comprises the active paramagnetic metal ion of various enzymes, prothetic group, fluorescent substance, luminophore, noclilucence material, radioactivity material, the positron emitting metal that uses multiple positron emission tomography and non-radioactive.Detectable substance can be directly with antibody (or its fragment) or use art technology and antibody coupling through midbody (joint for example known in the art) indirectly or put together.The example of suitable enzyme comprises horseradish peroxidase, SEAP, D tilactase or E.C. 3.1.1.7; The example of suitable prothetic group mixture comprises Streptavidin/vitamin H and avidin/biotin; Suitably the example of fluorescent substance comprises Umbelliferone, luciferin, Fluorescein Isothiocyanate, rhodamine, dichlorotriazine base amine luciferin, dansyl chloride or phycoerythrobilin; The example of luminophore comprises o-aminophthalylhydrazide; The noclilucence examples of substances comprises luciferase, luciferin, aequorin; Suitable radioactivity examples of substances comprise iodine, carbon ( ¹⁴C), sulphur etc.

Familial acute myeloid leukemia relative new gene of the present invention (FAMLF) and/or familial acute myeloid leukemia relative new gene (FAMLF) SV polypeptide with for polypeptide coupling radiation metals ion (is included but not limited to ¹¹¹In, ¹⁷⁷Lu, ⁹⁰Y, ¹⁵³Sm, ¹⁶⁶Ho) useful macrocyclic chelants connects.This macrocyclic chelants is 1,4,7,10-tetraazacyclododecanand-N, N ', N ", N " '-tetraacethyl (DOTA).DOTA is connected through linkers with FAMLF of the present invention and/or FAMLF SV polypeptide.The example that is used for DOTA and polypeptide link coupled linkers is that this area is known usually.In addition, USP 5,652,361 and 5,756,065 discloses the sequestrant that can put together with antibody and their preparation and method of use, hereby they is intactly incorporated into as a reference.Although USP 5,652,361 and 5,756,065 concentrates on sequestrant and antibody is puted together, and those skilled in the art can easily change wherein disclosed method and make sequestrant and other conjugation of polypeptides.

Antibody conjugates of the present invention can be used to modify specified biologically, and therapeutical agent or drug moiety should not be construed as and be limited to classical chemotherapeutic.For example, drug moiety can be protein or the polypeptide with expectation BA.These protein comprise for example toxin such as toxalbumin, ricin A, false unit cell mattress extracellular toxin or diphtheria toxin; Protein is tumour necrosis factor, IFN-, IFN-, NGFF, Thr6 PDGF BB, tissue plasminogen activator, apoptosis agent such as TNF-q, TNF-β, AIM I, AIM II, Fas part for example, VEGI, thromobotic agent or anti-angiogenic agent such as ANGIOSTAIN or endostatin; Or biological response modifier for example lymphokine, interleukin-11 (" IL-I "), interleukin-22 (" IL-2 "), interleukin 6 (" IL-6 "), rHuGM-CSF (" GM-CSF "), granulocyte colony-stimulating factor (" G-CSF ") or other growth factor.

Antibody is connected with solid support, and this is particularly useful for immunoassay or purifying target antigen.This solid support includes but not limited to glass, Mierocrystalline cellulose, SEPIGEL 305, nylon, gathers third ethene, Vilaterm chlorine or Vestolen PP 7052.

These treatment parts are known with the technology of antibody coupling; See for example Arnon etc.; " monoclonal antibody that is used for the immunotargeting of medicine in the cancer therapy ", " monoclonal antibody and cancer therapy " (Monoclonal Antiboides and Cancer Therapy), Reisfeld etc. (volume); Pp243-56 (Alan R.Liss, Inc.1985); Hellstrom etc., " being used for the antibody that medicine is sent ", " controlled medicine is sent " (Controlled Drug Delivery) (the 2nd edition), Robinson etc. (volume) pp623-53 (Marcel Dekker, Inc.1987); Thorpe; " antibody carrier of cytotoxic agent in the cancer therapy: summary "; " monoclonal antibody ' 84: biology and clinical application " (Monoclonal Antibodies ' 84:Biological and Clinical Applications), Pinchera etc. (volume), pp 475-506 (1985): " analysis, result and the prospect of radio-labeled Antybody therapy purposes in the cancer therapy "; " monoclonal antibody that is used for cancer detection and treatment " (Monoclonal Antibodies for Cancer Detection and Therapy); Baldwin etc. (volume), pp 303-16 (Academic Press 1985) and Thorpe etc.; " cutting of antibody-toxin conjugate is equipped with and cytotoxicity ", Immunol.Rev.62:119-58 (1982).

Perhaps, can antibody and two anti-puting together be formed the assorted conjugate (heteroconjugate) of antibody, referring to the USP 4,676,980 of Segal, it is intactly incorporated into as a reference.

With treatment part coupling or link coupled antibody can use separately when the therapeutical agent or associational cells virulence factor and/or cytokine are used.

Antibody of the present invention can be used for pair cell system and biological sample carries out the immunophenotype somatotype.The translation product of gene of the present invention can be used as the cell-specific mark, or more specifically is used as the cell marking of differential expression when particular cell types growth and/or ripe different steps.The monoclonal antibody of pointing to defined epitope or table combination firmly will allow screening to express the cell mass of this mark.When using the monoclonal antibody screening to express the cell mass of this mark; Multiple technologies can be used; Comprise that " elutriation " and Flow Cytometry that antibody that magnetic resolution, use and solid substrate (being plate) that the magnetic bead that uses antibody sandwich carries out adhere to carries out (see for example USP 5; 985,660; With Morrison etc., Cell, 96:737-49 (1999)).

These technology make can select specific cells colony; " non-from body " cell in those that for example can in hematologic malignancies (for example the minimum remaining disease of acute leukemic patient (minimal residual disease) (MRD)), find and the graft is to prevent graft versus host disease (GVHD).Perhaps, these technology allow screening can experience the hemopoietic stem cell and the ancester cell of propagation and/or differentiation, those that for example can in human cord blood, find.

Antibody of the present invention can be analyzed the combination of its immunologic opsonin through any currently known methods in this area.Operable immunoassay includes but not limited to use the competitiveness and the noncompetitive analytical system of following technology; The example of said technology has BIAcore analysis, FACS (fluorescence activated cell letter sorting art) analysis, immunofluorescence, immunocytochemical method, western trace, radioimmunoassay, ELISA (enzyme-linked immunosorbent assay), " sandwich " immunoassay, immuno-precipitation, precipitin reaction, GDP reaction, immunodiffusion(ID) analysis, agglutination test, complement fixation test (CFT), immunoradiometric assay(IRMA), FIA, a-protein immunoassay, but this only is several examples of enumerating.These mensuration are conventional and are (for example see that Ausubel etc. compiles 1994, Current Protocols in Molecular Biology, Vol.1, John Wiley&Sons, Inc., New York, it intactly incorporates this paper into as a reference) well known in the art.The exemplary immunization assay method is described below (but not being intended to constitute restriction) briefly.

The immunoprecipitation working method generally comprises is adding protein phosphatase and/or proteinase inhibitor (for example, EDTA, PMSF; Press down enzyme peptide, vanadic acid sodium) lysis buffer such as RIPA damping fluid (1%NP-40 or Triton X-100,1% Sodium desoxycholate, 0.1% SDS; 0.15M NaCl, 0.01M sodium phosphate (pH 7.2), 1%Trasylol) middle lysing cell crowd; Add purpose antibody to cell lysate; Hatch for some time (for example 1-4 hour) in 4 ℃, add albumin A and/or Protein G Sepharose pearl, hatched about 1 hour or longer for 4 ℃ to cell lysate; In lysis buffer, wash these pearls, and these pearls reproductions are suspended in the SDS/ sample buffer.The ability of purpose antibody mediated immunity deposition specific antigen can be estimated through for example Western engram analysis.Those skilled in the art should instruct can increase antibody and the antigenic parameter that combines and reduce background (for example cleaning cell lysate in advance with the sepharose pearl) through modifying.For the further discussion of immunoprecipitation working method, referring to for example Ausubel etc., 1994, Current Protocols in Molecular Biology, V01.1, John Wiley&Sons, Inc., New York, 10.16.1.

The Western engram analysis generally comprises the preparation protein sample; Go up this protein sample of electrophoresis at the polyacrylamide gel 8%-20% SDS-PAGE of antigenic molecular weight (for example according to); Protein sample is transferred on film such as nitrocellulose, PVDF or the nylon membrane from polyacrylamide gel; Closing membrane in sealing damping fluid (PBS that for example has 3%BSA or skimmed milk), washing film in lavation buffer solution (for example PBS-Tween 20) uses anti-(purpose antibody) closing membrane that is diluted in the sealing damping fluid; In lavation buffer solution, wash film, use is with enzyme substrates (for example horseradish peroxidase or SEAP) or the radioactivity molecule (for example ³²P or ¹²⁵I) two anti-(antibody that identification one resists is like anti-people's antibody) closing membrane of puting together washs film, and detects antigenic existence in lavation buffer solution.Those skilled in the art will instruct and can change to increase detection signal and to reduce the parameter of background noise.For the further discussion of western trace working method, see for example (volume) 1994 such as Ausubel, CurrentProtocols in Mulecular Biology, V01.1, John Wiley&Sons, Inc., New York, 10.8.1.

ELISA comprises preparation antigen, with the hole of these antigen coated 96 hole microtiter plates, but adds the purpose antibody of puting together with detection compound such as enzyme substrates (for example horseradish peroxidase or SEAP) in the hole and hatches for some time, detects antigenic existence.In ELISA, but purpose antibody needn't be puted together with detection compound; On the contrary, but can in the hole, add and detection compound link coupled two anti-(identifying purpose antibody).And, substitute and use antigen coated hole, can use the antibody sandwich hole.In the case, but can after in encapsulating the hole, adding purpose antigen, add with detection compound put together two anti-.Those skilled in the art will instruct and can change with the parameter of increase detection signal and other variant of ELISA known in the art.For the further discussion of ELISA, referring to (volumes) 1994 such as Ausubel, Current Protocols in Molecular Biology, V01.1, Jolln Wiley&Sons, Inc., New York, 11.2.1.

The shutdown rate of antibody and antigenic binding affinity and antibody-AI can be measured through competitive binding analysis.An example of competitive binding analysis is a radioimmunoassay, and it is included under the unlabelled antigen that has increasing amount and makes labelled antigen (for example ³H or ¹²⁵And detection and labelled antigen bonded antibody I) and the purpose antibody incubation.Purpose antibody can be confirmed from the data of Scatchard mapping analysis the affinity and the combination shutdown rate of familial acute myeloid leukemia relative new gene (FAMLF).Also can use radioimmunoassay to confirm the competition anti-with two.In the case, with familial acute myeloid leukemia relative new gene (FAMLF) and coupling tagged compound (for example ³H or ¹²⁵The compound of I mark) purpose antibody is hatched in the presence of unmarked two of increasing amount resists.This type of competitive assay between two kinds of antibody can be used for also confirming that two kinds of antibody are to combine identical or different epi-position.

The BIAcore dynamic analysis is used to confirm antibody (comprising antibody fragment or its variant) and familial acute myeloid leukemia relative new gene (FAMLF) or the segmental opening and closing speed that combines of familial acute myeloid leukemia relative new gene (FAMLF).The BIAcore dynamic analysis comprises that analyzing antibody has fixed the chips incorporate of familial acute myeloid leukemia relative new gene (FAMLF) with the surface and dissociate.

Others of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.

Beneficial effect of the present invention: the discovery of FAMLF full length gene cDNA sequence of the present invention, complete opening code-reading frame; The clone of FAMLF full length gene cDNA, the specific antibody of human gene FAMLF are developed the discovery of used immune peptide epi-position and the invention of FAMLF protein specific antibody, and all these work lay the foundation for the research and development of white blood disease specific gene diagnosis antibody, protein chip, gene chip, genomic medicine from now on.This Project Study improves leukemia diagnosis accuracy rate and result of treatment for developing the leukemia new drug, and improving the leukemic curative ratio in Fujian Province has important effect, and potential important social and economic benefit are arranged.The present invention helps the The Molecular Biology Mechanism of in-depth explanation white blood disease incidence and development, for the gene diagnosis and the gene therapy of white blood disease and other malignant tumours lays the foundation.This research has following advantage:

1, novelty: do not see the report of the acute myeloid leukemia family (seeing Figure 20) that sickness rate is so high, scale is so big at present both at home and abroad as yet, the domestic report of not seeing familial acute myeloid leukemia relative new gene clone as yet.

2, creativeness: the cDNA total length that clones familial acute myeloid leukemia relative new gene; Successfully dope the opening code-reading frame of this new gene; Invent out this gene differential expression primer; Invent out specific monoclonal property antibody to this new gene; And be consistent through the used opening code-reading frame of this genetic expression of Western Bloting checking with the opening code-reading frame of prediction, use single stage method RT-PCR and find that with Western Bloting this gene high expression level in the leukaemic hangs down expression in the normal people.

3, practicality: cloning this new full length gene cDNA sequence, confirming opening code-reading frame and invent out on the basis of this analysis of gene differential expression primer, protein-specific antibody; Can further design the target site of acute myeloid leukemia gene therapy; Develop the gene diagnosis kit, gene chip, the protein chip that comprise this gene, and promote the application clinically of the expressed protein-specific antibody of this gene.

Description of drawings

Fig. 1 is the cDNA sequence chart of FAMLF gene of the present invention.

Fig. 2 is the coding protein sequence chart of FAMLF gene FAMLF of the present invention.

Fig. 3 is that (the GenBank number of registration: CV973101) PCR detects electrophorogram to EST zywB-87 of the present invention.

1 EST zywB-87 PCR detected result, 2 negative controls

It is thus clear that a clear single band is arranged between 500-750bp, and negative control does not have band

Fig. 4 is the first round 5 ' RACE PCR electrophorogram of the present invention.

M DNAMarker 2,000 1 first round 5 ' RACE PCR 2 negative controls

Fig. 5 takes turns nido 5 ' RACE PCR electrophorogram for of the present invention second.

M DNAMarker 2,000 1 second takes turns nido 5 ' RACE PCR 2 negative controls

Fig. 6 is 3 ' RACE PCR electrophorogram of the present invention.

M DNAMarker 6,000 13 ' RACE PCR 2 negative controls

Fig. 7 is an ORF phase-split network surface chart of the present invention.

Fig. 8 is NCBI/Blastn retrieval figure of the present invention.

Fig. 9 is the new gene electron stain of a FAMLF of the present invention body location map.

Figure 10 is a protein hydrophobic skeleton diagram of the present invention.

Figure 11 is protein function domain analyses result one figure of the present invention.

Figure 12 is protein function domain analyses result two figure of the present invention.

Figure 13 is the expression electrophorogram of FAMLF gene of the present invention between part acute myeloid leukemia patient and normal people.

The outer normal control of normal control 8-9 family in the outer acute myeloid leukemia patient 6-7 family of acute myeloid leukemia patient 3-5 family in 1 DNA maker (DL2000), 2 familys

The confidential reference items segment is 251bp, and the purpose segment is 175bp, and the result shows that the expression of FAMLF gene in the patient is apparently higher than the normal people

Figure 14 is the expression electrophorogram of FAMLF of the present invention at U937, Raj and Ca46 cell strain.

M DNAMarker DL 2,000 1 U937 cell strains 2 Raj cell strains 3 Ca46 cell strains 4 Shi-1 cell strains

The confidential reference items segment is that 251bp purpose segment all has than high expression level in above-mentioned cell strain for 522bp result shows FAMLF

Figure 15 is the expression electrophorogram of FAMLF of the present invention at acute monocytic leukemia, melanoma, liver cancer, Hela cell strain.

M DNAMarker DL 2,000 1 positive controls (patient OneStep RT-PCR amplification)

2 acute monocytic leukemia cell strains, 3 MC strains, 4 hepatoma cell strains

5 Hela cell strain confidential reference items segments are that 251bp purpose segment is 522bp

The result shows that FAMLF expresses, and does not express in melanochrome, hepatoma cell strain in the acute monocytic leukemia cell strain

Figure 16 is the prepared monoclonal antibody figure to FAMLF of Western Bloting checking of the present invention.

The 1st, this antibody of 33-1-3R3 (PA), diluting 250 times 2 is this antibody of 33-1-3R3 * (PA), thinning ratio be 50 wherein GAPDH antibody and Actin antibody as positive control

Figure 17 analyzes the expression figure of FAMLF in white blood disease NB4, U937, K562, myeloma cell line U266, CEM, white blood disease H160 cell, lymphoma cell strain CA46, Jurkat cell strain for Western Bloting.

Figure 18 analyzes the expression figure (5 positive contrasts, 1,2,3,4,6 be clinical leukemia patient) of FAMLF in leukemia patient for Western Bloting

Figure 19 is that Western Bloting of the present invention analyzes the expression figure of FAMLF in the normal people.(1 positive contrast, 2,3,4,5,6 is the normal people)

Figure 20 is a Fujian Province of the present invention acute myeloid leukemia high density family family tree.

Embodiment

Describe the present invention below in conjunction with accompanying drawing and embodiment:

Should be understood that these embodiment only to be used to the present invention is described and be not used in the restriction scope of the present invention.The experimental technique of unreceipted actual conditions in the following example; According to people such as normal condition such as sanlbrook; Molecular cloning: the condition described in the laboratory manual (New York:cold Spring Harbor Laboratory Press, 1989), or the condition of advising according to manufacturer.

Embodiment 1: clone FAMLF full length gene sequence through the sMART-RACE technology

1) EST zywB-87 (GenBank number of registration: CV973101) sequence check and correction

1.1) with EST zywB-87 and genome comparison

Networking Http:// genome.ucsc.edu/cgi-bin/hgBlat? Command=startEST zywB-87 and human genomic sequence are compared, obtain following result:

Alignment?of?YourSeq?and?chr1：197136247-197173157

Click?on?links?in?the?frame?to?the?left?to?navigate?through?the?alignment.Matching?bases?in?cDNA?and?genomic?sequences?are?colored?blue?and?capitalized.Light?blue?bases?mark?the?boundaries?of?gap?s?in?either?sequence(often?splice?sites).

cDNA?YourSeq

acgcggggAC?AGGAGCAAGG?GATGTCTGAG?CACAAGTGGC?TGAGTTCCGA 50

GTGACTTTAT?GAAGCACTTT?CTACCTTCCT?CTCCGGCATG?AAAACAGGGA 100

TTCTGCACCT?GCATCATGGA?CAGTCTGGCA?AAAGCCTCTG?CTCTGCCTCC 150

GGGGACAAGA?AACTAGAGCA?AATAACCGcT?TTGAAATTAG?ATCCTGGCgA 200

AATTACCcAC?AATCAATGgt?ggaaactgaa?aggagaaTGA?TTTAAATCTT 250

CAATGACAGT?TGT

Aim sequence is positioned at karyomit(e) 197136247-197173157 section No. 1, wherein representative of capitalization sequence and genome correct match, representative of lowercase sequence and genome mispairing

1.2) adopt primer-design software Oligo 6.0 design check and correction upstream primer F39 according to the genome comparison result, check and correction downstream primer R591:

Upstream primer F39:5 ' AGTGGCACCAAGATGCTTA 3 ',

Downstream primer R591:5 ' CCCTATGGATTGTTGAACTGG 3 ',

1.3) with the PrimeSTAR of TaKaRa company ^TMHS DNA Polymerase reagent; Concrete operations are carried out the PCR detection of EST zywB-87 according to the protocol of the said firm, and get the 5mlPCR product, 2% agarose electrophoresis; Observations (result sees the electrophorogram of the zywB-87 gene of Fig. 3); It is thus clear that a clear single band is arranged between 500-750bp, and negative control does not have band, all the other 45ul send Invitrogen company directly to check order.

1.4) the direct sequencing result of EST zywB-87 PCR product

The PCR product directly checks order through Invitrogen company, and sequencing result is following:

1 CGAAGCGTCT?CATGGAAGCC?AGTCTCCTCT?AATGTGTATT

TTGGTGCCCT?GTCTGCTGGT

61 TCGCCTAAGT?GATGTGGCAT?ACATTTGATG?AAAGGACAGT

AAATGACATC?AATTATAAAA

121 GACATCTACT?AATGAGAGGA?AGAAGAGGAA?GAGAGAGAAA

TTGAAAAAAAGAATAAGAAA

181 TTCTCTGAAA?TGGAAACAGC?AAAGCACTTT?GATTGAACTA

AAAGAAATGA?CGTACCTTAA

241 TCATGCCCTA?ATTTTAGGGT?ACCACCAACC?AAGCTACTCA?CTCTTCTTTG

GAAAGATGAC

301 GTGTTTCTTC?AACTTCTGTA?CAACTGTCAT?TGAAGATTTA?AATCAATCTC

CCTTCAGTTT

361 CCATCATTGA?TTGTTGGTAA?TTTTGCCAGG?ATCTCTGTAC?AAAACAAAAC

AAAAAGATAT

421 TATGTGAAAC?TCAGGCCATG?CTGAGCAAAT?TAGCTGAAAT?TTATTTTTAT

CCTCTTATGG

481 GGATGTTTTC?CAGTTCAACA?ATCCATAGGGA

1.5) sequence EST zywB-87 correcting result

With above sequencing result and genome sequence and the contrast of EST zywB-87 original series, find that the order-checking of EST zywB-87 original series has the part mistake, correct sequence is following:

1 ACAGGAGCAA?GGGATGTCTG?AGCACAAGTG?GCTGAGTTCC

GAGTGACTTT?ATGAAGCACT

61 TTCTACCTTC?CTCTCCGGCA?TGAAAACAGG?GATTCTGCAC?CTGCATCATG

GACAGTCTGG

121 CAAAAGCCTC?TGCTCTGCCT?CCGGGGACAA?GAAACTAGAG

CAAATAACCG?TTTTGAAATT

181 AGATCCTGGC?AAAATTACCA?ACAATCAATG?ATGGAAACTG

AAGGGAGATT?GATTTAAATC

241 TTCAATGACA?GTTGT

2) utilize 5 of Clontech ' end RACE test kit to make 5 of FAMLF gene ' end RACE, and use primer-design software Oligo 6.0 according to proofreading and correct good EST zywB-87 sequences Design 5 ' RACE primer.

2.1) 5 ' RACE primer

GSP1：5’AATCAATCTCCCTTCAGTTTCCATC?3’

NGSP1：5’TCTCCCTTCAGTTTCCATCA?3’

2.2) 5 ' RACE PCR electrophoresis result sees Fig. 4, Fig. 5

2.3) the direct sequencing result of nido 5 ' RACE PCR product

Nido 5 ' RACE PCR product directly checks order through Invitrogen company, and sequencing result is following:

1 TTTCAAACGG?TTATTTGCTC?TAGTTTCTTG?TCCCCGGAGG

CAGAGCAGAG?GCTTTTGCCA

..........................................................

181 AGCTGTACTA?TCTGCAGTTC?TCCCCGCGTA?CTCTGCGTTG?ATACCACTGC

TTGCCCTATA

241 GTGAGTCGTA?TTAGA

3) utilize 3 of Clontech ' end RACE test kit to make 3 of FAMLF gene ' end RACE, and use primer-design software Oligo 6.0 according to proofreading and correct good EST zywB-87 sequences Design 3 ' RACE primer.

3.1) 3 ' RACE primer

GSP2：5’AAGCACTTTCTACCTTCCTCTC?3’

3.2) 3 ' RACE PCR electrophoresis result sees Fig. 6

3.3) the direct sequencing result of 3 ' RACE PCR product

3 ' RACE PCR product is longer, and it is logical that reaction can not be surveyed, and through 4 continuous Warlking order-checkings, it is following to obtain its full length sequence:

1 ATGCATCATG?GAAGTCTGGT?AAAAGCCTCT?GCTCTGCCTC

CGGGGACAAG?AAACTAGAGC

61 AAATAACCGT?TTTGAAATTA?GATCCTGGCA?AAATTACCAA?CAATCAATGA

TGGAAACTGA

.................................................

601 TAACCAAACA?ACATACCTAT?GAAAATAGAT?CAGTAAGGCT

TTGAGAAACATTCTTAAGTA

661 AAATCTGTAA?AGCATCTTTG?CATTTTTTTT?CAAGAAAGAC?CTCCAGGTAA

ATGATGGCTT

.................................................

2041 GTTCTGTAGT?TTTAACCAGA?ACAAAGGGAT?TACCCAGAAG

AAAAGAAGGT?AAGCTATTTC

2101 ATCAGTTTTG?GTGGAAATCA?GAAGTTTTTT?TTTCTATTAT?TAGCTTTGTA

TTCTTAAAAA

2161 AAAAAAAAAA?AAAAAAAAAA?AAAA

4) cDNA full length sequence splicing result

According to gauged est sequence, 5 '-RACE sequence, 3 '-the RACE sequence, adopt DNAMAN software to carry out the splicing of cDNA full length sequence, the cDNA sequence total length of splicing is following:

1 AGAACTGCAG?ATAGTACAGC?TTCCACAGGA?GCAAGGGATG

TCTGAGCACA?AGTGGCTGAG

61 TTCCGAGTGA?CTTTATGAAG?CACTTTCTAC?CTTCCTCTCC

GGCATGAAAA?CAGGGATTCT

121 GCACCTGCAT?CATGGACAGT?CTGGCAAAAG?CCTCTGCTCT

GCCTCCGGGG?ACAAGAAACT

...............................................

1201?GGGAAGAAGA?CACTTCTGCG?TCTGACAGTG?AATCAGGCTC

CCAGTTTTGA?AGATGTGCTG

1261?TAGGTAGTTC?TCGCTGAATC?CATTTCCCAG?TTGGTTTCTA?TTCCCCGCCC

CATTCCTGTG

...............................................

2161?TCACAGTTCT?GTAGTTTTAA?CCAGAACAAA?GGGATTACCC

AGAAGAAAAG?AAGGTAAGCT

2221?ATTTCATCAG?TTTTGGTGGA?AATCAGAAGT?TTTTTTTTCT?ATTATTAGCT

TTGTATTCTT

2281?AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

5) the new gene registering result of FAMLF

New gene is through application; Staff's audit through American National information biology center GenBank; Obtain nucleic acid number of registration: EF413001; Protein number of registration: ABN58747 is Homo sapiens familial acute myelogenous leukemia related factor (being called for short FAMLF) by definite designation.

The bioinformatic analysis of embodiment 2:FAMLF and function prediction

1) full-length cDNA analytical results

Application NCBI/ORF Finder program ( Http:// www.ncbi.nlm.nih.gov/gorf/gorf.html) analyzing its ORF encoder block, the result sees Fig. 7.The sequence of the cDNA of FAMLF is following:

1 AGAACTGCAG?ATAGTACAGC?TTCCACAGGA?GCAAGGGATG?TCTGAGCACA

AGTGGCTGAG 60

61 TTCCGAGTGA?CTTTATGAAG?CACTTTCTAC?CTTCCTCTCC?GGCATGAAAA?CAGGGATTCT

120

121 GCACCTGCAT?CATGGACAGT?CTGGCAAAAG?CCTCTGCTCT?GCCTCCGGGG

ACAAGAAACT 180

181 AGAGCAAATA?ACCGTTTTGA?AATTAGATCC?TGGCAAAATT?ACCAACAATC?AATGATGGAA

240

241 ACTGAAGGGA?GATTGATTTA?AATCTTCAAT?GACAGTTGTA?CAGAAGTTGA?AGAAACACGT 300

301 CATCTTTCCA?AAGAAGAGTG?AGTAGCTTGG?TTGGTGGTAC?CCTAAAATTA?GGGCATGATT

360

361 AAGGTACGTC?ATTTCTTTTA?GTTCAATCGA?AGTGCTTTGC?TGTTTCCATT?TCAGAGAATT

420

421 TCTTATTCTT?TTTTTCAATT?TCTCTCTCTT?CCTCTTCTTC CTCTCATTAG?TAGATGTCTT

480

481 TTATAATTGA?TGTCATTTAC?TGTCCTTTCA?TCAAATGTAT?GCCACATCAC?TTAGGCGAAC

540

541 CAGCAGACAG?GGCACCAAAA?TACACATTAG?AGGAGACTGG?CTTCCATGAG

ACGCTTCGAC 600

601 TGTCTCATCG?GGGCACTTGT?AATAAGCATC?TTGGTGCCAC?TGAATGCAAT?GCTGTATTCA

660

661 AATAATAGCT?TTCATCTTCA?CTCTTTTTAA?ATATAAAAGT?AAACCTTGAA?GCCCTTTGAA

720

721 GGACCTAACC?AAACAACATA?CCTATGAAAA?TAGATCAGTA?AGGCTTTGAG?AAACATTCTT

780

781 AAGTAAAATC?TGTAAAGCAT?CTTTGCATTT?TTTTTCAAGA?AAGACCTCCA?GGTAAATGAT

840

841 GGCTTTTAAT?AAGACACATG?ACAATCTCAA?TTACAAGAAT?CATTAGTGTG?TGTCCTGTGC

900

901 GCCATTTTAT?GTTCCCAGCA?GGATATATCT?TTTCTCGTCT?AGGGTTTCCA?GGGCTGTCTA

960

961 CTGTTCTCTA?TGTGTAAAAC?GTATTTAAGT?GTTCCCCCAA?TGCTGCACTA?ATGTTGAAAC

1020

1021 AAAACAAAAC?AAAAACGAAG?AAACCTTTGT?CAAGTGGTCA?GACAGACTGG

AACTAGAGGA 1080

1081 TTATAGGTAA?GAGAGATAAA?ATGAAGGGTT?GAAAGCTATA?ATTTCTATTT?ATGTGGTGGC

1140

1141 AACCAAATCA?GCTGTTGGAG?TCAGGCAATT?TAAAGATGTG?GCTACTGGAG?CTCAGAGTCT

1200

1201 GGGAAGAAGA?CACTTCTGCG?TCTGACAGTG?AATCAGGCTC?CCAGTTTTGA?AGATGTGCTG

1260

1261 TAGGTAGTTC?TCGCTGAATC?CATTTCCCAG?TTGGTTTCTA?TTCCCCGCCC?CATTCCTGTG

1260

1321 TCCCCACACT?TTCCACTTGA?TTTTACCTCT?TTGACAATTC?TATATTTTAC?TTTCCTTCCT

1320

1381 CTCATTCCCC?TTTTCCCACC?CCCTTTTTTT?ACTGTAGTTC?TTGGCCTCTG?ACTACTGTTC

1380

1441 CATGCTGGAT?GTCCCCAGAA?AATAGAGTAT?GTTTAGAAAG?GAGACAGTGC?ATCTCAGAAG

1440

1501 GGCCTCCCCA?GTCCACTAGT?CCATTTTTTA?ATGTGTTGTG?CTCTATGGGT?GTCAGGAATA

1560

1561 TTTGTAGATG?AAGTAATTTG?TGGCATGAAT?TTTGATAGAA?GCAGGATCAC?CAACAAAATG

1620

1621 ATAAATGTAG?GTACCTGTCT?ACCTTGCATA?ATATTCACTA?TGATCTTGAG?AATTTCAATG

1680

1681 TATAATTTGT?CTTTATTCTT?ATTTTTCATT?AGAATTAACA?GAATCTCAGA?GCTGGTAGAA

1740

1741 AGTATAGAAA?CTGTATATAC?AACTCTCATA?TTCAGATGAA?GAAAATGATG?CACAAAAAAT

1800

1801 CAACTGTCCT?AAGCCATTTA?GCTTGTCTAT?AAGTGCTGTT?GGCTTAATTA?TAGTTTTGCA

1860

1861 TATATTTAGG?CAAAGAAAAT?ACTTTCTCAG?AAACTGGTTA?GGACTGTTTG?AGAAGAAATA

1920

1921 TAATCATCAA?AATATATACA?CAGTAAAATG?TAACCGTCCA?TCATTCAACA?TAGGCAAGAA

1980

1981 TATATATTGA?ATTGCCTGAG?TGTATTATTC?GTATAGCAAA?ACTTACTTGA?ATTTCTAATA

2040

2041 AATCTTCTGA?CCTCTGTATA?TGTATAAAAT?ATATAAACCA?ACCAAATTCT?GTACATAAAT

2100

2101 ATATTTTTGG?ATACCAGTAC?AATCCCTATT?TCACTTTTGT?GTATTCCAGT?TATTTATTAC

2160

2161 TCACAGTTCT?GTAGTTTTAA?CCAGAACAAA?GGGATTACCC?AGAAGAAAAG

AAGGTAAGCT 2220

2221?ATTTCATCAG?TTTTGGTGGA?AATCAGAAGT?TTTTTTTTCT?ATTATTAGCT?TTGTATTCTT

2280

2281 AAAAAAAAAA?AAAAAAAAAA?AAAAAAAAAA?AAA

2303

NCBI/ORF Finder program finds that this sequence has the complete ORF encoder block in+1 phase place; Between 1531-1779 Nucleotide; 82 the amino acid whose protein of encoding have the terminator codon TAG with framework at first ATG upper reaches of open reading frame, and there is terminator codon TGA in the downstream of coding framework; 3 ' end has polyA tail and AATAAA tailing signal, shows that this cDNA is a full-length cDNA.

2) the sequence similarity analytical results is seen Fig. 8

3) new gene electron stain body positioning result is seen Fig. 9

Networking http://genome.ucsc.edu/ carries out the assignment of genes gene mapping, finds that the assignment of genes gene mapping is in karyomit(e) 1q31.3.

4) genome structure is confirmed

Networking Http:// genome.ucsc.edu/cgi-bin/hgBlat? Command=startCarry out genome structure and confirm, find that this gene contains 2 exons, 1 intron; First exon is 204bp, and second exon is 2076bp, and intron is 38964bp; Site, intron exon boundary meets the GT-AG rule; Promoter element is initial sub-Inr, meets-1 to classify the CA rule as with+1 two site nucleotides sequence, and CAAT box is contained in the transcripting start point upper reaches-75 district.

5) new gene coded protein character function prediction

5.1) the coded protein basic physical and chemical predicts the outcome

Learn that according to opening code-reading frame this proteinic amino acid residue sequence is:

1 MCCALWVSGI?FVDEVICGMN?FDRSRITNKM?INVGTCLPCI

41 IFTMILRISM?YNLSLFLFFI?RINRISELVE?SIETVYTTLI?FR 82

Using P rotParam instrument ( Http:// expasy.org/tools/protparam.html) to analyze this protein molecular quality be 9554.5, iso-electric point (pI) is 7.60, molecular formula is C ₄₃₄H ₆₉₃N ₁₀₇O ₁₁₄S ₁₀, optical extinction coefficient is 8730M ^-1Cm ^-1(280nm), the transformation period is 30h (an external mammals skein cell), and unstable coefficient is 37.75, it is generally acknowledged that this albumen is stable, and hydrophobicity index is 122.32, overall average wetting ability 0.888.

5.2) the protein hydrophobic profile analysis

Using P rotScale instrument (www.expasy.org/tools/protscale.html) carries out protein hydrophobic profile analysis (result sees Figure 10)

5.3) protein function domain analyses result

Networking Http:// smart.embl-heidelberg.de/, the functional domain (seeing Figure 11, Figure 12) that analysing protein is possible:

Find that the 1-17 amino acid region contains signal peptide; The 29-51 amino acid region maybe be for striding the film district; The 52-74 amino acid region contains the LRR_SD22 functional domain, and the 75-82 amino acid region is inherent intrinsic disordered structure district, and the 2-39 amino acid region also possibly be the BowB structural domain.

6) the FAMLF gene between patient and the normal people of family, the differential expression analysis of U-937, HL-60, CA-46, RAGJ, SHI-1, Hela, acute monocytic leukemia, melanoma, hepatoma cell strain

6.1) use primer-design software Oligo 6.0 to analyze primers F 17, R539 according to the cDNA sequences Design differential expression of this gene:

Upstream primer F17:5 ' AAGCACTTTCTACCTTCCTCTC 3 '

Downstream primer R539:5 ' TCTCCCTTCAGTTTCCATCA 3 '

6.2) with β ₂ACTIN is that internal reference carries out OneStep RT-PCR reaction, reaction system:

Reaction parameter:

50℃?30min

95℃?15min

94 ℃ of 30sec circulate 35 times

52℃?30sec

72℃?30sec

4 ℃ keep down

Get 5ul PCR product respectively; 2% agarose electrophoresis, observations (seeing Figure 13, Figure 14, Figure 15), electrophorogram is reached a conclusion: Figure 13 shows that the confidential reference items segment is 251bp; The purpose segment is 175bp, and the result shows that the expression of FAMLF gene in the patient is apparently higher than the normal people; Figure 14 shows that the confidential reference items segment is 251bp, and the purpose segment is 522bp, and the result shows that FAMLF all has than high expression level in above-mentioned cell strain U937 cell strain, Raj cell strain, Ca46 cell strain, Shi-1 cell strain; Figure 15 result shows that the FAMLF gene expresses in the acute monocytic leukemia cell strain, in melanochrome, hepatoma cell strain, do not express, and the FAMLF gene can contain human gene FAMLF test kit as what malignant tumour detected; And human gene FAMLF encoded polypeptide and polynucleotide can be in the application in the preparation leukemia cell drug.

Embodiment 3: people's gene FAMLF Full Length cDNA Cloning

According to the sequence of people's gene FAMLF, design a pair of primers F 82 and R1974, the FAMLF full length gene cDNA amplification condition that is used to increase and comprises signal skin sequence: 95 ℃ of sex change 15min; Then with 94 ℃ of 30s, 58 ℃ of 1min, the program loop of 72 ℃ of 30s (total length 2min) 35 times; Last 72 ℃ are extended 7min.The PCR product adopts direct sequence verification, and is cloned on the carrier pMD18-T.Its exactness is identified in PCR and order-checking.Dna fragmentation reclaims the glue that uses Shanghai to give birth to worker company and reclaims test kit, and plasmid extraction uses Shanghai to give birth to the plasmid extraction test kit of worker company, and intestinal bacteria transform the heat-shocked method that adopts.Concrete steps are seen " molecular cloning ".Determined dna sequence shows: the dna sequence dna of PCR product is identical with the 82-1974bp shown in the sequence table < 210>1.(seeing that Fig. 1 is said)

Embodiment 4-1: the development of people's gene FAMLF specific monoclonal property antibody A

1) the sequence application software according to gene FAMLF designs and synthesizes immune epitope polypeptide [this polypeptide is positioned at the proteinic the 2nd to the 16th amino-acid residue (CALWVSGIFVDEVI-NH2) of this genes encoding] 20mg; Through detecting its purity 92%, reach this experimental requirements.

2) this polypeptide chain is connected keyhole limpet hemocyanin (KLH) and bovine serum albumin (BSA), two signs are respectively applied for the immune purifying and the ELISA monitoring of follow-up antibody.

3) above-mentioned KLH, BSA are connected polypeptide two New Zealand white rabbits of immunity respectively.

4) with above-mentioned labeling polypeptide immunity New Zealand white rabbit, and through ELISA monitor sero-fast progress up to its titre greater than 10,000 o'clock, all release the blood of New Zealand white rabbit the extraction that is used for antibody A.

5) extract the antibody A in the serum through affinity purification, obtain the antibody A 7ml that concentration is 1.3mg/ml.

6) antibody A of being extracted through Western Bloting checking (result sees Figure 16); Figure 16 reaches a conclusion: 1,33-1-3R3 (PA); To the proteinic the 4th to the 16th the pairing polypeptide fragment of amino-acid residue of this genes encoding-CALWVSGIFVDEVI-NH2); This antibody dilutes 250 times; 2, this antibody of 33-1-3R3 * (PA), thinning ratio is 50, and wherein GAPDH antibody and Actin antibody are as positive control, and the concrete steps of Western Bloting are seen " molecular cloning ", and the result shows the antibody of successfully preparing to FAMLF; 3, confirm that first FAMLF is the proteinic human gene of the about 8kD of coding.

Embodiment 4-2: the development of people's gene FAMLF specific monoclonal property antibody B

1) the sequence application software according to gene FAMLF designs and synthesizes immune epitope polypeptide [this polypeptide is positioned at the proteinic the 17th to the 29th amino-acid residue (CGMNFDRSRITNK-NH2) of this genes encoding] 20mg; Through detecting its purity 84%, reach this experimental requirements.

2) this polypeptide chain is connected keyhole limpet hemocyanin (KLH) and bovine serum albumin (BSA), two signs are respectively applied for the immune purifying and the ELISA monitoring of follow-up antibody.

3) above-mentioned KLH, BSA are connected polypeptide two New Zealand white rabbits of immunity respectively.

4) with above-mentioned labeling polypeptide immunity New Zealand white rabbit, and through ELISA monitor sero-fast progress up to its titre greater than 10,000 o'clock, all release the blood of New Zealand white rabbit the extraction that is used for antibody B.

5) extract the antibody B in the serum through affinity purification, obtaining concentration is the antibody B 4ml of 0.1mg/ml.

6) the antibody B that is extracted through Western Bloting checking equally, the result shows the antibody B that successfully prepares to FAMLF.

Embodiment 4-3: the development of people's gene FAMLF specific monoclonal property antibody C

1) the sequence application software according to gene FAMLF designs and synthesizes immune epitope polypeptide [this polypeptide is positioned at the proteinic the 61st to the 77th amino-acid residue (C-RINRISELVESIETVYT-NH2) of this genes encoding] 20mg; Calculate 83% through detecting its purity, reach this experimental requirements.

2) this polypeptide chain is connected keyhole limpet hemocyanin (KLH) and bovine serum albumin (BSA), two signs are respectively applied for the immune purifying and the ELISA monitoring of follow-up antibody.

3) above-mentioned KLH, BSA are connected polypeptide two New Zealand white rabbits of immunity respectively.

4) with above-mentioned labeling polypeptide immunity New Zealand white rabbit, and through ELISA monitor sero-fast progress up to its titre greater than 10,000 o'clock, all release the blood of New Zealand white rabbit the extraction that is used for antibody C.

5) extract the antibody C in the serum through affinity purification, obtaining concentration is the antibody C 7ml of 1.7mg/ml.

6) the antibody C that is extracted through Western Bloting checking equally, the result shows the antibody C that successfully prepares to FAMLF.

Embodiment 5: the application of people's gene FAMLF specific monoclonal property antibody

At protein level quantitative analysis (result sees Figure 17, Figure 18, Figure 19) is carried out in the expression in cell strain, clinical leukaemic and normal people of people FAMLF gene through Western Blot; Reach a conclusion: 1, antibody A; To the proteinic the 2nd to the 16th the pairing polypeptide fragment of amino-acid residue (CALWVSGIFVDEVI-NH2) of this genes encoding, this antibody is used for detecting the expressed protein FAMLF of new gene through Western Bloting; 2, the protein high expression level in many cell strains relevant that shows the new genes encoding of FAMLF through WesternBloting scientific discovery result with white blood disease; High expression level in the clinical leukaemic of part; In the normal people, do not express, FAMLF is the new gene relevant with human leukemia; The present invention has prepared the test kit that contains human gene FAMLF that the FAMLF gene detects as malignant tumour through current techique; Test kit adopts universal method to detect; The result is illustrated in to contain in U937 cell strain, Raj cell strain, Ca46 cell strain, the Shi-1 cell strain all to be had than high expression level; In white blood disease NB4, U937, K562, myeloma cell line U266, white blood disease H160 cell, lymphoma cell strain CA46, have, can detect and contain acute monocytic leukemia cell line and CA46 than high expression level.Human gene encoded polypeptide and polynucleotide can be in the application in the preparation leukemia cell drug.

Through a large amount of tests, obtain Fujian Province's acute myeloid leukemia high density family family tree shown in figure 20.

Claims (4)

1. the specific antibody of a human gene FAMLF is developed used immune peptide epi-position:

SEQ?ID?NO:1

CGMNFDRSRITNK-NH2。

2. be directed against the specific antibody of the described immune peptide epi-position of claim 1.

3. the specific antibody of a human gene FAMLF is developed used immune peptide epi-position:

SEQ?ID?NO:2

CRINRISELVESIETVYT-NH2。

4. be directed against the specific antibody of the described immune peptide epi-position of claim 3.

Images