CN102586327A - D24 fiber protein modified conditionally replicating adenovirus carrier with exogenous gene by one-step method and application of carrier - Google Patents
D24 fiber protein modified conditionally replicating adenovirus carrier with exogenous gene by one-step method and application of carrier Download PDFInfo
- Publication number
- CN102586327A CN102586327A CN2012100149515A CN201210014951A CN102586327A CN 102586327 A CN102586327 A CN 102586327A CN 2012100149515 A CN2012100149515 A CN 2012100149515A CN 201210014951 A CN201210014951 A CN 201210014951A CN 102586327 A CN102586327 A CN 102586327A
- Authority
- CN
- China
- Prior art keywords
- gene
- carrier
- pgemt
- scleroproein
- positive colony
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Abstract
The invention discloses a D24 fiber protein modified conditionally replicating adenovirus carrier with an exogenous gene by a one-step method and an application of the carrier. on the basis of an Ad56 D24 conditionally replicating adenovirus carrier, the construction efficiency of the carrier for inserting into the exogenous gene can be improved by two aspects: (1) a BamHi locus on an adenovirus gene group is mutated; and (2) BamHi and SfuI are introduced between fiber and E4 by a homologous recombination method so as to introduce the exogenous gene into the adenovirus gene group in one step by an enzyme digestion ligation method. The obtained D24 fiber protein modified conditionally replicating adenovirus carrier with an exogenous gene is subjected to the pesticide effect experiment to prove that the D24 fiber protein modified conditionally replicating adenovirus carrier with an exogenous gene can improve a treatment effect on turmor.
Description
Technical field
The invention belongs to the biological gene technical field, relate to the structure and the application of gene, be specifically related to condition replication type adenovirus carrier and application thereof that single stage method makes up the D24 scleroproein modification of carrying foreign gene.
Background technology
Verified at present, molecule and cytopathy process that tumour forms are by due to the transgenation, thereby theoretically, and it is feasible designing gene therapy to the different steps of tumour pathology and different qualities.At present, virus vector and non-virus carrier are mainly used in gene therapy.Because the non-virus carrier transfection efficiency is lower, so the virus vector mediation is used in present most gene therapy.
Adenovirus carrier is used for field of gene and has many-sided advantage, as: the cells infected type is wide, and infection rate is high; Physico-chemical property is stable, prepares infectious titer easily; Unconformability is gone into cellular genome, and genetoxic is lower; Security is good etc.Result of study before shows, carries therapeutic gene through adenovirus and will promote the kill capability of adenovirus for tumour cell significantly.Yet the process that makes up the oncolytic adenovirus carrier that carries foreign gene is very complicated, and needs the time of labor.Therefore, be necessary to make up a kind of universal carrier framework for adenovirus, make its need can realize foreign gene is inserted in the adenovirus skeleton carrier through cutting to connect once the step enzyme.
Summary of the invention
The objective of the invention is to; The condition replication type adenovirus carrier that the D24 scleroproein that carries foreign gene that provides a kind of single stage method to make up is modified; On Ad5 D24 condition replication type adenovirus carrier basis, the transformation of following two aspects of process is to improve the structure efficient that this type carrier inserts foreign gene: the BamHI site on (1) sudden change adenoviral gene group; (2) method through homologous recombination is introduced BamHI and SfuI between fiber and E4, thereby can go on foot through the method one that enzyme is cut connection foreign gene is introduced in the adenoviral gene group.The condition replication type adenovirus carrier that the D24 scleroproein that carries foreign gene that obtains is modified can be used for preparing the application in the medicine for treating tumor thing.
In order to realize above-mentioned task, the present invention takes following technical scheme:
The condition replication type adenovirus carrier that the D24 scleroproein that carries foreign gene that a kind of single stage method makes up is modified; It is characterized in that; 24bp base deletion among the recombinant adenoviral vector Ad5 E1A, the type recombinant adenoviral vector can specificity duplicate in the tumour cell of pRBnull/mutant; Adopt the method for homologous recombination that the BamHI that Ad5 adenoviral gene group is positioned at last the 21468bp of Hexon～21573bp is suddenlyd change; The modification scleroproein that inserts at Ad5 adenoviral gene group 31042bp place is 5/3,5/6,5/7, in 5/11,5/35 sequence any one; Between Ad5 adenoviral gene group fiber and E4, promptly introduce two single restriction enzyme site BamHI, SfuI, between two single restriction enzyme sites that Ad5 adenoviral gene group is introduced, insert an Expression element that is used to screen at Ad5 adenoviral gene group the 32788bp～32913bp place; Between two single restriction enzyme sites that Ad5 adenoviral gene group is introduced, insert two-way expression cassette, this two-way expression cassette carries a reporter gene and a therapeutic gene, obtains carrying the condition replication type adenovirus carrier that the D24 scleroproein of foreign gene is modified.
The position of above-mentioned 24bp base deletion is at the 922bp～947bp of adenoviral gene group, and the base deletion sequence is cttacctgccacgaggctggcttt.
The Expression element of above-mentioned screening is the beta-galactosidase gene Expression element that is used for the screening of blue hickie, any one of the fluorescent protein expression element that is used for screening of in bacterium, expressing, penbritin Expression element, kantlex Expression element, paraxin Expression element.
Above-mentioned reporter gene is any one in green fluorescent protein, red fluorescent protein, luciferase, the beta-galactosidase gene.
Above-mentioned therapeutic gene is TRAIL, IL-24, IL-12, IFN, p53, arresten, any one among the endostatin etc.
The condition replication type adenovirus carrier that the D24 scleroproein that carries foreign gene that above-mentioned single stage method makes up is modified specifically makes up by following step:
The method of (1) cutting connection with enzyme makes up the shuttle vectors of 24 base deletions in the Ad5 E1A molecule:
With the Ad5 geneome plasmid is template, obtains to contain the gene fragment of 24bp base deletion in the Ad5 E1A molecule through the lap over polymerase chain reaction.The polymerase chain reaction fragment is connected with pGEMT-T easy carrier, will connects product and transform DH5 α cell, extract DNA, through the enzyme evaluation positive colony of cutting and check order through the alkaline bleach liquor cleavage method.Institute is obtained positive colony called after pGEMT/Ad5-D24F.
The Ad5-D24F fragment is gone up to get off through PacI and SpeI double digestion from pGEMT/Ad5-D24F, and be connected with the adenovirus E 1 shuttle vectors of SpeI double digestion processing with PacI.Connection product conversion DH5 α cell, extraction DNA, enzyme are cut and are identified that acquisition positive colony, called after pHBD24 shuttle, this carrier are the shuttle vectors that the pAd5 E1A 24bp of acquisition lacks.
(2) make up pHBD24-backbone:
With linearizing pHBD24shuttle shuttle vectors of ScaI and ClaI linearizing adenovirus skeleton carrier pTG3602/SwaI preparation in 3: 1 in molar ratio, cotransformation competent cell BJ5183 extracts DNA through the alkaline bleach liquor cleavage method.Through the enzyme evaluation positive colony of cutting and check order, the positive colony that is obtained is the carrier framework for adenovirus of 24 base deletions in the Ad5 E1A molecule, called after pHBD24-backbone.
(3) pHBD24-backbone in the BamHI site in the structure rite-directed mutagenesis six conjuncted albumen hypervariable regions 5:
With adenovirus Ad5 genome is template, obtains the homology arm sequence of six conjuncted albumen hypervariable region 5 sequence downstream 2300bp through the method for PCR, is connected on the pGEM-T easy carrier, obtains pGEMT/Hexon HR down-1.With pGEMT/Hexon HR down-1 is template, adopts the BamHI site in the PCR reaction rite-directed mutagenesis six conjuncted albumen hypervariable region 5 downstream homology arm sequences, the positive colony called after pGEMT/Hexon BM of acquisition.
With linearizing pHBD24-backbone of SwaI and pGEMT/Hexon BM preparation in 1: 6 in molar ratio; Cotransformation competent cell BJ5183; Extract DNA through the alkaline bleach liquor cleavage method, through the enzyme evaluation positive colony of cutting and check order, the positive colony that is obtained is pHBD24BM.
(4) plasmid vector of 3 ' upper reaches 2.0kb homology arms of the adenoviral fiber protein modification sequence of the single restriction enzyme site BmaHI of structure introducing:
With adenovirus Ad5 genomic dna is template, to introduce the fragment of 5 ' the end upper reaches 2.0kb that the Ad5 scleroproein of single restriction enzyme site modifies through pcr amplification, and the reaction amplified production is to reclaim fragment behind 1% the agarose gel electrophoresis through mass concentration; The polymerase chain reaction product that reclaims is connected with the pGEMT-easy carrier respectively; Extract DNA through the alkaline bleach liquor cleavage method; Cut and check order through enzyme and identify and obtain the plasmid vector of positive colony for the adenoviral fiber protein sequence 5 ' upper reaches 2.0kb homology arms of introducing single restriction enzyme site BamHI, called after pGEMT/fiber up-BamHI; Tail and chimeric Shaft of scleroproein and the Knob sequence of synthetic Ad5; On the Tail of Ad5 sequence, contain the NdeI site; Introduce the SpeI site at the Knob of scleroproein modification sequence 3 ' end; Through NdeI and SpeI double digestion, in the corresponding restriction enzyme site of pshuttle Ad5-E4-fiber carrier, the novel vector that is obtained is called pGEMT/fiber chimeric up BamHI with this sequence clone.
(5) structure is introduced the plasmid vector of the adenovirus E4 sequence 3 ' upper reaches 2.0kb homology arms of single restriction enzyme site SfuI:
With adenovirus Ad5 genomic dna is template, to introduce the fragment of Ad5E4 district 3 ' the end upper reaches 2.0kb of single restriction enzyme site through pcr amplification, reclaims fragment after reacting amplified production and through mass concentration be 1% agarose gel electrophoresis; The polymerase chain reaction product that reclaims is connected with the pGEMT-easy carrier respectively; Extract DNA through the alkaline bleach liquor cleavage method; Cut and check order through enzyme and identify and obtain the plasmid vector of positive colony for the adenovirus E4 sequence 3 ' upper reaches 2.0kb homology arms of introducing single restriction enzyme site SfuI, called after pGEMT/E4 up-SfuI;
(6) make up the shuttle vectors that screening-gene is carried at adenovirus fiber-E4 position:
Be the basis with the pUC19 carrier; Mode at the two ends of the opening code-reading frame of ammonia benzyl resistant gene through transgenation produces two single restriction enzyme site XbaI and SfuI; To block that resistant gene then is cloned in the site of XbaI and SfuI; That resistance carrier of the card that is obtained is connected with EcoRI-HindIII linker, the carrier called after pUCKanEHL of acquisition;
Fiber up and E4up are scaled off through corresponding enzymes double zyme on pGEMT/fiber chimeric up BamHI and pGEMT/E4 up-SfuI respectively; Be connected into pUCKanEHL more successively; Cut evaluation through alkaline bleach liquor cleavage method extraction DNA, enzyme; Obtain positive colony, called after pshuttle-fiber-E4HR;
The screening Expression element that will pass through single restriction enzyme site BamHI and the pairing enzymes double zyme cutting of SfuI is connected into the pshuttle-fiber-E4HR carrier through the same enzyme double digestion; Extract DNA through the alkaline bleach liquor cleavage method; Enzyme is cut and is identified that obtaining positive colony is the shuttle vectors that screening-gene is carried at adenovirus fiber-E4 position, called after pshuttle-fiber-E4/screeninggene.
(7) structure is introduced the condition replication type adenovirus carrier of the D24 scleroproein modification of single restriction enzyme site:
With pshuttle-fiber-E4/screening gene and pHBD24BM respectively through behind PacI and the SwaI linearization for enzyme restriction; 6: 1 in molar ratio preparation cotransformation BJ5183 competent cells; Extraction DNA, enzyme are cut and are identified that obtaining positive colony is the condition replication type adenovirus carrier of introducing the D24 scleroproein modification of single restriction enzyme site, called after pHBD24-fiber chimeric-BS.
(8) make up the shuttle vectors that carries foreign gene:
Through polymerase chain reaction method amplification miniCMV-SV40 Expression element, product is connected with pGEMT-T easy carrier, through the enzyme evaluation positive colony of cutting and check order, the positive colony called after pGEMT/miniCMV-SV40 that obtains; Same amplification PGK-SV40 Expression element is connected product with pGEMT-T easy carrier, through the enzyme evaluation positive colony of cutting and check order, the positive colony called after pGEMT/PGK-SV40 that obtains; MiniCMV-SV40 fragment and PGK-SV40 are gone up to get off through corresponding restriction enzyme site double digestion from pGEMT/miniCMV-SV40 and pGEMT/PGK-SV40 respectively; Be connected with the pUCKanEHL that cuts through same enzyme; Connect product and adopt the conversion that uses the same method; Extract DNA, enzyme is cut and is identified acquisition positive colony, called after pshuttle-BS-PGK-miniCMV; In the miniCMV-SV40 expression cassette, be connected into reporter gene then respectively and in the PGK-SV40 expression cassette, be connected into therapeutic gene, extract DNA, enzyme is cut and is identified acquisition positive colony, called after pshuttle-BS-therapeutic gene/reporter gene.
(9) carry the structure and the virus preparation of the condition replication type adenovirus carrier that the D24 scleroproein of foreign gene modifies:
Pshuttle-BS-therapeutic gene/the reporter gene that builds and pHBD24-fiber chimeric-BS cut through BamHI and SfuI enzyme be connected after handling; Connecting product transforms, cultivates, screens; Through shake bacterium, extract DNA, enzyme is cut and check order and identify that obtaining positive colony is to carry the condition replication type adenovirus that the D24 scleroproein of foreign gene is modified; Called after pHBD24-fiber chimeric-therapeutic gene/reporter gene; With pHBD24-fiber chimeric-therapeutic gene/reporter gene carrier transfection HEK293 cell after the PacI linearizing, obtain virus stock solution used after 7-10 days, through amplification; Carry the condition replication type adenovirus carrier of the D24 scleroproein modification of foreign gene, called after HBD24-fiber chimeric-therapeutic gene/reporter gene through acquisition behind the CsCl gradient centrifugation purification.
The present invention adopts condition replication type adenovirus carrier to carry a reporter gene and a therapeutic gene, in tumor disease therapeutic, has important value.The test of pesticide effectiveness through the applicant proves that the condition replication type adenovirus carrier that adopts the constructed D24 scleroproein that carries the external source therapeutic gene of method of the present invention to modify can improve the tumor treatment effect.
Description of drawings
Fig. 1 is a 24bp base deletion condition replication type adenovirus carrier framework pHBD24-backbone synoptic diagram in the E1A molecule.
Fig. 2 is the synoptic diagram that the shuttle vectors of screening-gene is carried at adenovirus fiber-E4 position.
Fig. 3 is a synoptic diagram of introducing the condition replication type adenovirus carrier that the D24 scleroproein of single restriction enzyme site modifies.
Fig. 4 is the synoptic diagram that carries the foreign gene shuttle vectors.
Fig. 5 is the synoptic diagram of the condition replication type adenovirus carrier of the D24 scleroproein modification of the expressing green fluorescent protein that obtains and TRAIL.
Fig. 6 is the growth-inhibiting exercising result of HBD24-5/11-TRAIL/eGFP adenovirus carrier to cerebral glioma U251 cell.
Fig. 7 is the efficiency of infection result of HBD24-5/11-TRAIL/eGFP adenovirus carrier to cerebral glioma U87 cell.
Fig. 8 is the experimental therapy result of HBD24-5/11-TRAIL/eGFP adenovirus carrier in the tumor model animal.
To further explain of the present invention, but the invention is not restricted to these embodiment below in conjunction with accompanying drawing and embodiment.
Embodiment
Embodiment 1:
Present embodiment provides the condition replication type adenovirus carrier HB D24-5/11-TRAIL/eGFP of the D24 scleroproein modification of carrying eGFP and TRAIL, and is specific as follows:
(1) 24 base sequences that in adenovirus hominis carrier 5 type genomes, lack between the 922bp～947bp, the 24bp base sequence of this disappearance is: cttacctgccacgaggctggcttt.
(2) the 31042bp place is scleroproein Tail place in adenovirus hominis carrier 5 type genomes, inserts the scleroproein 5/11 of a modification.The sequence of its insertion is:
atgaagcgcgcaagaccgtctgaagataccttcaaccccgtgtatccatatgacacggaaaccggtcctccaactgtgccttttcttactcctccctttgtatcccccaatgggtttcaagagagtccccctggtcttactttaaaatgtttaaccccgctaacaaccacaggcgggtctctacagctaaaagtgggagggggacttacagtagatgacactgatgggaccttacaagaaaacataggtaccaccacaccacttgttaagactgggcactctataggtttatccctaggagccggattgggaacagatgaaaataaactttgtaccaaattgggaaaaggacttacattcaattcaaacaacatttgcattgatgacaatattaacaccctgtggacaggaattaaccccaccgaagccaactgtcaaatgatggactccagtgaatctaatgattgcaaattaattctaacactagttaaaactggagccctagtcactgcatttgtttatgttataggagtatctaacaattttaatatgctaactacatacagaaatataaattttactgcggagctgttttttgattctgcgggtaatttactaactagcctgtcatccctaaaaactccacttaatcataaatcaggacaaaacatggctactggtgccattactaatgctaaaagtttcatgcccagcacaactgcttatcctttcaataataattctagagaaaaagaaaactacatttacggaacctgtcactacacagctagtgatcacactgcttttcccattgacatatctgtcatgcttaaccaaagagcaataagagctgatacatcatattgtattcgtataacttggtcctggaacacaggagatgccccagaggggcaaacctctgctacaaccctagttacctccccatttaccttttactacatcagagaagacgactga。
(3) in adenovirus hominis carrier 5 type genomes, insert the Expression element of DE TRAIL and eGFP between 32021bp～32022bp, its sequence is following:
agatctccatagagcccaccgcatccccagcatgcctgctattgtcttcccaatcctcccccttgctgtcctgccccaccccaccccccagaatagaatgacacctactcagacaatgcgatgcaatttcctcattttattaggaaaggacagtgggagtggcaccttccagggtcaaggaaggcacgggggaggggcaaacaacagatggctggcaactagaaggcacagtctagattacttgtacagctcgtccatgccgagagtgatcccggcggcggtcacgaactccagcaggaccatgtgatcgcgcttctcgttggggtctttgctcagggcggactgggtgctcaggtagtggttgtcgggcagcagcacggggccgtcgccgatgggggtgttctgctggtagtggtcggcgagctgcacgctgccgtcctcgatgttgtggcggatcttgaagttcaccttgatgccgttcttctgcttgtcggccatgatatagacgttgtggctgttgtagttgtactccagcttgtgccccaggatgttgccgtcctccttgaagtcgatgcccttcagctcgatgcggttcaccagggtgtcgccctcgaacttcacctcggcgcgggtcttgtagttgccgtcgtccttgaagaagatggtgcgctcctggacgtagccttcgggcatggcggacttgaagaagtcgtgctgcttcatgtggtcggggtagcggctgaagcactgcacgccgtaggtcagggtggtcacgagggtgggccagggcacgggcagcttgccggtggtgcagatgaacttcagggtcagcttgccgtaggtggcatcgccctcgccctcgccggacacgctgaacttgtggccgtttacgtcgccgtccagctcgaccaggatgggcaccaccccggtgaacagctcctcgcccttgctcaccatctcgagatacagctccaccgcacatgccaccctccggatatattcgtctcgagcaaatcactcgagtatgtcgaggtggcgtgtacggtgggaggcctatataagcagagctcgtttagtgttggcagtctagcggctagcacgcgttgacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcatcgatatggctatgatggaggtccaggggggacccagcctgggacagacctgcgtgctgatcgtgatcttcacagtgctcctgcagtctctctgtgtggctgtaacttacgtgtactttaccaacgagctgaagcagatgcaggacaagtactccaaaagtggcattgcttgtttcttaaaagaagatgacagttattgggaccccaatgacgaagagagtatgaacagcccctgctggcaagtcaagtggcaactccgtcagctcgttagaaagatgattttgagaacctctgaggaaaccatttctacagttcaagaaaagcaacaaaatatttctcccctagtgagagaaagaggtcctcagagagtagcagctcacataactgggaccagaggaagaagcaacacattgtcttctccaaactccaagaatgaaaaggctctgggccgcaaaataaactcctgggaatcatcaaggagtgggcattcattcctgagcaacttgcacttgaggaatggtgaactggtcatccatgaaaaagggttttactacatctattcccaaacatactttcgatttcaggaggaaataaaagaaaacacaaagaacgacaaacaaatggtccaatatatttacaaatacacaagttatcctgaccctatattgttgatgaaaagtgctagaaatagttgttggtctaaagatgcagaatatggactctattccatctatcaagggggaatatttgagcttaaggaaaatgacagaatttttgtttctgtaacaaatgagcacttgatagacatggaccatgaagccagttttttcggggcctttttagttggctaaactagtggatccggctgtggaatgtgtgtcagttagggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatcacaattagtcagcaaccaggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctcggcctctgagctattccagaagtagtgaggaggcttttttggaggcctaggcttttgcaaaaagcttgaattcgctgtctgcgagggccggctgttggggtgagtactccctctcaaaagcgggcatgacttctgcggccgc。
The condition replication type adenovirus carrier construction method step that the D24 scleroproein of above-mentioned expressing green fluorescent protein eGFP and trail dna is modified is following:
1, makes up the shuttle vectors of 24bp base deletion in the Ad5 E1A molecule
Through designing two pairs of primers, be template with the Ad5 geneome plasmid, obtain to contain the gene fragment of 24bp base deletion in the Ad5 E1A molecule through the lap over polymerase chain reaction.P1-P4 is the sequence of two pairs of primers:
P1：ATTAATTAACATCATCAATAATATACCTTATTTTGGATT；
P2：TCCTCGTCGTCACTGGGTGGAATCCAAAATAAGGTATATTATTGATGATG；
P3：CCACCCAGTGACGACGAGGATGAAGAGGGTGAGGAGTTT；
P4：TACTAGTCCGCTCTCCACAGATGCATGGCCAG。
The PCR amplification condition is: 94 ℃, 2 minutes, and 94 ℃, 50 seconds, 55 ℃, 60 seconds, 72 ℃, 2 minutes, 30 circulations.Overlapping polymerase chain reaction product is to reclaim fragment after 1.0% the agarose electrophoresis through mass concentration.The polymerase chain reaction fragment is connected with pGEMT-T easy carrier.Condition of contact is: 2 μ l enzymes are cut the purifying fragment; 5 μ l, 2 * T4 ligase enzyme damping fluid, 0.5 μ l pGEMT-T easy carrier, 0.5 μ l T4 ligase enzyme; 2 μ l tri-distilled waters; 25 ℃ connect 1 hour, with the DH5 α cell that connects the product transformed competence colibacillus, and coat in the LB flat board of the penbritin that contains 100 μ g/ml.Picking colony is inoculated in the LB nutrient solution of the penbritin that contains 100 μ g/ml, after 14～16 hours, extracts DNA through the alkaline bleach liquor cleavage method, through the enzyme evaluation positive colony of cutting and check order.Institute is obtained positive colony called after pGEMT/Ad5-D24F.The Ad5-D24F fragment is gone up to get off through PacI and SpeI double digestion from pGEMT/Ad5-D24F, through mass concentration be behind 1.0% the agarose electrophoresis purifying be connected with the adenovirus E 1 shuttle vectors of SpeI double digestion processing with PacI.Condition of contact is the same, connects that product is adopted conversions that use the same method, extracted DNA, enzyme cuts and identify and obtain positive colony, called after pHBD24shuttle, and this carrier is the shuttle vectors of 24bp base deletion in the Ad5 E1A molecule of acquisition.
2, make up the carrier framework for adenovirus of 24 base deletions in the Ad5 E1A molecule
With the shuttle vectors and the ClaI linearizing adenovirus skeleton carrier pTG3602/SwaI preparation in 3: 1 in molar ratio of 24 base deletions of the linearizing Ad5 E1A of ScaI molecule, cotransformation competent cell BJ5183 extracts DNA through the alkaline bleach liquor cleavage method.Through the enzyme evaluation positive colony of cutting and check order, the positive colony that is obtained is the carrier framework for adenovirus of 24 base deletions in the Ad5 E1A molecule, and called after pHBD24-backbone sees Fig. 1.In Fig. 1, the black widened section is represented 24 base deletion parts in the Ad5 E1A molecule.
3, make up the pHBD24-backbone in the BamHI site in the rite-directed mutagenesis six conjuncted albumen hypervariable regions 5:
With adenovirus Ad5 genome is template, obtains the homology arm sequence of six conjuncted albumen hypervariable region 5 sequence downstream 2300bp through the method for PCR, and the design primer sequence is following:
P5：AGGATCCATATTCGAACCTAAAGTGGTATTGTACAGTGAA
P6：TATCGATGAAACATGCAGCAGAATAGTCCACAG，
Amplified production is connected on the pGEM-T easy carrier, obtains pGEMT/Hexon HR down-1.
With pGEMT/Hexon HR down-1 is template, adopts the BamHI site in the PCR reaction rite-directed mutagenesis six conjuncted albumen hypervariable region 5 downstream homology arm sequences, and the design primer sequence is following:
P7：AGACATGACTTTTGAGGTCGATCCCATGGACGAGCCCA
P8：TGGGCTCGTCCATGGGATCGACCTCAAAAGTCATGTCT。
The positive colony called after pGEMT/Hexon BM that obtains.
With linearizing pHBD24-backbone of SwaI and pGEMT/Hexon BM preparation in 1: 6 in molar ratio, cotransformation competent cell BJ5183 extracts DNA through the alkaline bleach liquor cleavage method.Through the enzyme evaluation positive colony of cutting and check order, the positive colony that is obtained is pHBD24BM.
4, make up the plasmid vector of 3 ' upper reaches 2.0kb homology arms of the adenoviral fiber protein modification sequence of introducing single restriction enzyme site BmaHI:
With adenovirus Ad5 genomic dna is template, to introduce the fragment of 5 ' end upper reaches 2.0kb that the Ad5 scleroproein of single restriction enzyme site modifies through pcr amplification, and the reaction amplified production is to reclaim fragment behind 1% the agarose gel electrophoresis through mass concentration; The polymerase chain reaction product that reclaims is connected with the pGEMT-easy carrier respectively; Extract DNA through the alkaline bleach liquor cleavage method; Cut and check order through enzyme and identify and obtain the plasmid vector of positive colony for the adenoviral fiber protein sequence 5 ' upper reaches 2.0kb homology arms of introducing single restriction enzyme site BamHI, called after pGEMT/fiber up-BamHI; The Tai l of synthetic Ad5 and Shaft and the Knob sequence of scleroproein mosaic Ad11; On the Tail of Ad5 sequence, contain the NdeI site; Introduce the SpeI site at the Knob of scleroproein modification sequence 3 ' end; Through NdeI and SpeI double digestion, in the corresponding restriction enzyme site of pshuttleAd5-E4-fiber carrier, the novel vector that is obtained is called pGEMT/fiber5/11 up BamHI with this sequence clone.
5, make up the plasmid vector of the adenovirus E4 sequence 3 ' upper reaches 2.0kb homology arms of introducing single restriction enzyme site SfuI:
With adenovirus Ad5 genomic dna is template, to introduce the fragment of the Ad5E4 district 3 ' end upper reaches 2.0kb of single restriction enzyme site through pcr amplification, reclaims fragment after reacting amplified production and through mass concentration be 1% agarose gel electrophoresis; The polymerase chain reaction product that reclaims is connected with the pGEMT-easy carrier respectively; Extract DNA through the alkaline bleach liquor cleavage method; Cut and check order through enzyme and identify and obtain the plasmid vector of positive colony for the adenovirus E4 sequence 3 ' upper reaches 2.0kb homology arms of introducing single restriction enzyme site SfuI, called after pGEMT/E4 up-SfuI;
6, make up the shuttle vectors that screening-gene is carried at adenovirus fiber-E4 position:
Be the basis with the pUC19 carrier; Mode at the two ends of the opening code-reading frame of ammonia benzyl resistant gene through transgenation produces two single restriction enzyme site XbaI and SfuI; To block that resistant gene then is cloned in the site of XbaI and SfuI; That resistance carrier of the card that is obtained is connected with EcoRI-HindIII linker, and the carrier called after pUCKanEHL of acquisition sees Fig. 2;
Fiber up and E4up are upward scaled off through corresponding enzymes double zyme from pGEMT/fiber5/11 up BamHI and pGEMT/E4up-SfuI respectively; Be connected into pUCKanEHL more successively; Cut evaluation through alkaline bleach liquor cleavage method extraction DNA, enzyme; Obtain positive colony, called after pshuttle-fiber5/11-E4HR; The screening Expression element Lacza that will pass through single restriction enzyme site BamHI and the pairing enzymes double zyme cutting of SfuI is connected into the pshuttle-fiber5/11-E4HR carrier through the same enzyme double digestion; Extract DNA through the alkaline bleach liquor cleavage method; Enzyme is cut and is identified that obtaining positive colony is the shuttle vectors that screening-gene is carried at adenovirus fiber-E4 position, called after pshuttle-fiber5/11-E4/Lacza.
7, make up the Ad5D24 condition replication type adenovirus carrier of introducing single restriction enzyme site
With pshuttle-fiber5/11-E4/Lacza and pHBD24BM respectively through preparing cotransformation BJ5183 competent cell behind PacI and the SwaI linearization for enzyme restriction in 6: 1 in molar ratio; Extraction DNA, enzyme are cut and are identified that obtaining positive colony is the Ad5D24 condition replication type adenovirus carrier of introducing single restriction enzyme site; Called after pHBD24-5/11-BS sees Fig. 3.
8, make up the shuttle vectors that carries foreign gene
Through polymerase chain reaction method amplification miniCMV-SV40 Expression element, product is connected with pGEMT-T easy carrier, through the enzyme evaluation positive colony of cutting and check order, the positive colony called after pGEMT/miniCMV-SV40 that obtains; Same amplification PGK-SV40 Expression element is connected product with pGEMT-T easy carrier, through the enzyme evaluation positive colony of cutting and check order, the positive colony called after pGEMT/PGK-SV40 that obtains; MiniCMV-SV40 fragment and PGK-SV40 are gone up to get off through corresponding restriction enzyme site double digestion from pGEMT/miniCMV-SV40 and pGEMT/PGK-SV40 respectively; Be connected with the pUCKanEHL that cuts through same enzyme; Connect product and adopt the conversion that uses the same method; Extract DNA, enzyme is cut and is identified acquisition positive colony, called after pshuttle-BS-PGK-miniCMV; In the miniCMV-SV40 expression cassette, be connected into reporter gene eGFP then respectively and in the PGK-SV40 expression cassette, be connected into therapeutic gene TRAIL, extract DNA, enzyme is cut and is identified the acquisition positive colony, and called after pshuttle-BS-TRAIL/eGFP sees Fig. 4.
9, carry the structure and the virus preparation of the condition replication type adenovirus carrier that the D24 scleroproein of TRAIL and eGFP modifies:
The pshuttle-BS-TRAIL/eGFP that builds and pHBD24-5/11-BS cut through BamHI and SfuI enzyme be connected after handling; Connecting product transforms, cultivates, screens; Through shake bacterium, extract DNA, enzyme is cut and check order and identify that obtaining positive colony is the condition replication type adenovirus carrier that carries the D24 scleroproein modification of TRAIL and eGFP; Called after pHBD24-5/11-TRAIL/eGFP with pHBD24-5/11-TRAIL/eGFP carrier transfection HEK293 cell after the PacI linearizing, obtains virus stock solution used after 7-10 days; Through amplification; Carry the condition replication type adenovirus of the D24 scleroproein modification of TRAIL and eGFP through acquisition behind the CsCl gradient centrifugation purification, called after HBD24-5/11-TRAIL/eGFP sees Fig. 5.
Embodiment 2:
The condition replication type adenovirus carrier construction method step of modifying with the D24 scleroproein of expressing red fluorescent protein and trail dna is following:
Make up among the embodiment 1 that the shuttle vectors carry foreign gene is connected into reporter gene eGFP in the miniCMV-SV40 expression cassette and the green fluorescent protein eGFP that in the PGK-SV40 expression cassette, is connected among the therapeutic gene TRAIL replaces with red fluorescent protein.Other structures of carrier are identical with embodiment 1.
Embodiment 3:
The condition replication type adenovirus carrier construction method step of modifying with the D24 scleroproein of expressing luciferase and trail dna is following:
Make up among the embodiment 1 that the shuttle vectors carry foreign gene is connected into reporter gene eGFP in the miniCMV-SV40 expression cassette and the green fluorescent protein eGFP that in the PGK-SV40 expression cassette, is connected among the therapeutic gene TRAIL replaces with luciferase.Other structures of carrier are identical with embodiment 1.
Embodiment 4:
The condition replication type adenovirus carrier construction method step of modifying with the D24 scleroproein of expressing beta-galactosidase enzymes and trail dna is following:
Make up among the embodiment 1 that the shuttle vectors carry foreign gene is connected into reporter gene eGFP in the miniCMV-SV40 expression cassette and the green fluorescent protein eGFP that in the PGK-SV40 expression cassette, is connected among the therapeutic gene TRAIL replaces with beta-galactosidase enzymes.Other structures of carrier are identical with embodiment 1.
Embodiment 5:
The condition replication type adenovirus carrier construction method step of modifying with the D24 scleroproein of expressing green fluorescent protein eGFP and IL-24 gene is following:
Make up among the embodiment 1 that the shuttle vectors carry foreign gene is connected into reporter gene eGFP in the miniCMV-SV40 expression cassette and the TRAIL that in the PGK-SV40 expression cassette, is connected among the therapeutic gene TRAIL replaces with IL-24.Other structures of carrier are identical with embodiment 1.
Embodiment 6:
The condition replication type adenovirus carrier construction method step of modifying with the D24 scleroproein of expressing green fluorescent protein eGFP and IL-12 gene is following:
Make up among the embodiment 1 that the shuttle vectors carry foreign gene is connected into reporter gene eGFP in the miniCMV-SV40 expression cassette and the TRAIL that in the PGK-SV40 expression cassette, is connected among the therapeutic gene TRAIL replaces with IL-12.Other structures of carrier are identical with embodiment 1.
Embodiment 7:
The condition replication type adenovirus carrier construction method step of modifying with the D24 scleroproein of expressing green fluorescent protein eGFP and IFN gene is following:
Make up among the embodiment 1 that the shuttle vectors carry foreign gene is connected into reporter gene eGFP in the miniCMV-SV40 expression cassette and the TRAIL that in the PGK-SV40 expression cassette, is connected among the therapeutic gene TRAIL replaces with IFN.Other structures of carrier are identical with embodiment 1.
Embodiment 8
The condition replication type adenovirus carrier construction method step of modifying with the D24 scleroproein of expressing green fluorescent protein eGFP and p53 gene is following:
Make up among the embodiment 1 that the shuttle vectors carry foreign gene is connected into reporter gene eGFP in the miniCMV-SV40 expression cassette and the TRAIL that in the PGK-SV40 expression cassette, is connected among the therapeutic gene TRAIL replaces with p53.Other structures of carrier are identical with embodiment 1.
Embodiment 9:
The condition replication type adenovirus carrier construction method step of modifying with the D24 scleroproein of expressing green fluorescent protein eGFP and arresten gene is following:
Make up among the embodiment 1 that the shuttle vectors carry foreign gene is connected into reporter gene eGFP in the miniCMV-SV40 expression cassette and the TRAIL that in the PGK-SV40 expression cassette, is connected among the therapeutic gene TRAIL replaces with arresten.Other structures of carrier are identical with embodiment 1.
Embodiment 10:
The condition replication type adenovirus carrier construction method step of modifying with the D24 scleroproein of expressing green fluorescent protein eGFP and endostatin gene is following:
Make up among the embodiment 1 that the shuttle vectors carry foreign gene is connected into reporter gene eGFP in the miniCMV-SV40 expression cassette and the TRAIL that in the PGK-SV40 expression cassette, is connected among the therapeutic gene TRAIL replaces with endostatin.Other structures of carrier are identical with embodiment 1.
Embodiment 11:
The condition replication type adenovirus carrier construction method step of modifying with the D24 scleroproein of expressing green fluorescent protein eGFP and endostatin gene is following:
Make up among the embodiment 1 that the shuttle vectors carry foreign gene is connected into reporter gene eGFP in the miniCMV-SV40 expression cassette and the TRAIL that in the PGK-SV40 expression cassette, is connected among the therapeutic gene TRAIL replaces with endostatin.Other structures of carrier are identical with embodiment 1.
Embodiment 12:
Above embodiment 1～11,5 type genome 31042bp places are scleroproein Tail place in adenovirus, scleroproein 5/11 sequence of the modification of insertion is replaced with 5/3 sequence.The structure of other element is identical with respective embodiments.
5/3 above-mentioned sequence is following:
atgaagcgcgcaagaccgtctgaagataccttcaaccccgtgtatccatatgacacggaaaccggtcctccaactgtgccttttcttactcctccctttgtatcccccaatgggtttcaagagagtccccctttaagtcttaaatgtgttaatccacttaccactgcaagcggctccctccaacttaaagtgggaagtggtcttacagtagacactactgatggatccttagaaga?aaacatcaaagttaacacccccctaacaaagtcaaaccattctataaatttaccaataggaaacggtttgcaaatagaacaaaacaaactttgcagtaaactcggaaatggtcttacatttgactcttccaattctattgcactgaaaaataacactttatggacaggtccaaaaccagaagccaactgcataattgaatacgggaaacaaaacccagatagcaaactaactttaatccttgtaaaaaatggaggaattgttaatggatatgtaacgctaatgggagcctcagactacgttaacaccttatttaaaaacaaaaatgtctccattaatgtagaactatactttgatgccactggtcatatattaccagactcatcttctcttaaaacagatctagaactaaaatacaagcaaaccgctgactttagtgcaagaggttttatgccaagtactacagcgtatccatttgtccttcctaatgcgggaacacataatgaaaattatatttttggtcaatgctactacaaagcaagcgatggtgccctttttccgttggaagttactgttatgcttaataaacgcctgccagatagtcgcacatcctatgttatgacttttttatggtccttgaatgctggtctagctccagaaactactcaggcaaccctcataacctccccatttaccttttcctatattagagaagatgactga。
Embodiment 13:
Above embodiment 1～11,5 type genome 31042bp places are scleroproein Tail place in adenovirus, scleroproein 5/11 sequence of the modification of insertion is replaced with 5/6 sequence.The structure of other element is identical with respective embodiments.
Above-mentioned scleroproein 5/6 sequence is following:
atgaagcgcgcaagaccgtctgaagataccttcaaccccgtgtatccatatgacacggaaaccggtcctccaactgtgccttttcttactcctccctttgtatcccccaatgggtttcaagagagtccccctggagtgctttctttgcgtctttcagaacctttggttacctcacacggcatgcttgcgctaaaaatgggcagcggcctgtccctggatcaggcaggcaaccttacatcaaatacaatcactgtttctcaaccgctaaaaaaaacaaagtccaatataactttggaaacatccgcgccccttacagtcagctcaggcgccctaaccatggccacaacttcgcctttggtggtctctgacaacactcttaccatgcaatcacaagcaccgctaaccgtgcaagactcaaaacttagcattgctaccaaagagccacttacagtgttagatggaaaactggccctgcagacatcagcccccctctctgccactgataacaacgccctcactatcactgcctcacctcctcttactactgcaaatggtagtctggctgttaccatggaaaacccactttacaacaacaatggaaaacttgggctcaaaattggcggtcctttgcaagtggccaccgactcacatgcactaacactaggtactggtcagggggttgcagttcataacaatttgctacatacaaaagttacaggcgcaatagggtttgatacatctggcaacatggaacttaaaactggagatggcctctatgtggatagcgccggtcctaaccaaaaactacatattaatctaaataccacaaaaggccttgcttttgacaacaccgcaataacaattaacgctggaaaagggttggaatttgaaacagactcctcaaacggaaatcccataaaaacaaaaattggatcaggcatacaatataataccaatggagctatggttgcaaaacttggaacaggcctcagttttgacagctccggagccataacaatgggcagcataaacaatgacagacttactctttggacaacaccagacccatccccaaattgcagaattgcttcagataaagactgcaagctaactctggcgctaacaaaatgtggcagtcaaattttgggcactgtttcagctttggcagtatcaggtaatatggcctccatcaatggaactctaagcagtgtaaacttggttcttagatttgatgacaacggagtgcttatgtcaaattcatcactggacaaacagtattggaactttagaaacggggactccactaacggtcaaccatacacttatgctgttgggtttatgccaaacctaaaagcttacccaaaaactcaaagtaaaactgcaaaaagtaatattgttagccaggtgtatcttaatggtgacaagtctaaaccattgcattttactattacgctaaatggaacagatgaaaccaaccaagtaagcaaatactcaatatcattcagttggtcctggaacagtggacaatacactaatgacaaatttgccaccaattcctataccttctcctacattgcccaggaataa。
Embodiment 14:
Above embodiment 1～11,5 type genome 31042bp places are scleroproein Tail place in adenovirus, scleroproein 5/11 sequence of the modification of insertion is replaced with 5/7 sequence.The structure of other element is identical with respective embodiments.
Above-mentioned scleroproein 5/7 sequence is following:
atgaagcgcgcaagaccgtctgaagataccttcaaccccgtgtatccatatgacacggaaaccggtcctccaactgtgccttttcttactcctccctttgtatcccccaatgggtttcaagagagtccccctggagttcttactttaaaatgtttaaccccactaacaaccacaggcgggtctctacagttaaaagtgggagggggtcttacaatagatgacaccgacggttttttgaaagaaaacataagtgccaccacaccactcgttaagactggtcactctataggtttgtcgctaggacccggattagaaa?caaatgaaaacaaactttgtgtcaaattgggagaaggacttacattcaattccaacaacatttgcattaatgacaatattaacaccctatggacaggagttaaccccaccagagccaactgtcaaataatggcctccagtgaatctaatgattgcaaattaattctaacactagttaaaactggagccctcgtcactgcatttgtttatgttataggagtatctaacgattttaatatgctaactacacataaaaatataaatttcactgcagagctgttttttgattctactggtaatttattaactagcctttcatccctaaaaactccacttaatcataaatcagggcaaaacatggctactggtgcccttactaatgctaaaggtttcatgcccagcacaactgcctatcctttcaatgttaattccacagaaaaagaaaactacatttacggaacttgttactacacagctagtgatcacactgcttttcccattgacatatctgtcatgcttaaccaaagagcattaaataatgagacatcatattgtattcgtgtaacttggtcctggaatacaggagttgccccagaagtgcaaacctctgctactaccctagtcacctctccatttaccttttactacattagagaagacgactga。
Embodiment 15:
Above embodiment 1～11,5 type genome 31042bp places are scleroproein Tail place in adenovirus, scleroproein 5/11 sequence of the modification of insertion is replaced with 5/35 sequence.The structure of other element is identical with respective embodiments.
Above-mentioned scleroproein 5/35 sequence is following:
atgaagcgcgcaagaccgtctgaagataccttcaaccccgtgtatccatatgacacggaaaccggtcctccaactgtgcctttctactcctccctttgtatcccccaatgggttcaagagagtccccctggagttcttactttaaaatgtttaaccccactaacaaccacaggcggatctctacagctaaaagtgggagggggacttacagtggatgacactgatggtaccttacaagaaaacatacgtgctacagcacccattactaaaaataatcactctgtagaactatccattggaaatggattagaaactcaaaacaataaactatgtgccaaattgggaaatgggttaaaatttaacaacggtgacatttgtataaaggatagtattaacaccttatggactggaataaaccctccacctaactgtcaaattgtggaaaacactaatacaaatgatggcaaacttactttagtattagtaaaaaatggagggcttgttaatggctacgtgtctctagttggtgtatcagacactgtgaaccaaatgttcacacaaaagacagcaaacatccaattaagattatattttgactcttctggaaatctattaactgaggaatcagacttaaaaattccacttaaaaataaatcttctacagcgaccagtgaaactgtagccagcagcaaagcctttatgccaagtactacagcttatcccttcaacaccactactagggatagtgaaaactacattcatggaatatgttactacatgacttcttatgatagaagtctatttcccttgaacatttctataatgctaaacagccgtatgatttcttccaatgttgcctatgccatacaatttgaatggaatctaaatgcaagtgaatctccagaaagcaacatagctacgctgaccacatccccctttttcttttcttacattacagaagacgacaactaa。
In order to verify beneficial effect of the present invention, the contriver adopts the embodiment of the invention 1 constructed condition replication type adenovirus carrier HBD24-5/11-TRAIL/eGFP to carry out the test of pesticide effectiveness, and test situation is following:
1, the detection of cell growth inhibition
Experimental technique: the U251 tumour cell in the vegetative period of taking the logarithm, be inoculated in 96 orifice plates after 0.1% trysinization, every porocyte number is 5 * 10
3If the condition replication type adenovirus carrier HBD24-5/11-TRAIL/eGFP experimental group that the D24 scleroproein of substratum blank control group, replication-defective adenoviral vector Ad5-eGFP control group, expressing green fluorescent protein and TRAIL is modified; It is 5MOI that control group and experimental group add the adenovirus amount respectively, establishes 6 multiple holes for every group; Cultivate the 3-(4,5-dimethylthiazole-2)-2 that adds 5g/L after 24,48,72,96 hours respectively, 5-phenylbenzene tetrazole bromine salt 20 μ L continue to cultivate 4 hours, remove substratum, add DMSO 99.8MIN. 150 μ L, horizontal shaking table room temperature effect 10 minutes.Record light absorption value with ELIASA 570nm place.The data that obtained with cell growth-inhibiting method are carried out statistical study with the One Way ANOVA of the SPSS of statistical software 13.0 softwares, and each group difference relatively adopts variance analysis.Experimental result is seen Fig. 6.
Visible by Fig. 6, experimental group is compared with the Ad5-eGFP control group with the substratum blank control group, and growth has remarkable restraining effect to experimental group virus to the U251 cell, has tangible antitumous effect (*, p＜0.01).
2, the detection of cell infection efficient
Inoculate the U87 cell in 24 orifice plates, every hole 1 * 10
5Individual cell; The HBD24-5/11-TRAIL/eGFP adenovirus carrier is infected the U87 cell respectively with contrast adenovirus carrier Ad-eGFP; Adenovirus carrier infects concentration and is 5MOI, and count the cell that green fluorescence is arranged in 10 visuals field of picked at random under fluorescent microscope; Calculate the efficiency of infection of adenovirus to the U87 cell, experimental result is seen Fig. 7.Visible by Fig. 7; Control group cells infected quantity is few, explains that the carrier A d5-eGFP of contrast adenovirus is low to the efficiency of infection of U87 clone, and experimental group is compared with control group; Cells infected quantity increases; Explain that the HBD24-5/11-TRAIL/eGFP adenovirus carrier significantly improves (*, p＜0.05) to the efficiency of infection of U87 cell after adenovirus is through the scleroproein genetic modification.
3, set up the cerebral glioma animal model and detect its test of pesticide effectiveness
Adopt the U87 cell, the cell in vegetative period of taking the logarithm, through trysinization, centrifugal after, serum-free, unparalleled DMEM nutrient solution anti-, no Stimulina suspend, and prepare 7.5 * 10
6The cell suspension of/mL.Select 21 female nude mices of about 4～6 week BALB/C in age for use, nude mice is used ether inhalation anesthesia, 7.5 * 10 of every right hind top subcutaneous injection 200 μ l
6The cell suspension of/mL, U87MG injection cell amount is 2 * 10
6Individual cell is at the tumor growth of cell inoculation all visible lump approximate size after about 3 days.After inoculating a week, tumor average volume reaches about 70～100mm
3The time, set up the cerebral glioma animal model.
21 nude mice models are divided into 3 groups at random, 7 every group.Nude mice is used ether inhalation anesthesia, according to injection blank control group saline water, control group replication-defective adenoviral vector Ad5-eGFP and the experimental group adenovirus carrier HBD24-5/11-TRAIL/eGFP of dividing into groups.Every nude mice duplicate injection in per two days virus 1 time, totally 4 times, each dosage is 5 * 10
8PFU.Measured gross tumor volume 1 time in per 2 days behind the begin treatment, statistics volume change trend is also drawn tumor growth curve, measures 3 all gross tumor volumes.And carry out the significant difference analysis with the Oneway-ANOVA among the SPSS of statistical software 13.0.Experimental result is seen Fig. 8.
Visible by Fig. 8; Compare with control group replication-defective adenoviral Ad5-eGFP with blank control group saline water; The HBD24-5/11-TRAIL/eGFP adenovirus carrier can obviously suppress the speed of growth of tumour cell in the experimental model, has tangible antineoplaston effect (*, p＜0.05).
cttacctgccacgaggctggcttt
atgaagcgcgcaagaccgtctgaagataccttcaaccccgtgtatccatatgacacggaaaccggtcctccaactgtgccttttcttactcctccctttgtatcccccaatgggtttcaagagagtccccctggtcttactttaaaatgtttaaccccgctaacaaccacaggcgggtctctacagctaaaagtgggagggggacttacagtagatgacactgatgggaccttacaagaaaacataggtaccaccacaccacttgttaagactgggcactctataggtttatccctaggagccggattgggaacagatgaaaataaactttgtaccaaattgggaaaaggacttacattcaattcaaacaacatttgcattgatgacaatattaacaccctgtggacaggaattaaccccaccgaagccaactgtcaaatgatggactccagtgaatctaatgattgcaaattaattctaacactagttaaaactggagccctagtcactgcatttgtttatgttataggagtatctaacaattttaatatgctaactacatacagaaatataaattttactgcggagctgttttttgattctgcgggtaatttactaactagcctgtcatccctaaaaactccacttaatcataaatcaggacaaaacatggctactggtgccattactaatgctaaaagtttcatgcccagcacaactgcttatcctttcaataataattctagagaaaaagaaaactacatttacggaacctgtcactacacagctagtgatcacactgcttttcccattgacatatctgtcatgcttaaccaaagagcaataagagctgatacatcatattgtattcgtataacttggtcctggaacacaggagatgccccagaggggcaaacctctgctacaaccctagttacctccccatttaccttttactacatcagagaagacgactga
agatctccatagagcccaccgcatccccagcatgcctgctattgtcttcccaatcctcccccttgctgtcctgccccaccccaccccccagaatagaatgacacctactcagacaatgcgatgcaatttcctcattttattaggaaaggacagtgggagtggcaccttccagggtcaaggaaggcacgggggaggggcaaacaacagatggctggcaactagaaggcacagtctagattacttgtacagctcgtccatgccgagagtgatcccggcggcggtcacgaactccagcaggaccatgtgatcgcgcttctcgttggggtctttgctcagggcggactgggtgctcaggtagtggttgtcgggcagcagcacggggccgtcgccgatgggggtgttctgctggtagtggtcggcgagctgcacgctgccgtcctcgatgttgtggcggatcttgaagttcaccttgatgccgttcttctgcttgtcggccatgatatagacgttgtggctgttgtagttgtactccagcttgtgccccaggatgttgccgtcctccttgaagtcgatgcccttcagctcgatgcggttcaccagggtgtcgccctcgaacttcacctcggcgcgggtcttgtagttgccgtcgtccttgaagaagatggtgcgctcctggacgtagccttcgggcatggcggacttgaagaagtcgtgctgcttcatgtggtcggggtagcggctgaagcactgcacgccgtaggtcagggtggtcacgagggtgggccagggcacgggcagcttgccggtggtgcagatgaacttcagggtcagcttgccgtaggtggcatcgccctcgccctcgccggacacgctgaacttgtggccgtttacgtcgccgtccagctcgaccaggatgggcaccaccccggtgaacagctcctcgcccttgctcaccatctcgagatacagctccaccgcacatgccaccctccggatatattcgtctcgagcaaatcactcgagtatgtcgaggtggcgtgtacggtgggaggcctatataagcagagctcgtttagtgttggcagtctagcggctagcacgcgttgacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcatcgatatggctatgatggaggtccaggggggacccagcctgggacagacctgcgtgctgatcgtgatcttcacagtgctcctgcagtctctctgtgtggctgtaacttacgtgtactttaccaacgagctgaagcagatgcaggacaagtactccaaaagtggcattgcttgtttcttaaaagaagatgacagttattgggaccccaatgacgaagagagtatgaacagcccctgctggcaagtcaagtggcaactccgtcagctcgttagaaagatgattttgagaacctctgaggaaaccatttctacagttcaagaaaagcaacaaaatatttctcccctagtgagagaaagaggtcctcagagagtagcagctcacataactgggaccagaggaagaagcaacacattgtcttctccaaactccaagaatgaaaaggctctgggccgcaaaataaactcctgggaatcatcaaggagtgggcattcattcctgagcaacttgcacttgaggaatggtgaactggtcatccatgaaaaagggttttactacatctattcccaaacatactttcgatttcaggaggaaataaaagaaaacacaaagaacgacaaacaaatggtccaatatatttacaaatacacaagttatcctgaccctatattgttgatgaaaagtgctagaaatagttgttggtctaaagatgcagaatatggactctattccatctatcaagggggaatatttgagcttaaggaaaatgacagaatttttgtttctgtaacaaatgagcacttgatagacatggaccatgaagccagttttttcggggcctttttagttggctaaactagtggatccggctgtggaatgtgtgtcagttagggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatcacaattagtcagcaaccaggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctcggcctctgagctattccagaagtagtgaggaggcttttttggaggcctaggcttttgcaaaaagcttgaattcgctgtctgcgagggccggctgttggggtgagtactccctctcaaaagcgggcatgacttctgcggccgc
atgaagcgcgcaagaccgtctgaagataccttcaaccccgtgtatccatatgacacggaaaccggtcctccaactgtgccttttcttactcctccctttgtatcccccaatgggtttcaagagagtccccctggagtgctttctttgcgtctttcagaacctttggttacctcacacggcatgcttgcgctaaaaatgggcagcggcctgtccctggatcaggcaggcaaccttacatcaaatacaatcactgtttctcaaccgctaaaaaaaacaaagtccaatataactttggaaacatccgcgccccttacagtcagctcaggcgccctaaccatggccacaacttcgcctttggtggtctctgacaacactcttaccatgcaatcacaagcaccgctaaccgtgcaagactcaaaacttagcattgctaccaaagagccacttacagtgttagatggaaaactggccctgcagacatcagcccccctctctgccactgataacaacgccctcactatcactgcctcacctcctcttactactgcaaatggtagtctggctgttaccatggaaaacccactttacaacaacaatggaaaacttgggctcaaaattggcggtcctttgcaagtggccaccgactcacatgcactaacactaggtactggtcagggggttgcagttcataacaatttgctacatacaaaagttacaggcgcaatagggtttgatacatctggcaacatggaacttaaaactggagatggcctctatgtggatagcgccggtcctaaccaaaaactacatattaatctaaataccacaaaaggccttgcttttgacaacaccgcaataacaattaacgctggaaaagggttggaatttgaaacagactcctcaaacggaaatcccataaaaacaaaaattggatcaggcatacaatataataccaatggagctatggttgcaaaacttggaacaggcctcagttttgacagctccggagccataacaatgggcagcataaacaatgacagacttactctttggacaacaccagacccatccccaaattgcagaattgcttcagataaagactgcaagctaactctggcgctaacaaaatgtggcagtcaaattttgggcactgtttcagctttggcagtatcaggtaatatggcctccatcaatggaactctaagcagtgtaaacttggttcttagatttgatgacaacggagtgcttatgtcaaattcatcactggacaaacagtattggaactttagaaacggggactccactaacggtcaaccatacacttatgctgttgggtttatgccaaacctaaaagcttacccaaaaactcaaagtaaaactgcaaaaagtaatattgttagccaggtgtatcttaatggtgacaagtctaaaccattgcattttactattacgctaaatggaacagatgaaaccaaccaagtaagcaaatactcaatatcattcagttggtcctggaacagtggacaatacactaatgacaaatttgccaccaattcctataccttctcctacattgcccaggaataa
atgaagcgcgcaagaccgtctgaagataccttcaaccccgtgtatccatatgacacggaaaccggtcctccaactgtgccttttcttactcctccctttgtatcccccaatgggtttcaagagagtccccctggagttcttactttaaaatgtttaaccccactaacaaccacaggcgggtctctacagttaaaagtgggagggggtcttacaatagatgacaccgacggttttttgaaagaaaacataagtgccaccacaccactcgttaagactggtcactctataggtttgtcgctaggacccggattagaaacaaatgaaaacaaactttgtgtcaaattgggagaaggacttacattcaattccaacaacatttgcattaatgacaatattaacaccctatggacaggagttaaccccaccagagccaactgtcaaataatggcctccagtgaatctaatgattgcaaattaattctaacactagttaaaactggagccctcgtcactgcatttgtttatgttataggagtatctaacgattttaatatgctaactacacataaaaatataaatttcactgcagagctgttttttgattctactggtaatttattaactagcctttcatccctaaaaactccacttaatcataaatcagggcaaaacatggctactggtgcccttactaatgctaaaggtttcatgcccagcacaactgcctatcctttcaatgttaattccacagaaaaagaaaactacatttacggaacttgttactacacagctagtgatcacactgcttttcccattgacatatctgtcatgcttaaccaaagagcattaaataatgagacatcatattgtattcgtgtaacttggtcctggaatacaggagttgccccagaagtgcaaacctctgctactaccctagtcacctctccatttaccttttactacattagagaagacgactga
atgaagcgcgcaagaccgtctgaagataccttcaaccccgtgtatccatatgacacggaaaccggtcctccaactgtgcctttctactcctccctttgtatcccccaatgggttcaagagagtccccctggagttcttactttaaaatgtttaaccccactaacaaccacaggcggatctctacagctaaaagtgggagggggacttacagtggatgacactgatggtaccttacaagaaaacatacgtgctacagcacccattactaaaaataatcactctgtagaactatccattggaaatggattagaaactcaaaacaataaactatgtgccaaattgggaaatgggttaaaatttaacaacggtgacatttgtataaaggatagtattaacaccttatggactggaataaaccctccacctaactgtcaaattgtggaaaacactaatacaaatgatggcaaacttactttagtattagtaaaaaatggagggcttgttaatggctacgtgtctctagttggtgtatcagacactgtgaaccaaatgttcacacaaaagacagcaaacatccaattaagattatattttgactcttctggaaatctattaactgaggaatcagacttaaaaattccacttaaaaataaatcttctacagcgaccagtgaaactgtagccagcagcaaagcctttatgccaagtactacagcttatcccttcaacaccactactagggatagtgaaaactacattcatggaatatgttactacatgacttcttatgatagaagtctatttcccttgaacatttctataatgctaaacagccgtatgatttcttccaatgttgcctatgccatacaatttgaatggaatctaaatgcaagtgaatctccagaaagcaacatagctacgctgaccacatccccctttttcttttcttacattacagaagacgacaactaa
Claims (7)
1. the condition replication type adenovirus carrier that the D24 scleroproein that carries foreign gene that a single stage method makes up is modified; It is characterized in that; 24bp base deletion among the recombinant adenoviral vector Ad5 E1A, the type recombinant adenoviral vector can specificity duplicate in the tumour cell of pRB null/mutant; Adopt the method for homologous recombination that the BamHI that Ad5 adenoviral gene group is positioned at last the 21468bp of Hexon～21573bp is suddenlyd change; The modification scleroproein that inserts at Ad5 adenoviral gene group 31042bp place is 5/3,5/6,5/7, in 5/11,5/35 sequence any one; Between Ad5 adenoviral gene group fiber and E4, promptly introduce two single restriction enzyme site BamHI, SfuI, between two single restriction enzyme sites that Ad5 adenoviral gene group is introduced, insert an Expression element that is used to screen at Ad5 adenoviral gene group the 32788bp～32913bp place; Between two single restriction enzyme sites that Ad5 adenoviral gene group is introduced, insert two-way expression cassette, this two-way expression cassette carries a reporter gene and a therapeutic gene, obtains carrying the condition replication type adenovirus carrier that the D24 scleroproein of foreign gene is modified.
2. the condition replication type adenovirus carrier that the D24 scleroproein that carries foreign gene as claimed in claim 1 is modified; It is characterized in that; The position of said 24bp base deletion is at the 922bp～947bp of adenoviral gene group, and the base deletion sequence is cttacctgccacgaggctggcttt.
3. the condition replication type adenovirus carrier that the D24 scleroproein that carries foreign gene as claimed in claim 1 is modified; It is characterized in that; The Expression element of described screening is the beta-galactosidase gene Expression element that is used for the screening of blue hickie, any one of the fluorescent protein expression element that is used for screening of promptly in bacterium, expressing, penbritin Expression element, kantlex Expression element, paraxin Expression element.
4. the condition replication type adenovirus carrier that the D24 scleroproein that carries foreign gene as claimed in claim 1 is modified; It is characterized in that the said reporter gene that carries is any one in green fluorescent protein, red fluorescent protein, luciferase, the beta-galactosidase gene.
5. the condition replication type adenovirus carrier that the D24 scleroproein that carries foreign gene as claimed in claim 1 is modified is characterized in that the said therapeutic gene that carries is TRAIL; IL-24, IL-12, IFN; P53, arresten, any one among the endostatin.
6. the described condition replication type adenovirus carrier single stage method construction process that carries the D24 scleroproein modification of foreign gene of claim 1 is characterized in that, specifically makes up by following step:
The method of (1) cutting connection with enzyme makes up the shuttle vectors of 24 base deletions in the Ad5 E1A molecule:
With the Ad5 geneome plasmid is template, obtains to contain the gene fragment of 24bp base deletion in the Ad5 E1A molecule through the lap over polymerase chain reaction; The polymerase chain reaction fragment is connected with pGEMT-T easy carrier, will connects product and transform DH5 α cell, extract DNA, through the enzyme evaluation positive colony of cutting and check order, with the acquisition positive colony called after pGEMT/Ad5-D24F of institute through the alkaline bleach liquor cleavage method;
The Ad5-D24F fragment is gone up to get off through PacI and SpeI double digestion from pGEMT/Ad5-D24F; Be connected with the adenovirus E 1 shuttle vectors of handling with PacI and SpeI double digestion (AdEasy vector pShuttle); Connection product conversion DH5 α cell, extraction DNA, enzyme are cut and are identified the acquisition positive colony; Called after pHBD24 shuttle, the shuttle vectors that this carrier lacks for the pAd5 E1A 24bp that obtains;
(2) make up pHBD24-backbone:
With ScaI linearizing pHBD24 shuttle shuttle vectors and ClaI linearizing adenovirus skeleton carrier pTG3602/SwaI preparation in 3: 1 in molar ratio; Cotransformation competent cell BJ5183; Extract DNA through the alkaline bleach liquor cleavage method; Through the enzyme evaluation positive colony of cutting and check order, the positive colony that is obtained is the carrier framework for adenovirus of 24 base deletions in the Ad5 E1A molecule, called after pHBD24-backbone;
(3) pHBD24-backbone in the BamHI site in the structure rite-directed mutagenesis six conjuncted albumen hypervariable regions 5:
With adenovirus Ad5 genome is template, obtains the homology arm sequence of six conjuncted albumen hypervariable region 5 sequence downstream 2300bp through the method for PCR, is connected on the pGEM-T easy carrier, obtains pGEMT/Hexon HR down-1;
With pGEMT/Hexon HR down-1 is template, adopts the BamHI site in the PCR reaction rite-directed mutagenesis six conjuncted albumen hypervariable region 5 downstream homology arm sequences, the positive colony called after pGEMT/Hexon BM of acquisition;
With linearizing pHBD24-backbone of SwaI and pGEMT/Hexon BM preparation in 1: 6 in molar ratio; Cotransformation competent cell BJ5183; Extract DNA through the alkaline bleach liquor cleavage method, through the enzyme evaluation positive colony of cutting and check order, the positive colony that is obtained is pHBD24BM;
(4) plasmid vector of 3 ' upper reaches 2.0kb homology arms of the adenoviral fiber protein modification sequence of the single restriction enzyme site BmaHI of structure introducing:
With adenovirus Ad5 genomic dna is template, to introduce the fragment of 5 ' the end upper reaches 2.0kb that the Ad5 scleroproein of single restriction enzyme site modifies through pcr amplification, and the reaction amplified production is to reclaim fragment behind 1% the agarose gel electrophoresis through mass concentration; The polymerase chain reaction product that reclaims is connected with the pGEMT-easy carrier respectively; Extract DNA through the alkaline bleach liquor cleavage method; Cut and check order through enzyme and identify and obtain the plasmid vector of positive colony for the adenoviral fiber protein sequence 5 ' upper reaches 2.0kb homology arms of introducing single restriction enzyme site BamHI, called after pGEMT/fiber up-BamHI; Tail and chimeric Shaft of scleroproein and the Knob sequence of synthetic Ad5; On the Tail of Ad5 sequence, contain the NdeI site; Introduce the SpeI site at the Knob of scleroproein modification sequence 3 ' end; Through NdeI and SpeI double digestion, in the corresponding restriction enzyme site of pshuttle Ad5-E4-fiber carrier, the novel vector that is obtained is called pGEMT/fiber chimeric up BamHI with this sequence clone;
(5) structure is introduced the plasmid vector of the adenovirus E4 sequence 3 ' upper reaches 2.0kb homology arms of single restriction enzyme site SfuI:
With adenovirus Ad5 genomic dna is template, to introduce the fragment of Ad5 E4 district 3 ' the end upper reaches 2.0kb of single restriction enzyme site through pcr amplification, reclaims fragment after reacting amplified production and through mass concentration be 1% agarose gel electrophoresis; The polymerase chain reaction product that reclaims is connected with the pGEMT-easy carrier respectively; Extract DNA through the alkaline bleach liquor cleavage method; Cut and check order through enzyme and identify and obtain the plasmid vector of positive colony for the adenovirus E4 sequence 3 ' upper reaches 2.0kb homology arms of introducing single restriction enzyme site SfuI, called after pGEMT/E4up-SfuI;
(6) make up the shuttle vectors that screening-gene is carried at adenovirus fiber-E4 position:
Be the basis with the pUC19 carrier; Mode at the two ends of the opening code-reading frame of ammonia benzyl resistant gene through transgenation produces two single restriction enzyme site XbaI and SfuI; To block that resistant gene then is cloned in the site of XbaI and SfuI; That resistance carrier of the card that is obtained is connected with EcoRI-HindIII linker, the carrier called after pUCKanEHL of acquisition;
Fiber up and E4up are scaled off through corresponding enzymes double zyme on pGEMT/fiber chimeric up BamHI and pGEMT/E4 up-SfuI respectively; Be connected into pUCKanEHL more successively; Cut evaluation through alkaline bleach liquor cleavage method extraction DNA, enzyme; Obtain positive colony, called after pshuttle-fiber-E4HR;
The screening Expression element that will pass through single restriction enzyme site BamHI and the pairing enzymes double zyme cutting of SfuI is connected into the pshuttle-fiber chimeric-E4HR carrier through the same enzyme double digestion; Extract DNA through the alkaline bleach liquor cleavage method; Enzyme is cut and is identified that obtaining positive colony is the shuttle vectors that screening-gene is carried at adenovirus fiber-E4 position, called after pshuttle-fiber chimeric-E4/screening gene;
(7) make up the Ad5D24 condition replication type adenovirus carrier of introducing single restriction enzyme site:
With pshuttle-fiber chimeric-E4/screening gene and pHBD24BM respectively through behind PacI and the SwaI linearization for enzyme restriction; 6: 1 in molar ratio preparation cotransformation BJ5183 competent cells; Extraction DNA, enzyme are cut and are identified that obtaining positive colony is the Ad5D24 condition replication type adenovirus carrier of introducing single restriction enzyme site, called after pHBD24-fiber chimeric-BS;
(8) make up the shuttle vectors that carries foreign gene:
Through polymerase chain reaction method amplification miniCMV-SV40 Expression element, product is connected with pGEMT-T easy carrier, through the enzyme evaluation positive colony of cutting and check order, the positive colony called after pGEMT/miniCMV-SV40 that obtains;
Same amplification PGK-SV40 Expression element is connected product with pGEMT-T easy carrier, through the enzyme evaluation positive colony of cutting and check order, the positive colony called after pGEMT/PGK-SV40 that obtains;
MiniCMV-SV40 fragment and PGK-SV40 fragment are gone up to get off through corresponding restriction enzyme site double digestion from pGEMT/miniCMV-SV40 and pGEMT/PGK-SV40 respectively; Be connected with the pUCKanEHL that cuts through same enzyme; Connect product and adopt the conversion that uses the same method; Extract DNA, enzyme is cut and is identified acquisition positive colony, called after pshuttle-BS-PGK-miniCMV; In the miniCMV-SV40 expression cassette, be connected into reporter gene then respectively and in the PGK-SV40 expression cassette, be connected into therapeutic gene, extract DNA, enzyme is cut and is identified acquisition positive colony, called after pshuttle-BS-therapeutic gene/reporter gene;
(9) carry the structure and the virus preparation of the condition replication type adenovirus carrier that the D24 scleroproein of foreign gene modifies:
Pshuttle-BS-therapeutic gene/the reporter gene that builds and pHBD24-fiber chimeric-BS cut through BamHI and SfuI enzyme be connected after handling; Connecting product transforms, cultivates, screens; Through shake bacterium, extract DNA, enzyme is cut and check order and identify that obtaining positive colony is to carry the condition replication type adenovirus that the D24 scleroproein of foreign gene is modified, called after pHBD24-fiber chimeric-therapeutic gene/reporter gene;
With pHBD24-fiber chimeric-therapeutic gene/reporter gene carrier transfection HEK293 cell after the PacI linearizing; Obtain virus stock solution used after 7-10 days; Through amplification; Carry the condition replication type adenovirus carrier of the D24 scleroproein modification of foreign gene, called after HBD24-fiber chimeric-therapeutic gene/reporter gene through acquisition behind the CsCl gradient centrifugation purification.
7. the condition replication type adenovirus carrier modified of the described D24 scleroproein that carries the external source therapeutic gene of claim 1 application that is used for preparing the medicine for treating tumor thing.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201210014951 CN102586327B (en) | 2012-01-18 | 2012-01-18 | D24 fiber protein modified conditionally replicating adenovirus carrier with exogenous gene by one-step method and application of carrier |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201210014951 CN102586327B (en) | 2012-01-18 | 2012-01-18 | D24 fiber protein modified conditionally replicating adenovirus carrier with exogenous gene by one-step method and application of carrier |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102586327A true CN102586327A (en) | 2012-07-18 |
| CN102586327B CN102586327B (en) | 2013-09-11 |
Family
ID=46475551
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201210014951 Expired - Fee Related CN102586327B (en) | 2012-01-18 | 2012-01-18 | D24 fiber protein modified conditionally replicating adenovirus carrier with exogenous gene by one-step method and application of carrier |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102586327B (en) |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102921020A (en) * | 2012-10-29 | 2013-02-13 | 清华大学深圳研究生院 | Gene drug for combined treatment on tumors, and use thereof |
| WO2015097220A1 (en) * | 2013-12-23 | 2015-07-02 | Psioxus Therapeutics Limited | A method of making adenovirus and corresponding plasmids |
| CN106916851A (en) * | 2017-03-01 | 2017-07-04 | 广州恩宝生物医药科技有限公司 | Type adenovirus vector of a kind of replication deficient human 14 and its preparation method and application |
| US9987314B2 (en) | 2013-10-25 | 2018-06-05 | Psioxus Therapeutics Limited | Oncolytic adenoviruses armed with heterologous genes |
| US10034905B2 (en) | 2014-04-12 | 2018-07-31 | Psioxus Therapeutics Limited | Group B adenovirus modified in the E4orf4 region |
| US10124028B2 (en) | 2015-04-30 | 2018-11-13 | Psioxus Therapeutics Limited | Oncolytic adenovirus encoding a B7 protein or active fragment |
| US11155622B2 (en) | 2015-12-17 | 2021-10-26 | Psioxus Therapeutics Limited | Virus encoding an anti-TCR-complex antibody or fragment |
| US11840702B2 (en) | 2017-08-28 | 2023-12-12 | Akamis Bio Limited | Adenovirus armed with bispecific T cell activator |
| US12049513B2 (en) | 2016-08-29 | 2024-07-30 | Akamis Bio Limited | Oncolytic group B adenovirus expressing a stroma-targeted bispecific t-cell engager |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103555765B (en) * | 2013-05-30 | 2015-01-07 | 中南大学湘雅医院 | Transcriptional regulation tumor targeted replication oncolytic adenovirus vector, adenovirus carrying therapeutic gene, and preparation method and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004104204A1 (en) * | 2003-05-10 | 2004-12-02 | Zhaohui Peng | RECOMBINANT GENE MEDICINE OF ADENOVIRUS VECTOR AND GENE p53 FOR TREATING PROLIFERATIVE DISEASES |
| CN102229962A (en) * | 2011-05-26 | 2011-11-02 | 陕西师范大学 | Oncolytic adenovirus vector for modifying and expressing two exogenous genes by fibrin, construction method and application of vector |
-
2012
- 2012-01-18 CN CN 201210014951 patent/CN102586327B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004104204A1 (en) * | 2003-05-10 | 2004-12-02 | Zhaohui Peng | RECOMBINANT GENE MEDICINE OF ADENOVIRUS VECTOR AND GENE p53 FOR TREATING PROLIFERATIVE DISEASES |
| CN102229962A (en) * | 2011-05-26 | 2011-11-02 | 陕西师范大学 | Oncolytic adenovirus vector for modifying and expressing two exogenous genes by fibrin, construction method and application of vector |
Non-Patent Citations (1)
| Title |
|---|
| 王福山等: "定点整合型基因治疗腺病毒载体的构建", 《北京医科大学学报》 * |
Cited By (19)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102921020A (en) * | 2012-10-29 | 2013-02-13 | 清华大学深圳研究生院 | Gene drug for combined treatment on tumors, and use thereof |
| US11938159B2 (en) | 2013-10-25 | 2024-03-26 | Akamis Bio Limited | Oncolytic adenoviruses armed with heterologous genes |
| US9987314B2 (en) | 2013-10-25 | 2018-06-05 | Psioxus Therapeutics Limited | Oncolytic adenoviruses armed with heterologous genes |
| US11439678B2 (en) | 2013-10-25 | 2022-09-13 | Psioxus Therapeutics Limited | Oncolytic adenoviruses armed with heterologous genes |
| JP2021040651A (en) * | 2013-12-23 | 2021-03-18 | サイオクサス セラピューティクス リミテッド | Method of making adenovirus and corresponding plasmids |
| WO2015097220A1 (en) * | 2013-12-23 | 2015-07-02 | Psioxus Therapeutics Limited | A method of making adenovirus and corresponding plasmids |
| JP7104994B2 (en) | 2013-12-23 | 2022-07-22 | サイオクサス セラピューティクス リミテッド | Methods for producing adenoviruses and corresponding plasmids |
| US10472648B2 (en) | 2013-12-23 | 2019-11-12 | Psioxus Therapeutics Limited | Method of making adenovirus and corresponding plasmids |
| US10034905B2 (en) | 2014-04-12 | 2018-07-31 | Psioxus Therapeutics Limited | Group B adenovirus modified in the E4orf4 region |
| US10548929B2 (en) | 2015-04-30 | 2020-02-04 | Psioxus Therapeutics Limited | Oncolytic adenovirus encoding a therapeutic protein or active fragment |
| US10849945B2 (en) | 2015-04-30 | 2020-12-01 | Psioxus Therapeutics Limited | Oncolytic adenovirus encoding a B7 protein or active fragment |
| US11000559B2 (en) | 2015-04-30 | 2021-05-11 | Psioxus Therapeutics Limited | Oncolytic adenovirus encoding a B7 protein |
| US10322152B2 (en) | 2015-04-30 | 2019-06-18 | Psioxus Therapeutics Limited | Oncolytic adenovirus encoding a B7 protein |
| US10124028B2 (en) | 2015-04-30 | 2018-11-13 | Psioxus Therapeutics Limited | Oncolytic adenovirus encoding a B7 protein or active fragment |
| US11155622B2 (en) | 2015-12-17 | 2021-10-26 | Psioxus Therapeutics Limited | Virus encoding an anti-TCR-complex antibody or fragment |
| US11970536B2 (en) | 2015-12-17 | 2024-04-30 | Akamis Bio Limited | Group B adenovirus encoding an anti-TCR-complex antibody or fragment |
| US12049513B2 (en) | 2016-08-29 | 2024-07-30 | Akamis Bio Limited | Oncolytic group B adenovirus expressing a stroma-targeted bispecific t-cell engager |
| CN106916851A (en) * | 2017-03-01 | 2017-07-04 | 广州恩宝生物医药科技有限公司 | Type adenovirus vector of a kind of replication deficient human 14 and its preparation method and application |
| US11840702B2 (en) | 2017-08-28 | 2023-12-12 | Akamis Bio Limited | Adenovirus armed with bispecific T cell activator |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102586327B (en) | 2013-09-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102586327B (en) | D24 fiber protein modified conditionally replicating adenovirus carrier with exogenous gene by one-step method and application of carrier | |
| Lukashev et al. | Evidence of frequent recombination among human adenoviruses | |
| CN104004778B (en) | Targeting knockout carrier containing CRISPR/Cas9 system and adenovirus thereof and application | |
| Wong et al. | Oncolytic viruses for cancer therapy: overcoming the obstacles | |
| CN104894075A (en) | Method for preparing vaccine by editing pseudorabies virus genomes based on CRISPR/Cas9 and Cre/lox systems and application of method | |
| CN102264760A (en) | Oncolytic adenoviral vectors and methods and uses related thereto | |
| CN106318916B (en) | Recombined adhenovirus and tetravalence adenovirus vaccine and preparation method thereof | |
| CN105420261A (en) | Newcastle disease virus heat-resistant transformation method and application | |
| Duffy et al. | Generation and characterization of a novel candidate gene therapy and vaccination vector based on human species D adenovirus type 56 | |
| CN108220251B (en) | Recombinant infectious pustulosis virus, and preparation method and application thereof | |
| CN111166875A (en) | Adenovirus bivalent vaccine | |
| CN105755043B (en) | A kind of pair of copy Human p53 gene recombined adhenovirus and preparation method thereof | |
| CN113874495A (en) | Method for producing virus and harvesting solution composition | |
| CA2449013C (en) | Viral mutants that selectively replicate in targeted human cancer cells | |
| CN102229962B (en) | Oncolytic adenovirus vector for modifying and expressing two exogenous genes by fibrin, construction method and application of vector | |
| CN101565718A (en) | Construction method of three-target mosaic type oncolytic adenovirus Ad5/F11 carrier and use thereof | |
| Yang et al. | Rapid, efficient, and modular generation of adenoviral vectors via isothermal assembly | |
| CN100429316C (en) | Recombination adenovirus and its application | |
| Davydova et al. | Oncolytic adenoviruses: design, generation, and experimental procedures | |
| CN103343110B (en) | Construction method of recombinant coatpox virus used for expressing foot and mouth disease virus empty capsid | |
| CN101649328A (en) | Ad5 D24 conditional reproduction type adenovirus carrier for expressing multiple exogenous genes, constructing method and application thereof | |
| CN103298936A (en) | Recombinant vaccinia virus having hemagglutinin protein genes derived from novel influenza viruses | |
| RU2443779C2 (en) | Method for making recombinant adenovirus preparation characterised by lower ratio of physical and infectious viral particles, and genetically therapeutic drug preparation produced by such method | |
| CN1952160B (en) | Recombinant of intelligent adenovirus vector and khp53 gene and application thereof | |
| CN101215575A (en) | Rabbit viral haemorrhagic virus capsid protein gene recombination adenovirus and bacterin |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130911 Termination date: 20140118 |