CN102604967A - Peanut salt-tolerant associated gene Rab7 and application thereof to improvement of salt tolerance - Google Patents
Peanut salt-tolerant associated gene Rab7 and application thereof to improvement of salt tolerance Download PDFInfo
- Publication number
- CN102604967A CN102604967A CN2012100834108A CN201210083410A CN102604967A CN 102604967 A CN102604967 A CN 102604967A CN 2012100834108 A CN2012100834108 A CN 2012100834108A CN 201210083410 A CN201210083410 A CN 201210083410A CN 102604967 A CN102604967 A CN 102604967A
- Authority
- CN
- China
- Prior art keywords
- peanut
- salt
- gene
- rab7
- ahrab7
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention provides a peanut salt-tolerant associated gene Rab7 (AhRab7) and an Rab7 (RabG3f) protein generated by encoding the gene. The amino acid sequence similarity of the protein to AtRabG3f in arabidopsis thaliana is 92 percent. After the gene is excessively expressed in a peanut, a transgenic plant of which the salt tolerance is obviously improved is obtained. After the gene is expressed in escherichia coli, the salt tolerance of a recombinant bacterium is obviously improved. The tolerance of the peanut and the escherichia coli to high-salt stress can be obviously improved through the over expression of the AhRab7 gene, and the normal growth and the economic character of the peanut are not obviously affected. The protein and the gene encoding the protein have an important theoretic and practical significance in study on the salt-tolerant mechanism of plants and the improvement of associated characters of the plants. The protein and the gene have an important effect in the improvement of salt-tolerant genetic engineering of the plants and have wide application prospect.
Description
Technical field
The invention belongs to biological technical field, relate in particular to the peanut salt-resistant related gene
Rab7(
AhRab7) and the application in improving salt tolerance.
Background technology
Peanut is important oil crops and cash crop, in China's agriculture prodn and even whole national economy, has critical role.Salt stress has suppressed the growth of peanut, causes that plant is wilted, pod increases and slows down, fruitlet is significantly increased, output reduces, and makes the qualitative change of pod article bad simultaneously, and commodity value obviously reduces.Along with the continuous deterioration of environment, cultivating the crop new variety with salt tolerance has become one of major objective of the man research of vast breeding.Current development genetic engineering technique rapidly is that genetic modification of plants provides new approach, and being utilized in gene that salt stress plays an important role in replying, to carry out genetic transformation be the important means that obtains the salt tolerant new germ plasm.Therefore, excavate important resistant gene of salt resource, will be the salt tolerant genetic improvement establish a firm foundation of peanut.
Rab albumen is the maximum subtribe of little gtp binding protein family, and as the molecular switch of vesica transportation, it is constantly changed between GDP and GTP bonding state, in formation, transhipment, adhesion and the fusion process of vesica, plays an important role.Rab albumen is not only being regulated kinase whose activity, and further influences growth, differentiation and the apoptosis of cell, and it is regulating growth and development of plant, morphogenesis, the polarity secretion process of antimicrobial compounds during involved in plant is replied bacteria pathogeny.When plant receive external factor as arid, saline and alkaline, when disease is coerced, many Rab albumen are also arranged by abduction delivering.In the Rab subfamily; Rab7 albumen is mainly regulated the matter transportation of early stage endosome-late period endosome-lysosome and vacuole; It can be transported to high salt ion in the vacuole and excrete, and reduces the damage of salt ion to plant materials, and it can also remove the active oxygen that environment stress produces; Protection and reparation endomembrane system improve the resistance of plant.But in peanut, also do not see at present
Rab7The report of gene clone and functional study thereof.
Summary of the invention
The invention provides the peanut salt-resistant related gene
AhRab7And the application in salt tolerance, the present invention passes through will
AhRab7Gene changes over to respectively in peanut and the intestinal bacteria, can significantly improve their salt tolerance.
For realizing the foregoing invention purpose, the present invention adopts following technical proposals to be achieved:
The peanut salt-resistant related gene
AhRab7, its sequence table is shown in SEQ ID No:1.
Said
AhRab7Gene has 7 exons, and corresponding respectively base is 173-225,554-580,743-842,1611-1757,1860-1940,2099-2244,3167-3249.
Clone said peanut
AhRab7The primer title and the sequence of gene are following:
P1：5- TGCTTTGATTTGAGGAGGAC-3；
P2：5- ATATCTCAGCATTCACAACC -3，
Said P1 and P2 respectively with
Rab7Gene 1-20 base, 3235-3254 base pair should.
The present invention also provides and has contained described peanut salt-resistant related gene
AhRab7Carrier.
The present invention also provides described peanut salt-resistant related gene
AhRab7Amino acid sequence coded has GTP binding domains/hydrolysis structural domain in the said aminoacid sequence shown in SEQ ID No:2.
The present invention also provides described peanut salt-resistant related gene
AhRab7At the application that improves salt tolerance, said peanut
Rab7Gene can improve peanut and colibacillary salt tolerance.
With peanut
AhRab7Gene is overexpression in peanut, and the salt tolerant concentration of peanut transgenic seedling is 12 ‰ NaCl.
With peanut
AhRab7Gene changes intestinal bacteria over to, and expression product is 23KDa, and colibacillary salt tolerant concentration is 15% NaCl.
Compared with prior art, advantage of the present invention and positively effect are:
1, the present invention has cloned from peanut
AhRab7(sequencing result shows that this gene has 7 exons to gene, and corresponding respectively base is 173-225,554-580,743-842,1611-1757,1860-1940,2099-2244,3167-3249; GTP binding domains/hydrolysis structural domain is arranged in the aminoacid sequence, and corresponding respectively amino-acid residue is 15-22,62-66,124-128,156-160.
2, change
AhRab7The morphological development of gene peanut plant is normal, and anti-12 ‰ NaCl of transgenic peanut seedling coerce; The present invention will
AhRab7Gene can significantly improve its salt tolerance at the peanut overexpression.
3,
AhRab7The gene transformation intestinal bacteria, the reorganization bacterium can resist coercing of 15% NaCl.
4, transformation system is very effective.(6w) can obtain a large amount of resistance seedlings in the short period of time, and this is to obtain a large amount of transgenic seedlings and therefrom filter out the obviously important prerequisite of the transfer-gen plant of raising of salt tolerance.
After advantages embodiment of the present invention, other characteristics of the present invention and advantage will become clearer.
Description of drawings
Fig. 1 is a peanut genetic transformation among the present invention, a: the cotyledon explant of cultivating 3d altogether; B: the cotyledon explant of cultivating 2w; C: add the resistant buds (cultivating 4w) that screens on 100 mg/L kantlex substratum; The resistance seedling that screens on d:150 mg/L kantlex substratum (cultivating 6w).
Fig. 2 is T among the present invention
1The result of rotaring gene plant blade after the NaCl of 200 mM handles,
A: the vanes water (contrast) of unconverted plant (WT) and transformed plant (T) is handled the result behind the 7d;
B: the NaCl of vanes 200 mM of unconverted plant and transformed plant handles the result behind the 7d;
C: the variation of the chlorophyll content after the NaCl of vanes 200 mM of unconverted plant and transformed plant handles.
Fig. 3 is T among the present invention
1The result of transfer-gen plant after 12 ‰ NaCl processing, a: before the processing; After the NaCl of b:12 ‰ handles 7d.
Fig. 4 induces with IPTG among the present invention
AhRab7Gene is at expression in escherichia coli, M: albumen marker; 1: contrast BL21 (pET28a) induces 8h; 2-4:BL21 (pET28a-
AhRab7) induce 8h.Arrow refers to inductive AhRab7 albumen.
Fig. 5 is pET28a-among the present invention
AhRab7At the growing state of salts solution, a: contrast BL21 (pET28a) is at the growing state of different concns salts solution after IPTG induces; B:BL21 (pET28a-
AhRab7) at the growing state of different concns salts solution; C:PET28a and pET28a-
AhRab7Growing state (* P at 15% salts solution<0.05, * * P<0.01).
Embodiment
Below in conjunction with accompanying drawing and embodiment technical scheme of the present invention is done further detailed explanation.
Embodiment 1: peanut
Rab7Gene and the application in improving the peanut salt tolerance thereof
One, experiment material
1. gene, bacterial classification and rice varieties
The present invention has cloned peanut
Rab7Gene (
AhRab7); Bacillus coli DH 5 alpha is by the preservation of laboratory, Qingdao Agricultural University genetic research chamber, agrobacterium tumefaciens bacterial strain EHA105 (available from sky, Beijing bounties Gene Tech. Company Limited), and genetically modified acceptor material is peanut varieties " Xuzhou 68-4 " (laboratory, Qingdao Agricultural University genetic research chamber provides).
2. plant culture
The substratum that adopts during peanut transforms has:
Minimum medium: be MS inorganic salt+B
5Organic composition (is called for short MSB
5), add 3% sucrose, 0.8% agar, pH=5.8,20min sterilizes under 121 ℃, 105Kpa condition;
SIM inducing culture: MSB
5+ 5 mg/L BAP+1.5 mg/L 2,4-D;
SEM bud elongation medium: MSB
5+ 5 mg/L BAP.
Two, experimental technique
The present invention includes following concrete experimental procedure:
1,
AhRab7The structure of gene plant expression vector
(1) amplification
AhRab7Gene
Clone said peanut
AhRab7The primer title and the sequence of gene are following:
P1 (5- TGCTTTGATTTGAGGAGGAC-3)（SEQ ID No:4）；
P2 (5- ATATCTCAGCATTCACAACC -3)（SEQ ID No:5），
P1 and P2 respectively with
AhRab7Gene 1-20 base, 3235-3254 base pair should.
Peanut varieties " Xuzhou 68-4 " is provided by laboratory, Qingdao Agricultural University genetic research chamber, has increased through RT-PCR
AhRab7The coding region of gene (its sequence table is shown in SEQ ID No:3).
P3 (5-GGTACCCATGCCTTCCAGAAGAAGAAC-3) (
KpnI) （SEQ ID No:6）；
P4 (5-GAGCTCATCTCAGCATTCACAACCTGT-3) (
SacI) （SEQ ID No:7）；
Above-mentioned primer sequence respectively with
AhRab7Gene 1-20 base, 3235-3254 base pair should.
Will
AhRab7After the gene clone, sequencing result shows that this gene has 7 exons, and corresponding respectively base is 173-225,554-580,743-842,1611-1757,1860-1940,2099-2244,3167-3249; In the aminoacid sequence that this genes encoding produces GTP binding domains/hydrolysis structural domain is arranged, corresponding respectively amino-acid residue is 15-22,62-66,124-128,156-160.
(2)
AhRab7Gene is connected with cloning vector pUC18 and plant expression vector pBI121's
Reclaim the PCR product, and under the effect of T4 dna ligase, be connected, connect the bacterium colony that product transformed into escherichia coli DH5 α has obtained anti-penbritin with cloning vector pUC18 (purchase) in TaKaRa.Extract recombinant plasmid, use
KpnI with
SacI carries out double digestion, and recovery contains
AhRab7The endonuclease bamhi of gene, and be cloned in the corresponding restriction enzyme site of plant expression vector pBI121, the plant expression vector pBI121-of this gene obtained
AhRab7
3, expression vector is transformed peanut, may further comprise the steps:
The preparation of a, Agrobacterium recombinant bacterial strain, activation and the preparation of bacterium liquid: with pBI121-
AhRab7Recombinant plasmid utilizes the frozen-thawed method to transform agrobacterium strains EHA105 competent cell, filters out the recombinant bacterial strain that contains recombinant plasmid.Picking recombinant bacterial strain list bacterium colony; Be inoculated into YEB (Rifampin 50mg/L; Kantlex 50mg/L) in the liquid nutrient medium, 28 ℃, 180rpm are cultured to OD600=0.5 ~ 0.8 o'clock, get 2mL bacterium liquid and transfer to 50mL YEB (Rifampin 50mg/L; Kantlex 50mg/L) in the substratum, cultivates OD600=0.6 ~ 0.8.With bacterium liquid behind the centrifugal 15min of 5000rpm, with the liquid MSB of equal volume
5It is subsequent use to suspend.
The separation of b, the little leaf explant of peanut embryo: choose full peanut seed, in 70% alcohol, soak 1min, 0.1% mercuric chloride soaks 20min, aseptic water washing 4-6 time.Remove kind of skin and plumular axis, every cotyledon vertically is cut into 2 half.
C, agriculture bacillus mediated genetic transformation: the explant that cuts is dipped in the Agrobacterium bacterium liquid of having got ready, and 28 ℃, 90rpm are gentle, and 10min is infected in concussion, with aseptic filter paper residual bacterium liquid is blotted, and inserts on the SIM inducing culture and cultivates 3d darkling altogether.Transfer to the SIM inducing culture that adds 250 mg/L cephamycins, the explant cut ends is embedded substratum, cultivate about 2w, induced bundle is sprouted, culture condition: light intensity is that 1500-2000lx, illumination 12h, temperature are 26 ℃ ± 1 ℃.
The grow thickly explant of bud of formation is shifted and to the SEM substratum of 250 mg/L cephamycins, 100 mg/L kantlex, to screen resistant buds outward, cultivate 2w, culture condition: light intensity is that 1500-2000lx, illumination 12h, temperature are 26 ℃ ± 1 ℃.
After cultivating 2w, downcut indefinite bud and partly transfer on the SEM substratum of 250 mg/L cephamycins, 150 mg/L kantlex, carry out the screening and the induced bud elongation of resistant buds, cultivate about 4w, during succeeding transfer culture 2-3 time (as shown in Figure 1).
4, the PCR of transfer-gen plant detects
Extract the genomic dna of regeneration plant, utilize above-mentioned carrier sequence with
AhRab7Gene order design primer carries out pcr amplification.The PCR response procedures is: 95 ℃, 5min; 95 ℃, 50s, 56 ℃, 50s, 72 ℃, 1 min, 30 circulations; 72 ℃, 10min.Transfer-gen plant PCR positive rate reaches 20.1%.
5, the graft and transplantation of transgenic positive plant
" flower educates 23 " aseptic seedling with the 12-15d seedling age is a stock, and excision is practiced thrift the stem part more than the 2cm apart from cotyledon, with scalpel the about deeply 0.5-1cm of otch is vertically rived in the stock upper end.Work as T
0When growing to about 2-3cm for the transfer-gen plant seedling, downcut the regeneration seedling from bud clump base portion and do scion, the V-arrangement wound that is about 0.5-1cm is cut in the lower end, and otch is smooth.Scion is inserted in the stock, the form layers of stock and scion is closely contacted, twine interface with sealing film then, the degree of tightness appropriateness.Graft is placed MSB
5Sterile culture 3-4d in the substratum; Transplant then in the sterilization seedling medium in (comprising vermiculite, turfy soil and perlite) tame 3w, be transplanted to the field afterwards.Transfer-gen plant is acted normally in the field growing situation.
6, T
1For the transfer-gen plant selection of salt tolerance
Get T
1For seed, carry out vernalization processing in strong sprout and obtain T
1For seedling.Treatment process is: the vernalization 3d under 37 ℃ of conditions of elder generation; Carry out strong sprout after having gone out bud,, cultivate 15d under the condition of 14h light according to ∕ 10h dark at 24 ℃.Get T
1For seedling leaves, be immersed in the NaCl solution of 200mM and handle 1w, be contrast with not genetically modified Xuzhou 68-4 seedling leaves.Contrast blade wilting flavescence, chlorophyll content descends obviously; The part rotaring gene plant blade is greener, and chlorophyll content changes little (as shown in Figure 2).
For further analyzing the salt tolerance of transfer-gen plant, with the T that obtains
1Earlier with the NaCl solution-treated of 3-5 ‰, improving the NaCl strength of solution for seedling gradually, use 12 ‰ NaCl solution-treated at last, is contrast with not genetically modified Xuzhou 68-4 when carrying out selection of salt tolerance.There have the commentaries on classics plant seedling in 3 independent sources under 12 ‰ NaCl solution-treated, grow to be normal basically, and adjoining tree wilting (as shown in Figure 3), thus the anti-salt concn of these 3 transfer-gen plants be 12 ‰ or more than.
One, experiment material
1, bacterial classification and rice varieties
E. coli bl21, coli strain pET-28a are preserved by laboratory, Qingdao Agricultural University genetic research chamber.
2, plant culture
The substratum that adopts is the LB substratum.
Two, experimental technique
The present invention includes following concrete experimental procedure:
1,
AhRab7The structure of gene prokaryotic carrier
To carry
AhRab7The plasmid of the pUC18 reorganization of gene is a template, through pcr amplification
AhRab7Gene, the primer is:
P5 (5-CATATGATGCCTTCCAGAAGAAGAAC-3) (
NdeⅠ) （SEQ ID No:8）；
P6 (5-AAGCTTTCATCTCAGCATTCACAACCTGT-3) (
HindⅢ) （SEQ ID No:9）；
Reclaim the PCR product, and under the effect of T4 dna ligase, be connected, connect the bacterium colony that product transformed into escherichia coli DH5 α has obtained anti-penbritin with cloning vector pUC18.Extract recombinant plasmid, use
NdeI with
HinThe d III is carried out double digestion, and recovery contains
AhRab7The endonuclease bamhi of gene, and be cloned in the corresponding site of prokaryotic expression carrier pET-28a, this Prokaryotic Expression carrier pET-28a-obtained
AhRab7
2,
AhRab7The abduction delivering of gene in intestinal bacteria
Picking carries pET-28a-
AhRab7Single colony inoculation in the liquid LB substratum that contains 100 μ g/mL kantlex; 37 ℃ of shaking table 250rpm cultivate 16h; Forward in the liquid LB substratum that 10mL contains 100 μ g/mL kantlex 37 ℃ of shaking table 250rpm activation 2-3h in the ratio of the 1:30 switching bacterium liquid (about 340 μ L) that spends the night.When bacterium liquid OD600 reaches 0.6-0.8, add 100mM IPTG and make final concentration reach 1mM, in 37 ℃ of shaking table 250rpm inducing culture 8h.The product of e. coli bl21 after IPTG induces 8h that contains pET-28a is as contrast.Get the bacterium 1.5mL at night after inducing; The centrifugal 2min of 12000rpm abandons supernatant and adds 60 μ L phosphoric acid buffers with abundant suspension thalline, adds isopyknic sample-loading buffer mixing; Room temperature is placed 5min; 100 ℃ are boiled the 5min postcooling to room temperature, and the centrifugal 2min of 12000rpm gets isolate and on 5% concentrated glue, 12% separation gel, carries out SDS-PAGE and analyze.PET-28a-
AhRab7The reorganization bacterium obtained the big or small specific band product that is about 23KDa, and contrast pET-28a does not have this band (as shown in Figure 4) after inducing after inducing.
3, pET-28a-
AhRab7The salt tolerance of reorganization bacterium is measured
By 1:100 learn from else's experience IPTG inductive reorganization bacterium and control strain; Place 10mL to contain the liquid LB (containing 100 μ g/mL kantlex) of 0,1.5%, 3.5%, 5.5%, 7.5%, 10.0%, 12.5% and 15.0% NaCl respectively it; Get the culture of cultivating 0h, 1h, 2h, 3h, 4h, 5h respectively and survey its absorbancy in 600nm; Repeat 3 times, draw its growth curve according to experimental result, experimental result is carried out statistical study.PET-28a-
AhRab7The reorganization bacterium can also grow in 15% NaCl solution, and the growth of contrast bacterium receives severe inhibition (as shown in Figure 5).
Above embodiment is only in order to explaining technical scheme of the present invention, but not limits it; Although the present invention has been carried out detailed explanation with reference to previous embodiment, for the person of ordinary skill of the art, still can make amendment to the technical scheme that previous embodiment is put down in writing, perhaps part technical characterictic wherein is equal to replacement; And these modifications or replacement do not make the essence of relevant art scheme break away from the spirit and the scope of the present invention's technical scheme required for protection.
SEQUENCE LISTING
< 110>Qingdao Agricultural University
< 120>peanut salt-resistant related gene Rab7 and the application in improving salt tolerance thereof
<130>
<160> 9
<170> PatentIn version 3.3
<210> 1
<211> 3254
<212> DNA
< 213>peanut
<400> 1
tgctttgatt tgaggaggac tagaaagctc gccccaagtc tcaactctca acgcaactgc 60
tttgctgaga ctctcaacag aaagcggtta cacctttttc cgatctctct aacagaacaa 120
caacaacaaa aagcggttac actttttttt cccgatcggt gaaaaagtaa ccatgccttc 180
cagaagaaga actctattga aggtcatcat tctcggtgac agcgggtaag ttacttttcg 240
attccagtct ttcttctttg ttgcaatcat gatttctctg cagatctttg ctttaacctt 300
cacgatttcc gtttttctgc cacctactta gctcaattcg atcgaatttt ttttctccct 360
aggatcttgt atttttgtcg ctttctgctg cggaaattgc cttttgtttt caactctttt 420
tcttgatgca tacgcacgat tggttgatac tggaaagaaa ttttcactat atttgatcgt 480
gatttgaatc atatgtgcac tttcaatctt ggtagcagct tgcgtttatg taacactgtt 540
tgtgctgttg cagggtaggg aagacatctt tgatgaatca gtatcctttg gtgtttggtt 600
cttcaaattc attcgtcctt gctttctttt ttttttttac gcgatttgtt tggtatagtt 660
tagcgctgta ccaaggggtt acatattgaa tttcggttga gtagacttaa aagcatgcat 720
ttccctaaca aatataattt agatatgtga ataagaagtt tagcaaccag tacaaggcaa 780
ccattggagc ggacttttta acaaaggagg tgcaatttga agataggctt ttcaccttgc 840
aggtttgtga acggtactca gttgtgcttt tttttttttt gtgcatgtgt gtgtgcttga 900
ccatatccat atgcataagc tggataatta ggtaaggtgg cgaatctcgg ggatatatct 960
gactagttgc ttgaaaaatg ctatgtgttg gactattaat ttatctgata ctacttagat 1020
ttttctgtat tttatatgtt atatttcata atacatactg attttaggta aagaacttag 1080
gctgcaactc tctaagtgaa cgaagttgga tatgttgttt ctgagtgata tcagcttgtg 1140
gaaaaaaaaa cacttagttg gaaatgcata acatatttac cccagactct taccatttgt 1200
gatgatttct cggattaaga ttctttcctt gttgtacctt taatattaga aagcctaagc 1260
cttaaagtgt atcagttgat gtctttgaaa cctattggtt cttcttcttg atgtctttga 1320
aaatgggatc ttggttgtat cagttggtac tgtttcctat tgtgtctcag aaattgtttt 1380
tcatcatatg acacatttcg atgaggcaca tacatgtgat tagatataat gatctcactc 1440
ttggagtgct atctgataca tctatgtaac tttgtcatat aaataatgct tggactctta 1500
tctacataca tgacacaaca attctcttgt tatctcttga aagttttaag ctacaacagt 1560
tgtcaagttt tactattctt tattcttatt ttaatatttg ctccttgcag atttgggata 1620
cagctggtca ggaaagattc caaagcctag gagttgcttt ctaccgtggg gctgattgct 1680
gtgttcttgt atatgatgtt aattcaatga aatcattcga caaccttaac aactggaggg 1740
aggaatttct gattcaggta ggcctgcgtt cctcttgctg gacatatttc tcagtcttat 1800
tatcacaagc aatgtctaag tgatttttca aatgttaagc tgtgcaataa ttttttcagg 1860
ctagtccttc cgatccagag aattttcctt ttgttgttat aggaaacaag gtagatattg 1920
atggtggaaa cagtagagtg gtacgttttc tctttcctag agttggctgt tttccatgtt 1980
tcttttcttt ccgtcaaatg tttgattagc tcagatgtgt tcatactcat aaaatacctg 2040
aaatatactg ctggacagct gaactactta acacaagaaa gtgattgtgt cactgcaggt 2100
ttcggaaaag aaggctcggg cttggtgtgc atcaaaagga aatatcccat attttgagac 2160
atctgccaag gaaggtatta acgttgaaga agcattccag tgcatagcca agaatgccct 2220
gaaaagtggg gaagaagagg aattgtaagt tctcaaatgt tatctctctt cttctttagt 2280
gtatgtggac aaatgcaggc acaaatacat ttagaatccc tgattatagc atcagttaat 2340
tggttggggg aacatactat aattccattg gtgttttagc tcacaagaga catgttgtct 2400
ctcactctct tcaaagggga agatctataa atgatgatta tggaaacaat tacaaaccat 2460
tactgacata ataataataa taataataag gcgggcatcc ttgaatagtt gactactcat 2520
tattaaacct tgaagttaca ttagatagta ccaccgcact ttaaagttac attggatata 2580
gtggttccag tttatataat cataccctgc aaatgagtat aaccgattct tttaagttag 2640
ctcttcgatt catttttttc ttgatttagt taccagatat taggctgtgt tcagttctga 2700
gaacagaaca agacaggata ctgagaacaa gacacagatg acaaggacac aaaaatgagt 2760
gttgtatttt gtttgatgat aaattaaata taagaaagaa taaattatga aagtctaatt 2820
taatcatttt tttcttgcaa aaaattttag ggaaaataat ataaagataa aaaatataat 2880
tatgtaaagc tgatagataa taaaagaaga aatgaaaaaa taaattgtcg ttttttagta 2940
tcctagtctc tttcttgtca tgaaggaaac aaaatatact aattcaatga ctctagacac 3000
aatgtttgtg tccatctctc atttgccaaa tatgattgtg tctttatctc agtatcccgt 3060
gtctggaaac aaacacagcc ttatagatct cgtatataat ttggaaaaac tgaaataatc 3120
cgatatgtta ttgatttcgc gtcttgaccg aagctctgat tgtggtaact gttttattgt 3180
agatacctac ccgacacaat tgatgttgga accagcagtc agcaacgggc aacaggttgt 3240
gaatgctgag atat 3254
<210> 2
<211> 206
<212> PRT
< 213>peanut
<400> 2
Met Pro Ser Arg Arg Arg Thr Leu Leu Lys Val Ile Ile Leu Gly Asp
1 5 10 15
Ser Gly Val Gly Lys Thr Ser Leu Met Asn Gln Tyr Val Asn Lys Lys
20 25 30
Phe Ser Asn Gln Tyr Lys Ala Thr Ile Gly Ala Asp Phe Leu Thr Lys
35 40 45
Glu Val Gln Phe Glu Asp Arg Leu Phe Thr Leu Gln Ile Trp Asp Thr
50 55 60
Ala Gly Gln Glu Arg Phe Gln Ser Leu Gly Val Ala Phe Tyr Arg Gly
65 70 75 80
Ala Asp Cys Cys Val Leu Val Tyr Asp Val Asn Ser Met Lys Ser Phe
85 90 95
Asp Asn Leu Asn Asn Trp Arg Glu Glu Phe Leu Ile Gln Ala Ser Pro
100 105 110
Ser Asp Pro Glu Asn Phe Pro Phe Val Val Ile Gly Asn Lys Val Asp
115 120 125
Ile Asp Gly Gly Asn Ser Arg Val Val Ser Glu Lys Lys Ala Arg Ala
130 135 140
Trp Cys Ala Ser Lys Gly Asn Ile Pro Tyr Phe Glu Thr Ser Ala Lys
145 150 155 160
Glu Gly Ile Asn Val Glu Glu Ala Phe Gln Cys Ile Ala Lys Asn Ala
165 170 175
Leu Lys Ser Gly Glu Glu Glu Glu Leu Tyr Leu Pro Asp Thr Ile Asp
180 185 190
Val Gly Thr Ser Ser Gln Gln Arg Ala Thr Gly Cys Glu Cys
195 200 205
<210> 3
<211> 642
<212> cDNA
< 213>peanut
<400> 3
ccatgccttc cagaagaaga actctattga aggtcatcat tctcggtgac agcggggtag 60
ggaagacatc tttgatgaat caatatgtga ataagaagtt tagcaaccag tacaaggcaa 120
ccattggagc ggacttttta acaaaggagg tgcaatttga agataggctt ttcaccttgc 180
agatttggga tacagctggt caggaaagat tccaaagcct aggagttgct ttctaccgtg 240
gggctgattg ctgtgttctt gtatatgatg ttaattcaat gaaatcattc gacaacctta 300
acaactggag ggaggaattt ctgattcagg ctagtccttc cgatccagag aattttcctt 360
ttgttgttat aggaaacaag gtagatattg atggtggaaa cagtagagtg gtttcggaaa 420
agaaggctcg ggcttggtgt gcatcaaaag gaaatatccc atattttgag acatctgcca 480
aggaaggtat taacgttgaa gaagcattcc agtgcatagc caagaatgcc ctgaaaagtg 540
gggaagaaga ggaattaact gttttattgt agatacctac ccgacacaat tgatgttgga 600
accagcagtc agcaacgggc aacaggttgt gaatgctgag at 642
<210> 4
<211> 20
<212> DNA
< 213>artificial sequence
<400> 4
tgctttgatt tgaggaggac 20
<210> 5
<211> 20
<212> DNA
< 213>artificial sequence
<400> 5
atatctcagc attcacaacc 20
<210> 6
<211> 27
<212> DNA
< 213>artificial sequence
<400> 6
ggtacccatg ccttccagaa gaagaac 27
<210> 7
<211> 27
<212> DNA
< 213>artificial sequence
<400> 7
gagctcatct cagcattcac aacctgt 27
<210> 8
<211> 26
<212> DNA
< 213>artificial sequence
<400> 8
catatgatgc cttccagaag aagaac 26
<210> 9
<211> 29
<212> DNA
< 213>artificial sequence
<400> 9
aagctttcat ctcagcattc acaacctgt 29
Claims (9)
1. peanut salt-resistant related gene
Rab7, its sequence table is shown in SEQ ID No:1.
2. peanut salt-resistant related gene according to claim 1
Rab7, it is characterized in that said
Rab7Gene has 7 exons, and corresponding respectively base is 173-225,554-580,743-842,1611-1757,1860-1940,2099-2244,3167-3249.
3. peanut salt-resistant related gene according to claim 1
Rab7, it is characterized in that cloning said peanut
Rab7The primer title and the sequence of gene are following:
P1：5- TGCTTTGATTTGAGGAGGAC-3；
P2：5- ATATCTCAGCATTCACAACC -3，
Said P1 and P2 respectively with
Rab7Gene 1-20 base, 3235-3254 base pair should.
4. contain the described peanut salt-resistant related gene of claim 1
Rab7Carrier.
5. the described peanut salt-resistant related gene of claim 1
Rab7The aminoacid sequence that coding produces has GTP binding domains/hydrolysis structural domain in the said aminoacid sequence shown in SEQ ID No:2.
6. peanut salt-resistant related gene according to claim 1
Rab7Application in improving salt tolerance.
7. peanut salt-resistant related gene according to claim 6
Rab7Application in improving salt tolerance is characterized in that said peanut
Rab7Gene can improve peanut and colibacillary salt tolerance.
8. peanut salt-resistant related gene according to claim 7
Rab7Application in improving salt tolerance is characterized in that peanut
Rab7Gene is overexpression in peanut, and the salt tolerant concentration of peanut transgenic seedling is 12 ‰ NaCl.
9. peanut salt-resistant related gene according to claim 7
Rab7Application in improving salt tolerance is characterized in that peanut
Rab7Gene changes intestinal bacteria over to, and expression product is 23KDa, and colibacillary salt tolerant concentration is 15% NaCl.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201210083410 CN102604967B (en) | 2012-03-27 | 2012-03-27 | Peanut salt-tolerant associated gene Rab7 and application thereof in improvement of salt tolerance |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201210083410 CN102604967B (en) | 2012-03-27 | 2012-03-27 | Peanut salt-tolerant associated gene Rab7 and application thereof in improvement of salt tolerance |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102604967A true CN102604967A (en) | 2012-07-25 |
| CN102604967B CN102604967B (en) | 2013-07-17 |
Family
ID=46522735
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201210083410 Expired - Fee Related CN102604967B (en) | 2012-03-27 | 2012-03-27 | Peanut salt-tolerant associated gene Rab7 and application thereof in improvement of salt tolerance |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102604967B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108728447A (en) * | 2018-06-04 | 2018-11-02 | 青岛农业大学 | One cultivates peanut anti contravariance related gene and its application |
| CN108795941A (en) * | 2018-07-02 | 2018-11-13 | 青岛农业大学 | A kind of inducible promoter and its application |
| CN108812295A (en) * | 2018-06-06 | 2018-11-16 | 山东省花生研究所 | A kind of high oleic acid salt tolerant peanut selection |
| CN109355295A (en) * | 2018-09-12 | 2019-02-19 | 青岛农业大学 | One cultivate peanut AhWRKY75 gene and its improve peanut salt tolerance in application |
| CN110982827A (en) * | 2019-12-26 | 2020-04-10 | 山东大学 | Soybean williams 82 middle and small G protein gene GmRAB7 and application thereof |
| CN114292320A (en) * | 2022-01-24 | 2022-04-08 | 青岛农业大学 | Peanut SL-type oil body protein gene AhOLE2 and application thereof in improving salt tolerance of plants |
-
2012
- 2012-03-27 CN CN 201210083410 patent/CN102604967B/en not_active Expired - Fee Related
Non-Patent Citations (4)
| Title |
|---|
| DREW,J.E. ET AL: "P31022", 《GENBANK》 * |
| JIONG-MING SUI ET AL: "Isolation and characterization of a stress responsive small GTP-binding protein AhRabG3b in peanut (Arachis hypogaea L.)", 《EUPHYTICA》 * |
| SALANOUBAT,M. ET AL: "NP_188512", 《GENBANK》 * |
| YOUNG,N.D. ET AL: "XP_003606887", 《GENBANK》 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108728447A (en) * | 2018-06-04 | 2018-11-02 | 青岛农业大学 | One cultivates peanut anti contravariance related gene and its application |
| CN108812295A (en) * | 2018-06-06 | 2018-11-16 | 山东省花生研究所 | A kind of high oleic acid salt tolerant peanut selection |
| CN108795941A (en) * | 2018-07-02 | 2018-11-13 | 青岛农业大学 | A kind of inducible promoter and its application |
| CN108795941B (en) * | 2018-07-02 | 2021-04-23 | 青岛农业大学 | Inducible promoter and application thereof |
| CN109355295A (en) * | 2018-09-12 | 2019-02-19 | 青岛农业大学 | One cultivate peanut AhWRKY75 gene and its improve peanut salt tolerance in application |
| CN110982827A (en) * | 2019-12-26 | 2020-04-10 | 山东大学 | Soybean williams 82 middle and small G protein gene GmRAB7 and application thereof |
| CN114292320A (en) * | 2022-01-24 | 2022-04-08 | 青岛农业大学 | Peanut SL-type oil body protein gene AhOLE2 and application thereof in improving salt tolerance of plants |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102604967B (en) | 2013-07-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102604967B (en) | Peanut salt-tolerant associated gene Rab7 and application thereof in improvement of salt tolerance | |
| CN106636025B (en) | A kind of rice EPSP S mutant and its encoding gene and application | |
| CN101747419A (en) | Protein related to salt tolerance, coding gene thereof and application thereof | |
| CN109536516B (en) | Cloning and application of corn drought-resistant gene ZmDSR | |
| CN110643618A (en) | Jatropha curcas MYB transcription factor JcMYB16 gene and application thereof in improving drought resistance of plants | |
| CN102978218B (en) | Cloning of apple stress-resistant related gene MdSIMYB2 and application of cloning of apple stress-resistant related gene MdSIMYB2 | |
| CN103194456B (en) | Lilium regale antifungal gene Lr14-3-3 and application thereof | |
| CN102643830A (en) | Application of cotton gene GbMYB 5 related to drought resistance | |
| CN103695439A (en) | Fortunella.crassifolia FcWRKY70 gene and application of gene in improving drought tolerance of plants | |
| CN102719449A (en) | Clone of apple resistance-related gene MdSIMYB1 and application thereof | |
| CN113388017B (en) | Drought-resistant protein and application of coding gene thereof in cultivating drought-resistant plants | |
| CN101993481B (en) | Plant stress resistance related protein as well as coding gene and application thereof | |
| CN101748144B (en) | Torch pear haloduric gene PpGST and application thereof | |
| CN102477435A (en) | Method for improving plant drought resistance using Poncirus trifoliata transcription factor gene PtrABF | |
| CN103421104A (en) | Application of OsLEA3-2 in improvement of stress resistance of crop | |
| CN100513421C (en) | Plant inverse-resistant zinc finger protein, coding gene and application thereof | |
| CN102559699A (en) | CsCoL1 gene relative to cymbidium sinense photoperiod and application of CsCoL1 gene | |
| CN115433264A (en) | Rice disease-resistant gene LBRW1, recombinant vector, recombinant engineering bacterium and application | |
| CN115058433A (en) | Tobacco leaf yellowing regulation gene NtMYB2, protein and application thereof | |
| CN113046375A (en) | SpCPK33 gene and application of encoding protein thereof in regulation and control of tomato drought tolerance | |
| CN102146128B (en) | Protein MtMYB1 related to stress tolerance of plants and encoding gene and application thereof | |
| CN113913441B (en) | Application of rice nascent polypeptide binding complex alpha subunit NACA gene in osmotic stress resistance of plants | |
| CN102952810A (en) | Draught resistant gene TaPK of wheat as well as coding protein and application | |
| CN113621038B (en) | Oligopeptide capable of improving germination rate of plant seeds under salt stress and application of oligopeptide | |
| CN117777262B (en) | Application of wheat TAALDHASE gene in regulation and control of wheat stem basal rot resistance |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C53 | Correction of patent of invention or patent application | ||
| CB03 | Change of inventor or designer information |
Inventor after: Sui Jiongming Inventor after: Zheng Chunhua Inventor after: Wang Ya Inventor after: Li Rui Inventor after: Wang Jingshan Inventor after: Qiao Lixian Inventor after: Guo Baotai Inventor before: Sui Jiongming Inventor before: Li Rui Inventor before: Wang Jingshan Inventor before: Qiao Lixian Inventor before: Zheng Chunhua Inventor before: Guo Baotai |
|
| COR | Change of bibliographic data |
Free format text: CORRECT: INVENTOR; FROM: SUI JIONGMING LI RUI WANG JINGSHAN QIAO LIXIAN ZHENG CHUNHUA GUO BAOTAI TO: SUI JIONGMING ZHENG CHUNHUA WANG YA LI RUI WANG JINGSHAN QIAO LIXIAN GUO BAOTAI |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130717 Termination date: 20140327 |