CN102586201A - Preparation method of recombinant human thioredoxin - Google Patents

Abstract

The invention belongs to the technical field of bio-pharmacy and relates to a preparation method of recombinant human thioredoxin. A target protein with the purity of above 95 percent can be obtained through the preparation method, and the obtained human thioredoxin has biological activity. The invention further constructs a strain library of the recombinant human thioredoxin and determines the heredity stability of a seed bank; an immunoblotting method is adopted for proving that the recombinant human thioredoxin can be specifically combined with mouse anti-human thioredoxin antiserum; and the activity of the protein is further determined through an insulin disulfide bond reduction method. Results prove that the purified recombinant human thioredoxin has the activity of an insulin disulfide bond reducase and the effects are obvious. According to the method disclosed by the invention, the separation and purification of the target protein can be completed only through two-step ion exchange action for chromatography, and the preparation method has the advantages of simple steps, speediness and low cost, and can lay a foundation for further research and extensive application of the human thioredoxin.

Description

The preparation method of recombinant human Trx

Technical field

The invention belongs to the medical biotechnology field; The preparation method who relates to a kind of recombinant human Trx; Be specifically related to from prokaryotic expression recombinant human Trx; The purifying of recombinant human Trx and evaluation, the mitotic stability of structure recombinant human Trx strain library, mensuration seed bank is identified the external biological activity of recombinant human Trx etc.

Background technology

Trx (Trx) is the small protein that molecular weight is about 12kDa, contains disulfide linkage/sulfydryl of regulating redox active in its aminoacid sequence, and this structure is arranged in conserved sequence: Cys-Gly-Pro-Cys is its active site.Under the oxidizing condition, form disulfide linkage (Trx-S2) between Cys32 and the Cys35, this disulfide linkage can be by TrxR through the reduction of NADPH hydrogen supply, and reduced form Trx (Trx-(SH) 2) contains sulfydryl.Trx realizes its redox modulating function through the exchange of disulfide linkage and sulfydryl.Discover that Trx extensively is present in prokaryotic organism, eukaryote, plant and the Mammals, structure height is conservative, and human Trx is made up of 105 amino acid.Also there are other 3 cysteine residues in addition in Trx in the mammalian cell in the active site, can modify the activity that changes Trx through the back.

People's Trx can be divided into endochylema type (Trx1) and two kinds of hypotypes of plastosome type (Trx2).The Trx system comprises Trx, Trx reductase enzyme (TrxR), DPNH I (NADPH) and Trx px (TrxP), is the redox enzyme system of the wide expression of a control cell reducing/oxidizing state and cell proliferation/existence.Trx can change reduced form into from oxidized form under the effect of TrxR, the Trx of reduced form can the many reduction reactions that contain disulfide bond protein matter of catalysis.TrxP can be in the presence of reduced form Trx is H with hydrogen-peroxide reduction ₂O.Discover that Trx is except basic redox modulating function, it is active to also have many other biologicals such as anti-inflammatory, anti-apoptosis to learn, thereby the relation of itself and human diseases receives people's attention day by day.

The intravital Trx of people is one type of Buchner's bodies, can stress situation make response to multiple, and pair cell is protected.Except its anti-oxidative effect, Trx has anti-apoptosis and anti-inflammatory action, and suppresses the expression of leukocyte chemotaxis and chemokine.Having proved and in animal model, in cardiovascular disorder, played the part of important role, is that the key of keeping cardiovascular stable state is regulated molecule.Injection recombinant human Trx or Trx expression excessively in animal body can be brought into play anti-oxidant and anti-inflammatory action effectively in the animal body.Can weaken myocardial ischemia through reducing oxidation/nitrated apoptosis of cardiac muscle that stress, suppress, improve heart function, reduce heart stalk area, thereby bring into play its cardioprotection.

And the Trx solvability is good, as other proteic amalgamation and expression label, can effectively promote proteic solubility expression.Trx has thermostability preferably, can preserve more than one month at 4 ℃, can tolerate 80 ℃ temperature the short period of time.Trx is 1 hour in the mouse body in the intravital transformation period of Mammals and inequality, and rat is 2 hours, and monkey is 8 hours, excretes with urine.

Though Trx has a wide range of applications; But the Trx that is used for laboratory and clinical trial at present mainly contains two big types; Wherein mainly see, but the Trx output of from animal tissues, extracting is few, purity is low, immunogenicity is strong, cost an arm and a leg with what from animal tissues, extract more.Also having minority is to adopt the genetically engineered reorganization; But the Trx of these genetically engineered reorganization mostly has label; This Trx that has label can't use and human body, and having only minority is tape label not, but only limits to laboratory scale mostly; The feasible process degree is low, be difficult to enlarge and produce, and these all make Trx use to be restricted can't to satisfy into property of medicine evaluation.

Summary of the invention

The preparation method who the purpose of this invention is to provide a kind of Trx, preparing method's step of the present invention is simple, fast and reliable, cost is low, only used two step ion exchange chromatographies just to accomplish purge process, and purity reaches more than 95%.The Trx of this method preparation has BA, can combine with mouse-anti Trx antiserum(antisera) specificity, also can make the Regular Insulin disulfide bond reduction, its active and standard substance indifference.

" recombinant human Trx " dna sequence dna (rhTrx) is shown in SEQ ID No:1.

The preparation method of recombinant human Trx of the present invention is characterized in that, this preparation method comprises following steps:

1) inducing culture contains the reorganization bacterium of recombinant human Trx, centrifugal acquisition thalline; 2) UW splits bacterium, and smudge cells is centrifugal, collects supernatant; 3) with step 2) supernatant that obtains is splined on the anion-exchange chromatography post, collects target protein place elution peak, obtains purified product one time; A purified product that 4) will obtain is splined on the cation-exchange chromatography post, collects target protein place elution peak, obtains the recombinant human Trx.Final obtain purity reach more than 95%, more than 96%, more than 97%, more than 98%, more than 99% or 100% target protein matter.

In the step 1), when being cultured to OD600nm and reaching 7-8, the IPTG that adds final concentration and be 1mM is as inductor, and said bacterium is e. coli bl21 (DE3).

Trx's according to the invention gene order is shown in SEQ ID NO:1.

Step 2) in; Adding is split the bacterium damping fluid and is split bacterium; Thalline splits the bacterium damping fluid with the ratio of splitting the bacterium damping fluid for the 1g thalline adds 10ml, and the said bacterium damping fluid that splits is that STE splits the bacterium damping fluid, and this splits the bacterium damping fluid is made up of the 50mM Tris-HCl of 100mM NaCl, 1mMEDTA, pH 8.0.

In the step 3), said anion-exchange chromatography post is a DEAE anion-exchange chromatography post, is specially DEAESepharose Fast Flow chromatography column.In the step 4), said cation-exchange chromatography post is a SP cation-exchange chromatography post, is specially SP Sepharose Fast Flow chromatography column.

In step 3), before the appearance, elder generation is with abundant balance DEAE Sepharose Fast Flow (high sub) (GE company) chromatography column of A liquid (pH 8.0 for 20mM Tris-HCl, 1mM EDTA) on the supernatant; On the supernatant appearance after, with B liquid (20mM Tris-HCl, 1mM EDTA; 1M NaCl, pH 8.0) 10 column volumes of (elution buffer) continuous gradient wash-out, collect target protein place elution peak (see figure 8); Add 150 times of volume C liquid (pH 4.0 for 20mM citric acid-sodium citrate damping fluid, 1mM EDTA) (dialyzate) again; Dialysis 24h, liquid is changed three to four times in the centre.

In step 4), earlier with the abundant balance SP Sepharose of C liquid Fast Flow (GE company) chromatography column, appearance on the supernatant after will dialysing again; With D liquid (20mM citric acid-sodium citrate damping fluid, 1M NaCl, 1mM EDTA; PH 4.0) 10 column volumes of (elution buffer) continuous gradient wash-out, collect target protein place elution peak (see figure 9), with its PBS (NaCl 10g/L to 150 times of volumes; KCl 0.2g/L, Na ₂HPO ₄.12H ₂O 2.9g/L, KH ₂PO ₄0.2g/L) divide 3 dialysis, with 0.22 μ m membrane filtration degerming ,-20 ℃ of preservations are subsequent use after the packing.

Can know by Figure 10,12,13; Only through an anion-exchange chromatography and a cation-exchange chromatography; Just can obtain the very high recombinant human Trx of purity, purity can reach more than 95%, more than 96%, more than 97%, more than 98%, more than 99% or 100%.

The purity of recombinant human Trx is identified and activity identification, adopts the semiqualitative analysis of SDS-PAGE and immunoblotting, HPLC, mass spectroscopy; The external biological activity identification of recombinant human Trx, employing be Regular Insulin disulfide bond reduction method.

Among the preparation method of the present invention; The ultrasonic supernatant that splits behind the bacterium only only need just can be accomplished the purge process of target protein through 2 step ion exchange chromatographies; Wherein, Split the bacterium supernatant and can remove the foreign protein more than 50%, can obtain the target protein of purity through SP ion exchange chromatography greater than 95% through DEAE ion exchange chromatography.

Description of drawings

Shown in Figure 1 is the double digestion evaluation figure of recombinant plasmid pET-22b (+)-Trx;

A figure: pET-22b (+)-Trx/Nde I and BamH I double enzyme site synoptic diagram;

B figure is that the gel electrophoresis figure after enzyme is cut: M is DNA marker, and left side swimming lane 1 is the purpose band.

Shown in Figure 2 is the sequencing result figure of pET-22b (+)-Trx.

Colonial morphology for the reorganization bacterium shown in Figure 3 is identified.

Gram's staining for the reorganization bacterium shown in Figure 4 is identified.

Transmission electron microscope for the reorganization bacterium shown in Figure 5 is identified;

A figure amplifies 5000 times;

B figure amplifies 10000 times.

Shown in Figure 6ly be recombinant bacterial strain mitotic stability calibrating-recombinant plasmid restriction enzyme mapping, wherein, recombinant plasmid carries out 1% agarose electrophoresis with Nde I and BamH I double digestion; M.DNA marker, 1. former generation, 2.10 generations, 3.20 generations; 4.30 generation, 5.40 generations, 6.50 generations.

Shown in Figure 7 is that recombinant bacterial strain mitotic stability calibrating-product expression level is examined and determine, wherein M.protein marker; 1. before inducing; 2. former generation; 3.10 generation; 4.20 generation; 5.30 generation; 6.40 generation; 7.50 generation.

Abduction delivering result for the reorganization Trx shown in Figure 8, wherein;

A figure: the OD value with fermentation time changes adds 1mM IPTG abduction delivering when fermentation 6h;

B figure: 1:protein marker; 2: do not induce BL21/pET-22b (+)-Trx; 3:1mM IPTG induces BL21/pET-22b (+)-Trx 1h; 4:1mM IPTG induces BL21/pET-22b (+)-Trx 2h; 5:1mM IPTG induces BL21/pET-22b (+)-Trx 3h; 6:1mM IPTG induces BL21/pET-22b (+)-Trx 4h.

Shown in Figure 9 is DEAE anion-exchange chromatography result, wherein,

A figure: split the bacterium supernatant through DEAE Sepharose Fast Flow tomographic map;

B figure: 1:protein marker; 2: split the bacterium supernatant; 3: collect and pass liquid; 4; Collect peak-target protein.

Shown in Figure 10 is SP cation-exchange chromatography result, wherein,

A figure: thick pure products is through SP Sepharose Fast Flow tomographic map;

B figure: 1:protein marker; 2,3: collect appearance on peak-target protein lower concentration; 4,5: appearance on the concentration in collection peak-target protein; 6,7,8: collect appearance on peak-target protein high density.

Purification result for the reorganization Trx shown in Figure 11, wherein, 1:protein marker; 2: split the bacterium supernatant; 3:DEAE anionresin effect purifying target protein; 4:SP cationic exchange effect purifying target protein.

Immunoblotting evaluation for the recombinant human Trx that obtains through preparation method of the present invention shown in Figure 12, about be the albumen that is purified into.

HPLC analysis for the recombinant human Trx through preparation method of the present invention acquisition shown in Figure 13.

Mass spectroscopy figure for the recombinant human Trx through preparation method of the present invention acquisition shown in Figure 14.

Determination of activity result for the recombinant human Trx through preparation method of the present invention acquisition shown in Figure 15;

◆ 1ug/ul standard substance Trx is arranged in the reaction solution;

The Trx that has 1ug/ul present method to be purified in the ■ reaction solution;

Blank.

Embodiment

Experiment material

(1) key instrument

The 5415C desk centrifuge, Eppendorf company; GS-15R high speed tabletop refrigerated centrifuge, U.S. Beckman company; The VORTEX-2 mixing tank, Scientific industries company; The accurate pH meter of PHS-3C type, Shanghai thunder magnetic instrument plant; The CSIOI-IE electric drying oven with forced convection, Chinese-foreign joint Chongqing four reaches laboratory apparatus ltd; DY-C1 electrophoretic blotting appearance, Jiangsu Province Xinghua City analytical instrument factory; The biochemical incubator of SHH-3, Sida Experiment Instrument Factory, Chongqing; Constant water bath box, Pharmacia (LKB) company; SBD50-1 bio water bath with thermostatic control shaking table, Denmark Heto master Shaker company; The Tempeerature-constant air shaking table, German GALLENKAMP; The protein electrophoresis appearance, Bio-Rad company; Ultraviolet transmission reflective analysis appearance, pool Educational Instrument Factory on Yongjia, Zhejiang; The J2-HS completely automated high speed refrigerated centrifuge, U.S. Beckman company; J-6B large vol whizzer, U.S. Beckman company; The full-automatic sequenator of 377 types, PE company; Labo Autoclave autoclaving appearance, ANYO company; 1815TC CO2 constant temperature incubator, U.S. Shel-Lab company; TH-2C isothermal vibration device, granary, Jiangsu experimental installation factory; Normal pressure liquid chromatograph unit Phamacia GP-10; Peristaltic pump Phamacia P-1; Ultraviolet Detector Phamacia Uricord SII; Fraction collector Phamacia RediFrac; Bechtop, Bengbu treating plant factory; The Milli-QUF water purifior, Millipore company; Lambda UV/VIS spectrophotometer, PE company; The DW1.0-60E freeze drier, Denmark Heto company.

(2) main agents material

Bacteria culture: E.coli DH5 α, E.coli BL21 (DE3) is provided by big four army medical university's biotechnology centers

Plasmid vector: pET-22b is provided by big four army medical university's biotechnology centers

Molecular biology reagent:

Plasmid purification test kit and nucleic acid fragment purification kit are available from Shanghai Bo Ya company; Trizol is the Invitrogen Company products; The M-MLV reversed transcriptive enzyme is the promega product; Restriction endonuclease Nde I and EcoR I are available from TaKaRa company; The T4DNA ligase enzyme, the TaqDNA polysaccharase, DNAMarker is available from TaKaRa company; Albumen Marker is available from Pharmacia company; Dna gel reclaims test kit available from omiga company; Ion exchange column is available from QIAGEN company.Anti-Trx's monoclonal antibody is purchased the company in Abcam.Goat anti-mouse igg-HRP is available from Santa company.The Trx standard substance are available from sigma company.

Main chemical reagent:

Tryptones, yeast extract are the Oxide Company products, and Tris base is the Promega Company products, and IPTG is the Solon Company products, and TEMED purchases the company in Bio-Rad.Acrylic amide, N, N '-dimethyl-bisacrylamide, SDS, ammonium persulphate, sodium-chlor, Hydrocerol A, Trisodium Citrate, glycerine, sal epsom, potassium primary phosphate, potassium hydrogenphosphate, sodium pyrosulfate, ammonium sulfate, ammonium chloride etc. are homemade AR.

The preparation of groundwork liquid:

LB nutrient solution: Tryptones 10g/L, yeast extract 5g/L, sodium-chlor 5g/L

LB solid medium: Tryptones 10g/L, yeast extract 5g/L, agar 15g/L, sodium-chlor 5g/L

Seed culture medium: Tryptones 1.6g/L, yeast extract 1g/L, sodium-chlor 0.5g/L, glycerine 2ml/L

Fermention medium: Tryptones 10g/L, yeast extract 10g/L, glycerine 20ml/L, sal epsom 0.6g/L,

Potassium primary phosphate 4g/L, potassium hydrogenphosphate 8g/L, sodium pyrosulfate 14g/L, ammonium sulfate 2.4g/L, ammonium chloride 0.04g/L

The feeding medium during fermentation nutrient solution: Tryptones 16g/L, yeast extract 8g/L, glycerine 80ml/L, sal epsom 1g/L,

PBS：NaCl?10g/L，KCl?0.2g/L，Na ₂HPO ₄.12H ₂O?2.9g/L，KH ₂PO ₄?0.2g/L

Embodiment one makes up recombinant human thioredoxin gene expression vector pET-22b (+)-rhTrx

(1) obtains Trx's full-length cDNA

Collect HEK293 (human embryo kidney) cell and add 1mL Trizol reagent, the extraction of total RNA is by the explanation routine operation.Ultraviolet spectrophotometer is measured the purity A260nm/A280nm=1.90 of RNA.

According to the people Trx1 gene coding region sequences Design primer of having reported, the gene number of landing is Gene ID:7295,

Synthetic by the big genome company of China.

Upstream primer: 5 ' GGAATTCCATATGGTGAAGCAGATC 3 '

Downstream primer: 5 ' GCGGATCCTTAGACTAATTCATTAATG 3 '

Synthesizing of cDNA the 1st chain: carry out according to Promega company M-MLVReverse Transcriptase specification sheets, main operation steps is following: in pcr tube, add total RNA1.5 μ g, random primer oligo (dT) 2 μ L (concentration is 10 μ mol/L); DEPC water complements to 12 μ L, and mixing is hatched behind the 5min ice bath rapidly for 70 ℃; Add M-MLV 5 * Buffer4 μ L; 10mmol/L dNTPmix 2 μ L, M-MLVReverse Transcriptase (200U/ μ L) 1 μ L adds ddH2O to total system 20 μ L; 42 ℃ of reaction 60min are hatched 10min deactivation ThermoScript II with termination reaction for 70 ℃.The polymerase chain reaction total reaction volume of cDNA is 25 μ L:

Template cDNA 4 μ L, upstream primer 2 μ L, downstream primer 2 μ L, Taq DNA Polymerase 12.5 μ L add H2O to 25 μ L.Reaction conditions is following: 94 ℃ of preparatory sex change 4min; 94 ℃ of sex change 30s, 55 ℃ of annealing 30s, 72 ℃ are extended 45s, 30 circulations; 72 ℃ are extended 10min.Polymerase chain reaction product is got the band of locating about the 350bp purifying of tapping rubber fast after the 10g/L agarose gel electrophoresis is analyzed.

(2) structure of pET-22b (+)-rhTrx and evaluation

The gained dna fragmentation is connected into same pET-22b (+) carrier segments that obtains with Nde I and EcoR I double digestion behind Nde I and BamH I double digestion, connect product and use CaCl ₂Method changes E.coli DH5 α competent cell over to.Extract plasmid, cut through enzyme and identify the insertion fragment (Fig. 1) that obtains the expection size, dna sequencing is display sequence correct (Fig. 2) as a result.With this plasmid called after pET-22b (+)-rhTrx.

Embodiment two makes up recombinant human Trx strain library

(1) preparation of competent cell:

Get E.coli BL21 (DE3) glycerine bacterial classification and be inoculated in the LB substratum in 1: 100 ratio, 37 ℃ of shaking culture are spent the night, and transfer once next day, continues to be cultured to about about 0.4 (aseptic techniques) of OD600.With bacterium liquid ice bath 10min, centrifugal (3000rpm * 5min, 4 ℃) back supernatant discarded; Add the 100mmol/L CaCl2 of 1/2 volume precooling, blow afloat deposition gently, ice bath 40min; Centrifugal (3000rpm * 5min, 4 ℃) are abandoned the 100mmol/L CaCl2 that contains 25% glycerine that adds 1/25 volume behind the supernatant; Blow afloat deposition, divide in the Eppendorf pipe of packing into ,-70 ℃ of preservations are subsequent use.

(2) conversion of competent cell and cultivation:

Competent escherichia coli cell is taken out from-70 ℃, and ice bath dissolving 5-10min adds the connection product of pET-22b (+)-rhTrx, slight mixing, ice bath 20min, 42 ℃ of heat-shocked 90s, bed board then, 37 ℃ of overnight cultures.

(3) extraction of plasmid and evaluation

Connecting picking neat in edge on the petridish that product transforms back 37 ℃ of overnight cultures; The mono-clonal that growth conditions is good is inoculated into 100mL and contains in the LB substratum of Amp 37 ℃; 200rpm cultivates 9h; Extract plasmid 50 pipes with plasmid extraction kit, carry out double digestion with restriction enzyme Nde I and BamH I after, carry out agarose gel electrophoresis observe whether insertion fragment and insertion are arranged segment whether with expect big or small consistent.Enzyme is cut evaluation male clone send the big gene ltd of Beijing China to carry out dna sequencing.Correct person's called after pET-22b (+)-rhTrx will check order.

(4) preparation of glycerol stock

Connecting picking neat in edge on the petridish that product transforms back 37 ℃ of overnight cultures, the clone that growth conditions is good is inoculated into 100mL and contains in the LB substratum of Amp 37 ℃; 200rpm cultivates 9h, gets bacterium liquid and adds 50% glycerine, is sub-packed in the bacterial classification pipe; Seal preparation 50 pipes ,-70 ℃ of preservations.

(5) calibrating of seed bank

Colonial morphology calibrating: be typical intestinal bacteria colonial morphology, do not have other varied bacteria growings (Fig. 3); The gramstaining calibrating is typical gram negative bacillus (Fig. 4); The transmission electron microscope calibrating is typical intestinal bacteria form, no mycoplasma, virus-like particle and other microbiological contamination (Fig. 5); The antibiotics resistance calibrating conforms to the original strain resistance; The biochemical reaction characteristic conforms intestinal bacteria biological character of engineering bacteria.

(6) mitotic stability of engineering bacteria calibrating

Engineering bacteria cut on the LB flat board goes down to posterity 50 times; Per 10 generations observe plasmid enzyme restriction collection of illustrative plates, product expression level and to split bacterium supernatant rhTrx active; The result shows, plasmid enzyme restriction collection of illustrative plates, engineering bacterium expression level and split bacterium supernatant Trx active all consistent with original strain (Fig. 6,7).

Embodiment three reorganization Trx's expression

(1) laboratory culture of recombinant human Trx

In the laboratory study stage, we adopt triangle to shake bottle engineering bacteria are cultivated, and concrete steps are following: recombinant plasmid pET-22b (+)-Trx transformed into escherichia coli BL21 (DE3) competent cell; Picking neat in edge behind the 12h; The bacterium colony that growth conditions is good is inoculated in the LB nutrient solution (containing penbritin 100mg/L) 37 ℃ of overnight cultures of shaking table; Next day, the ratio with 1: 100 was inoculated in the fresh LB nutrient solution (containing penbritin 100mg/L); 37 ℃ are continued to be cultured to bacterial density and reach OD600=0.4～0.6, add 1mM IPTG, collect thalline after inducing 4h.

(2) foundation of recombinant human Trx zymotechnique

The glycerine bacterial classification streak inoculation of-70 ℃ of preservations is dull and stereotyped in the solid LB that contains penbritin (100mg/L); 37 ℃ of constant temperature incubator overnight cultures; Choosing well-grown mono-clonal is inoculated in the LB nutrient solution (containing penbritin 100mg/L); Shaking table is cultured to bacterial density for 37 ℃ and reaches OD600=0.6, is inoculated in 1% (to contain penbritin 100mg/L) in the 50ml seed culture medium 37 ℃, and the 220rpm overnight cultures is a primary seed solution; Next day, the ratio with 1: 100 was inoculated in fresh LB nutrient solution (containing penbritin 100mg/L) the 100mlX2 bottle, and 37 ℃, 220rpm continues to be cultured to bacterial density and reaches OD600=0.4～0.6, is grown to secondary seed solution.Preparation is used for the top fermentation jar.

Adopt the Biostat-CT5 automatically controlled fermentor, fermentation volume is 5L, and dissolved oxygen is controlled at 30%-60%; Through regulating ventilation flow velocity (AIRFL) and stirring revolution (STIRR) it is controlled; When revolution reaches maximum (800rpm), when air-flow is 4.00L/Min, feed pure oxygen; Temperature is controlled to be 37 ℃; PH is controlled at about 7, when the pH value is lower than this value, controls with adding ammoniacal liquor; Adopt the batch feeding fed-batch mode: 3h does not add feed supplement before the fermentation, and 4-7h stream rate of acceleration is 100ml/h, and 7-10h is 200ml/h.In the whole fermentation process,, observe the growth of engineering bacteria and the expression of target protein through the stream rate of acceleration of control pH value, activation and induction time, saturation dissolved oxygen and feed supplement.Every 30min sampling and measuring OD600nm value, when being cultured to OD600nm and reaching 7-8, adding final concentration is the IPTG of 1mM, collects thalline after continuing to cultivate 4h, get to carry out SDS-PAGE in a small amount and detect protein expression level, all the other thalline preserve with-70 ℃ be used for purifying.

(3) the SDS-PAGE electrophoresis is identified

The ultrasonic bacterium supernatant that splits of 30 μ L adds 30 μ l 2 * year appearance damping fluid, mixing.Boil 10min in the boiling water; Cooling back 12000rpm is from 10min; Get 10 μ l supernatant application of samples and concentrate glue in 15% separation gel 6%, last appearance back voltage is the about 30min of 80V, and voltage rose to the about 2h of 120V after sample got into separation gel; With 0.5% Coomassie brilliant blue R-250 vibration dyeing 2-3h, decolouring is preserved until the dried glue of the clear back preparation of background.

Can know that from Fig. 8 when being cultured to OD600nm and reaching 7-8, the cell proliferation of reorganization bacterium has got into the quick division growth phase, is the Best Times that adds inductor at this moment; When 1mM IPTG induced 4h, the expression amount of recombinant protein was maximum, therefore selected 1mM IPTG to induce 4h best.

Embodiment quadruple group Trx's purifying

(1) ultrasonicly splits bacterium

Get 10g and express wet bacterium, it is suspended in 100mL STE (100mMNaCl, 50mM Tris.Cl, 1mM EDTA; PH 8.0) in, ultrasonic bacterium, the ultrasonic 5s of splitting of 300W in ice bath; 10s intermittently, omnidistance 40min, centrifugal (12000rpm * 40min; 4 ℃), keep supernatant, remove impurity with 0.45 μ m membrane filtration.

(2) ion column chromatography

The supernatant of collecting is used A liquid: 20mM Tris-HCl pH 8.0, and the abundant equilibrated DEAE of 1mM EDTA Sepharose Fast Flow (high sub) (GE company) chromatography purification is used B liquid: 20mM Tris-HCl, 1mM EDTA; 1MNacl, pH 8.0,10 column volumes of continuous gradient wash-out; Collect target protein place elution peak (see figure 9), add 150 times of volume C liquid again: 20mM citric acid-sodium citrate damping fluid, 1mM EDTA; PH 4.0, dialysis 24h, and liquid is changed three to four times in the centre.

Dialysis back supernatant is used D liquid: 20mM citric acid-sodium citrate damping fluid, 1M NaCl with the abundant equilibrated SP of C liquid Sepharose Fast Flow (GE company) chromatography purification; 1mM EDTA, 10 column volumes of pH 4.0 continuous gradient wash-outs are collected target protein place elution peak (see figure 10); It is dialysed to 150 times of volume PBS; Divide 3 dialysis, with 0.22 μ m membrane filtration degerming ,-20 ℃ of preservations are subsequent use after the packing.

Can know by Figure 11, only, just can obtain the very high recombinant human Trx of purity through an anion-exchange chromatography and a cation-exchange chromatography.

Embodiment quintet Trx's evaluation

(1) Lowry ' s method is surveyed protein contnt:

The formulation of typical curve: accurately measure standard protein solution (100 μ g/ml) 0,0.2,0.4,0.6,0.8,1.0ml places test tube (two-tube) respectively, and adding distil water is mended to 1ml.All the other operate same sample, can get a typical curve.

The sample detection method: accurately measure certain volume sample (containing about albumen 50 μ g), rapid mixing, room temperature is placed 30min, 650nm colorimetric.

Protein contnt calculates: find institute's test sample article protein content or with OD value substitution regression equation calculation protein content according to the OD value from typical curve.

Annotate:, can sample be done suitably dilution if samples contg exceeds standard curve range.

(2) immunoblotting of recombinant human Trx is identified

Thalline after inducing is after SDS-PAGE finishes; Pull down gel; According to the Bio-Rad description of product; With gel near negative electrode one side, pvdf (PVDF) film near anode one side, 100V constant voltage electrophoresis is 40 minutes in the transfering buffering liquid (25mM Tris, 192mM Glycine, 20% methyl alcohol) of precooling, and albumen is transferred on the pvdf membrane.After electrophoresis finishes, take out pvdf membrane, washings TBST (20mM Tris-HCl, pH7.5,150mM NaCl; 0.05%Tween-20) clean the back and immerse in the confining liquid (TBST that contains 5% skim-milk) 4 ℃ of sealings and spend the night, the TBST room temperature is washed 3 times, each 10min, and (1:15h is hatched in dilution in 1: 1000 to add Trx's monoclonal antibody; The TBST room temperature is washed 3 times, and each 10min adds goat anti-mouse igg-HRP (by dilution in 1: 5000) again; Incubated at room 45min, the TBST room temperature is washed 3 times, each 10min; Pvdf membrane immerses in the DAB colour developing liquid, room temperature lucifuge colour developing 1min, distilled water flushing termination reaction (seeing Figure 12).

(3) efficient liquid phase chromatographic analysis

Steady with moving phase (20mM Tris-HCl pH 8.0) balance chromatographic column to baseline, flow velocity is 0.6ml/min, gets appearance on the 25 μ l protein samples, uses the moving phase wash-out, and the detection wavelength is 280nm, record and analytical results.

See Figure 13, the purity of the recombinant human Trx for preparing through preparation method of the present invention is very high, does not see impurity.

(4) mass spectroscopy (MALDI-TOF-MS)

Use molecular weight cut-off the purified proteins sample to be carried out desalination, concentrates, after the 0.22 μ m filter filtration sterilization, entrust Xi'an Technological University that it is carried out molecular-weight determination as the ultra-filtration centrifuge tube of 3000Da.

See Figure 14, the purity of the recombinant human Trx for preparing through preparation method of the present invention is very high, does not see impurity.

(5) recombinant human Trx extracorporeal biology is active detects

Getting purified proteins adjustment concentration is 40 μ g/40 μ l; Activation solution [the activationbuffer:100mM XN-2 hydroxyethyl piperazine-N`-2 ethyl sulfonic acid (Hepes) that adds 2 μ l; 2mM YD 30 (EDTA); 1mg/ml BSA, and 2mM dithiothreitol] then under 37 ℃, hatch 20mins.The reaction solution (reaction buffer:100mM Hepes, 2.0mM EDTA, 0.2mMNADPH, and 140 μ M insulin) that adds 20 μ l then.(Trx reductase:1 μ l, 15mU Sigma), add the deionized water of equal volume at the blank sample in sample to be tested, to add 1 μ l Mammals Trx reductase enzyme.Reaction system adds 125 μ l reaction terminating liquid (Stopping solution:0.2M Tris-CL after hatching 20min under 37 ℃; 10M guanidine-HCl; And 1.7mM 3-carboxy-4-nitrophenyl disulfide) reaction is stopped; 96 orifice plates are placed SpectraMax-Plus culture plate spectrophotometer, the absorbancy of sample after 412nm place detection reaction, the result sees Figure 15.

Effect of the present invention is following:

A) utilize gene synthetic and round pcr successfully to make up recombinant human thioredoxin gene expression vector pET-22b (+)-rhTrx, it is consistent with expection that its enzyme is cut qualification result.

B) engineering bacteria BL21/pET-22b (+)-rhTrx through lower concentration IPTG (1mM) but just high efficiency expressing destination protein after inducing, that induces the back thalline splits the bacterium supernatant through 2 step ion exchange chromatographies, can obtain purity greater than 95% target protein.

C) adopt immunoblotting proof recombinant human Trx to combine with mouse-anti Trx antiserum(antisera) specificity.

D) purified recombinant Trx and standard substance Trx all can make the Regular Insulin disulfide bond reduction.

E) find out the stable Chinese style technology that is adapted to suitability for industrialized production.

Claims (10)

1. the preparation method of a recombinant human Trx (rhTrx) is characterized in that, this preparation method comprises following steps:

1) inducing culture reorganization bacterium, centrifugal acquisition thalline;

2) split bacterium, centrifugal, collect supernatant;

3) supernatant is splined on the anion-exchange chromatography post, collects target protein place elution peak, obtains purified product one time;

A purified product that 4) will obtain is splined on the cation-exchange chromatography post, collects target protein place elution peak, obtains the recombinant human Trx;

The final purity that obtains reaches the recombinant human Trx more than 95%.

2. preparation method according to claim 1 is characterized in that, in the step 1), when being cultured to OD600nm and reaching 6-8, the IPTG that adds final concentration and be 1mM is as inductor.

3. preparation method according to claim 1 is characterized in that, in the step 1), said bacterium is e. coli bl21 (DE3).

4. preparation method according to claim 1; It is characterized in that; Step 2) in, adding is split the bacterium damping fluid and is split bacterium, and thalline splits the bacterium damping fluid with the ratio of splitting the bacterium damping fluid for the 1g thalline adds 10ml; The said bacterium damping fluid that splits is that STE splits the bacterium damping fluid, and this splits the bacterium damping fluid is made up of the 50mM Tris-HCl of 100mM NaCl, 1mM EDTA, pH 8.0.

5. preparation method according to claim 1 is characterized in that, in the step 3), said anion-exchange chromatography post is a DEAE Sepharose Fast Flow chromatography column.

6. preparation method according to claim 1 is characterized in that, in the step 4), said cation-exchange chromatography post is a SP Sepharose Fast Flow chromatography column.

7. preparation method according to claim 1 is characterized in that, in the step 3), the elution buffer that said anion-exchange chromatography post uses is by 20mM Tris-HCl, 1mM EDTA, and 1M NaCl, pH8.0 forms.

8. preparation method according to claim 1 is characterized in that, in the step 3); After collecting target protein place elution peak, add the dialyzate of 150 times of volumes again, divide 3 dialysis; Used dialyzate is by 20mM citric acid-sodium citrate damping fluid, 1mM EDTA, and pH 4.0 forms.

9. preparation method according to claim 1 is characterized in that, in the step 4), the elution buffer that said cation-exchange chromatography post uses is by 20mM citric acid-sodium citrate damping fluid, 1M NaCl, and 1mM EDTA, pH 4.0 forms.

10. preparation method according to claim 1 is characterized in that, in the step 4), behind the elution peak of collection target protein place, adds the PBS of 150 times of volumes again, divides 3 dialysis.

Images