CN102604897B - Application of lentivirus containing carp IGF2b gene in increasing carp meat yield - Google Patents
Application of lentivirus containing carp IGF2b gene in increasing carp meat yield Download PDFInfo
- Publication number
- CN102604897B CN102604897B CN201210087621.9A CN201210087621A CN102604897B CN 102604897 B CN102604897 B CN 102604897B CN 201210087621 A CN201210087621 A CN 201210087621A CN 102604897 B CN102604897 B CN 102604897B
- Authority
- CN
- China
- Prior art keywords
- carp
- igf2b
- gene
- slow virus
- meat yield
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/80—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in fisheries management
- Y02A40/81—Aquaculture, e.g. of fish
Landscapes
- Farming Of Fish And Shellfish (AREA)
Abstract
The invention relates to application of a lentivirus containing a carp IGF2b gene in increase of carp meat yield. According to the invention, non-mitotic cells and mitotic cells in a specific tissue of a carp are infected with the lentivirus containing the carp IGF2b gene, and the expression of a target gene in the specific tissue is affected, so that the growth status of the carp is changed. A result shows that when carp larvae are infected with a lentivirus that contains the carp IGF2b gene according to a detection result, after three months, compared with a control group, the weight of the carps in an infection group is significantly increased, in addition, each index of carp blood is not affected, and the safety is good.
Description
Technical field
The invention belongs to molecular biology fish breeding technical field, relate in particular to a kind of slow virus that contains carp IGF2b gene in the application improving in carp meat yield.
Background technology
At present, the carp that obtains faster growing speed is still the demand of industry development, therefore, select fast growth, colory carp kind, especially select good candidate gene and suitable treatment process when improving carp growth speed, not to affect the expression of other proterties, have great importance.
The method that in traditional protokaryon, microinjection, sperm vector method, liposome transfection method, retrovirus vector method, nuclear transfer method etc. improve animal varieties performance is all because the shortcomings such as cost is high, efficiency is low or Insert Fragment is little cannot widespread use.
The slow virus that contains carp IGF2b gene is the virus liquid that a kind of employment work point obtains from the method with modifying, according to carp RNA, reverse transcription is cDNA, design again corresponding primer and carry out pcr amplification, with corresponding restriction endonuclease cutting, obtain the gene fragment that contains IGF2b, thereby be finally connected with carrier pLenti6.3-IRES-EGFP by this gene fragment, obtain the slow virus that contains carp IGF2b gene; Its concrete preparation method is shown in that number of patent application is described in 201110356210.0 patent application document.
The slow virus that contains carp IGF2b gene with this is processed carp and infects non-division stage and division cells in carp particular organization, thus the expression that affect particular organization's target gene consequently its upgrowth situation change.This kind of breeding method is applied to fish and can determines in a short time the strain with goal gene, improve carp meat yield, thereby shorten the fish breeding time, and can make to be integrated in long-term, the stable expression of the genomic goal gene of target cell, this type of is studied, and so far there are no reports.
Summary of the invention
The technical problem solving: the object of the invention is to overcome the deficiencies in the prior art, provide a kind of slow virus that contains carp IGF2b gene in the application improving in carp meat yield.
Technical scheme:
Concrete treatment step is as follows:
(1) employment work point obtains the slow virus that contains carp IGF2b gene from the method with modifying;
(2) allow carp infect described slow virus, in carp body, inject described slow virus;
(3) with green fluorescence, determine that whether infection is successful: infect after 48h, by fluorescent microscope observation method, observe the expression situation of green fluorescent protein, if any the expression of green fluorescent protein, show that described carp has infectd described slow virus;
As a further improvement on the present invention, described in step (2), the infection of slow virus completed in the juvenile fish stage.
As of the present invention, further improve, in step (2), when described carp body weight is 5g, inject described slow virus.
As a preferred embodiment of the present invention, in step (2), carp injection site is muscle of back.
As further preferred version of the present invention, carp injection site is fix a point the foremost intermediate point of side line vertical range of dorsal fin in step (2).
The present invention also comprises that observation is because infection causes the step (4) of the variation of carp proterties: after 3 months, and checking carp growth situation and physiochemical indice situation.
Beneficial effect
After 3 months, verify upgrowth situation and the physiochemical indice situation of infected carp, its verification method is according to negative control, positive control, contrasts the body weight change situation of carp of different injected dose and the changing condition of physiochemical indice.Result shows, with the slow virus infection carp young that contains carp IGF2b gene having detected, infected group is compared control group, and carp body weight has obtained the effect of remarkable increase, and dosage better effects if when larger, and on the not impact of carp physiochemical indice, security is good simultaneously.
This kind of breeding method is applied to fish and can determines in a short time the strain with goal gene, shorten the fish breeding time, and can make to be integrated in long-term, the stable expression of the genomic goal gene of target cell, owing to physiochemical indice not being impacted, so security is good.
Accompanying drawing explanation
Fig. 1 is the expression that fluorescent microscope detects fish body green fluorescent protein after slow virus injection 48h, can show by the growth result of the carp muscle of back of slow virus infection have green fluorescence explicit declaration infected by this expression
Fig. 2 cultivates the difference of the weight character of different experiments group fish after 3 months
Embodiment
Embodiment 1
For Control experiment error, all injection work is completed by a people, and all experimental group all cultivate in the same pool, and all aquaculture managements are undertaken by a people.
(1) slow virus that contains carp IGF2b gene is from the compound breeding of China Aquatic Science Research Academy Fresh Water Fishery Research Center carp seminar, the patent application document that its preparation method is 201110356210.0 referring to number of patent application, 250 tail carps are taken from Nan Quan cultivation base, fresh water fishery research centre, China Aquatic Science Research Institute Wuxi, set up altogether 5 experimental group:
One is the negative control group being left intact;
One is to inject the positive controls that does not contain the slow virus diluent of carp IGF2b gene, and injection volume is 20 μ L, amounts to approximately containing 1.1 * 10
5individual virus;
Other three is the slow virus infection group containing carp IGF2b gene slow virus diluent according to basic, normal, high three different concns gradients injection, and its injected dose is respectively 10 μ L, 20 μ L and 40 μ L, and corresponding is respectively 5.54 * 10 containing viral number
4individual virus, 1.1 * 10
5individual virus, 2.22 * 10
5individual virus.
(2) after 48h, choose at random each 2 tails of negative control group, positive controls and each dosage infected group fish, carry out green fluorescent protein (GFP) fluoroscopic examination.Result demonstration, each dosage infected group fish has all infected carp IGF2b gene slow virus, sees Fig. 1;
(3) on the basis of (2), cultivate after 3 months, measure body weight, calculate the growth performance between different experiments group fish.Result demonstration, the carp that infects carp IGF2b gene slow virus is obviously larger than not infecting this viral carp body weight, and the body weight of the highest infective dose 40uL group is maximum, sees Fig. 2.
(4) on the basis of (3), measured the physiochemical indice of different experiments group fish, comprise albumen on kidney, liver and IGF2 Signal transduction pathway totally 9 indexs, measuring sample size is 20 tail fishes, the results are shown in following table.
Note: difference letter mark represents significant difference, marks or has same letter to represent that difference is not remarkable without letter
By upper table, shown: between 8 index negative control group such as alkaline phosphatase, total protein, blood urea nitrogen, creatinine, total cholesterol, IMA-IGF2BP3-001, IGF-1 1, IGF-1 2 and positive controls, all there is no significant difference, only have this index positive controls of alanine transaminase higher than negative control group;
Again, creatinine, IMA-IGF2BP3-001, IGF-1 1 and IGF-1 2 do not detect significant difference between infected group and control group yet;
Finally, 10 μ L virus liquid infected group, increase alanine transaminase in blood, alkaline phosphatase, blood urea nitrogen and total protein concentration, and 20 μ L virus liquid infected group and 40 μ L virus liquid infected group total cholesterol concentrations reduce.
Comprehensive above step, we can obtain, with the slow virus that contains carp IGF2b gene, carry out the injection of carp muscle of back, can obtain the IGF2b animal model of crossing expression at carp back, according to fluoroscopic examination, can determine the infectious effect of slow virus, according to the detection of growth differences between different experiments group after 3 months, can determine the influence degree of carp IGF2b gene overexpression to carp body weight change: result shows, with the slow virus infection carp young that contains carp IGF2b gene having detected, infected group is compared control group, carp body weight has obtained the effect of remarkable increase, and better effects if when dosage is larger, simultaneously on the not impact of carp physiochemical indice, security is good.
Embodiment 2
That carp injection site is fix a point the foremost intermediate point of side line vertical range of dorsal fin in step (2) with embodiment 1 difference.
Its beneficial effect is for can guarantee more that the infected degree of carp is identical on the same group.
Claims (5)
1. contain the slow virus of carp IGF2b gene in the application improving in carp meat yield, realize as follows:
(1) employment work point obtains the slow virus that contains carp IGF2b gene from the method with modifying;
(2) carp infects described slow virus: the slow virus obtaining in injecting step (1) in body during the stage carp juvenile fish;
(3) with green fluorescence, determine and infect whether success: infect after 48h, by fluorescent microscope observation method, observe the expression situation of green fluorescent protein, successfully infect the expression that has green fluorescent protein in the carp body of slow virus;
The wherein said slow virus that contains carp IGF2b gene is the virus liquid that a kind of employment work point obtains from the method with modifying, according to carp RNA, reverse transcription is cDNA, design again corresponding primer and carry out pcr amplification, with corresponding restriction endonuclease cutting, obtain the gene fragment that contains IGF2b, thereby be finally connected with carrier pLenti6.3-IRES-EGFP by this gene fragment, obtain the slow virus that contains carp IGF2b gene;
Lei IGF2b said gene coding sequence follows the Genbank accession number AF402958:ATGGAGGACCAACTAAAACATCATTCTTTGTGCCATACTTGTTTGAGAACAGACAGTGTCATAAATAAGGTCATAAAGATGTACTGGTCCATACGAATGCCCATATGCATACTGTTTTTAACCCTGTCTGCCTTCGAAGTGGCTTCAGCTGAAACGTTATGCGGCGGAGAGCTGGTGGACGCGCTACAGTTTGTGTGTGGAGACAGAGGTTTCTATTTCAGTCGACCAACTAGCAGGTTGAGCAGTCGACGTTCTCAAAATCGTGGGATTGTGGAAGAGTGTTGTTTTAACAGTTGTAACCTAGCTCTTCTAGAACAGTACTGCGCTAAACCTGCCAAGTCAGAGAGGGACGTTTCAGCCACATCCCTACAGGTCATCCCGGTGATGCCCACATTAAAACAGGAGGTCCCAAGAAAACATGTGACCGTGAAATATTCCAAATACGACATGTGGCAACGAAAGGCCGCCCAGAGGCTACGGAGGGGCGTCCCCGCCATCCTGCGGGCCAAGAAGTTTAGGCGGCAGGCGGAGAGAATCAGGGCCCAAGAGCAACTGCACCACCACAGGCCTCTCATCACGCTTCCCAGCAAGCTCCCGCCCATCCTTTTTGCACAGAGTCGATGA。
2. the slow virus that contains carp IGF2b gene according to claim 1, in the application improving in carp meat yield, is characterized by: in step (2), inject described slow virus when carp body weight is 5g.
3. the slow virus that contains carp IGF2b gene according to claim 1 and 2, in the application improving in carp meat yield, is characterized by: in step (2), carp injection site is muscle of back.
4. the slow virus that contains carp IGF2b gene according to claim 1 and 2, in the application improving in carp meat yield, is characterized by: in step (2), carp injection site is fix a point the foremost intermediate point of side line vertical range of dorsal fin.
5. the slow virus that contains carp IGF2b gene according to claim 1 and 2 is in the application improving in carp meat yield, it is characterized by: also comprise step (4): observe the variation that causes carp proterties due to infection: carp, infect described slow virus after 3 months, upgrowth situation and the physiochemical indice situation of checking carp.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210087621.9A CN102604897B (en) | 2012-03-28 | 2012-03-28 | Application of lentivirus containing carp IGF2b gene in increasing carp meat yield |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210087621.9A CN102604897B (en) | 2012-03-28 | 2012-03-28 | Application of lentivirus containing carp IGF2b gene in increasing carp meat yield |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102604897A CN102604897A (en) | 2012-07-25 |
| CN102604897B true CN102604897B (en) | 2014-04-16 |
Family
ID=46522672
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210087621.9A Expired - Fee Related CN102604897B (en) | 2012-03-28 | 2012-03-28 | Application of lentivirus containing carp IGF2b gene in increasing carp meat yield |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102604897B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103555791A (en) * | 2013-10-28 | 2014-02-05 | 中国水产科学研究院淡水渔业研究中心 | Clustering method for inspecting influence of slow viruses containing carp IGF2b (Insulin Growth Factor 2b) gene on physiques of carps |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1487083A (en) * | 2003-07-10 | 2004-04-07 | 中山大学 | Grouper insulin-like growth factor II gene, carrier and recombinant strain containing the gene and application thereof |
| CN102250912A (en) * | 2011-06-10 | 2011-11-23 | 中国水产科学研究院淡水渔业研究中心 | Construction method for lentiviral vector containing IGF2b gene |
| CN102363792A (en) * | 2011-11-11 | 2012-02-29 | 中国水产科学研究院淡水渔业研究中心 | Lentivirus method for preparing IGF2b transgenic fish |
-
2012
- 2012-03-28 CN CN201210087621.9A patent/CN102604897B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1487083A (en) * | 2003-07-10 | 2004-04-07 | 中山大学 | Grouper insulin-like growth factor II gene, carrier and recombinant strain containing the gene and application thereof |
| CN102250912A (en) * | 2011-06-10 | 2011-11-23 | 中国水产科学研究院淡水渔业研究中心 | Construction method for lentiviral vector containing IGF2b gene |
| CN102363792A (en) * | 2011-11-11 | 2012-02-29 | 中国水产科学研究院淡水渔业研究中心 | Lentivirus method for preparing IGF2b transgenic fish |
Non-Patent Citations (4)
| Title |
|---|
| Expression of recombinant tilapia insulin-like growth factor-I and stimulation of juvenile tilapia growth by injection of recombinant IGFs polypeptides;Jyh-Yih Chen et al;《Aquaculture》;20000115;第181卷(第3-4期);347-360 * |
| Jyh-Yih Chen et al.Expression of recombinant tilapia insulin-like growth factor-I and stimulation of juvenile tilapia growth by injection of recombinant IGFs polypeptides.《Aquaculture》.2000,第181卷(第3-4期),347-360. |
| PCR-cloning and gene expression studies in common carp (cyprinus carpio) insulin-like growth factor-II;Tse MC et al;《Biochimica et Biophysica Acta》;20020503;第1575卷(第1-3期);63-74 * |
| Tse MC et al.PCR-cloning and gene expression studies in common carp (cyprinus carpio) insulin-like growth factor-II.《Biochimica et Biophysica Acta》.2002,第1575卷(第1-3期),63-74. |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102604897A (en) | 2012-07-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ito et al. | Growth of cyprinid herpesvirus 2 (CyHV-2) in cell culture and experimental infection of goldfish Carassius auratus | |
| Thangaraj et al. | Cyprinid herpesvirus‐2 (CyHV‐2): A comprehensive review | |
| CN105368791A (en) | Porcine pseudorabies virus gene-deleted strain, vaccine composition and their preparation method and application | |
| CN108251384A (en) | One plant of kinds of fish Rhabdovirus attenuated vaccine strain | |
| CN104208669B (en) | A kind of canine distemper, canine parvovirus disease bigeminy vaccine and preparation method thereof | |
| CN104911152B (en) | One 09 plant of plant weight group infectious hematopoietic necrosis poison rIHNV HLJ and its construction method and application | |
| CN113583968A (en) | Infectious pancreatic necrosis vaccine and method for amplifying virus thereof on salmon embryo cells | |
| CN100516198C (en) | Production method for rude type Brucella and its bacterin by using gene recombination technique | |
| CN102363769A (en) | Chicken Marek's disease Meq gene deleted vaccine strain, construction method thereof, and application thereof | |
| IŞIDAN et al. | A survey of viral hemorrhagic septicemia (VHS) in Turkey | |
| Zhou et al. | Establishment of a Chinese sturgeon Acipenser sinensis tail‐fin cell line and its susceptibility to frog iridovirus | |
| CN103623403A (en) | Vaccine composition for resisting swine fever virus and porcine circovirus 2 infection, and preparation and application thereof | |
| CN102604897B (en) | Application of lentivirus containing carp IGF2b gene in increasing carp meat yield | |
| CN103468733B (en) | The expression vector of resisting porcine circovirus 2 type and transgenic pig and construction process thereof | |
| Liu et al. | Isolation, genomic and biological characterizations of a rhabdovirus from mandarin fish (Siniperca chuatsi) | |
| CN102154293A (en) | Small-interfering RNA (siRNA) capable of inhibiting classical swine fever virus (CSFV) reproduction and infection as well as preparation method and application thereof | |
| CN114836474B (en) | Construction of grass carp ctnnb1 gene over-expression lentivirus and application thereof in improving fish hepatic cell sugar utilization capacity | |
| CN102559762A (en) | Preparation method for anti-foot-and-mouth disease virus RNAi (Ribonucleic Acid interference) transgenic livestock | |
| CN105238764A (en) | Pseudorabies virus LLT region delta Intron strain as well as construction method and application | |
| CN102943127A (en) | Primers and detection kit for avian leukosis J subgroup virus PCR detection | |
| CN102703506A (en) | Alpha 1,2-fucosyltransferase gene silenced somatic cloning pig, as well production method and application thereof | |
| CN105969745B (en) | Fish hypoxemia tolerance gene and application thereof | |
| CN104774873B (en) | A kind of assembled in vitro GCRV preparation method | |
| CN103468725A (en) | Construction and application of PTEN gene overexpression recombinant adenoviral vectors | |
| CN102363792A (en) | Lentivirus method for preparing IGF2b transgenic fish |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140416 Termination date: 20160328 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |