CN102559707A - Peste des petits ruminants virus H and F protein antigenic epitope gene fragment, and expression and application thereof - Google Patents

Abstract

The invention discloses a peste des petits ruminants virus H and F protein antigenic epitope gene fragment. Predicted and screened antigenic epitopes are connected by flexible amino acid fragments, an exogenous general auxiliary T lymphocytes epitope PADRE is added, a nucleotide sequence is deduced according to the amino acid sequence of the antigenic epitopes, BamHI and Xho I restriction enzyme cutting sites are added into 5' and 3' ends of the amino acid sequences of the tandem epitope respectively, and TAA terminator codons are added into the tail end, so a targeted gene fragment with the length of 456bp is synthesized; and the expression and application of the gene fragment are provided. Peste des petits ruminants antigenic epitope vaccine is safe and is easy to produce, store and use, and can be widely applied to the fields of genetic engineering.

Description

PPR virus H, F proteantigen epitope gene fragment and expression thereof, application

Technical field

The invention belongs to gene engineering technology field, be specifically related to a kind of PPR virus H, F proteantigen epitope gene fragment and expression thereof, application.

Background technology

PPR (Peste des Petits Ruminants; PPR) be by PPR virus (Peste des Petits Ruminants Virus; The transmissible disease of little ruminant animals such as a kind of serious harm goat that PPRV) causes, sheep also claims to ruminate for a short time beastly pseudo-rinderpest, catarrh, pneumoenteritis and mouthful pneumoenteritis syndromes; Goat height susceptible, sickness rate and case fatality rate are all higher.This disease is considered to one of crucial deadly infectious disease in the world, should disease also be classified as one type of zoonosis in China.Nineteen forty-two, PPR is in the news in the Cote d'lvoire in West Africa first, and in the coming years, most of country in Africa all reports this disease takes place.In recent years, PPR further spread, and fashion trend is increasingly serious.In in July, 2007 and in May, 2010, Ali area, China Tibet has taken place should disease, and China's animal health safety has been constituted serious threat.

At present, the anti-system of most countries PPR mainly depends on vaccine immunization in the world.Do not have the efficacious therapy method for the animal that has fallen ill, anti-animal excessively can obtain active immunity.PPRV and the RPV homology on gene is very high, generally all is in the past to adopt RPV tissue culture vaccine to come PPR is prevented epidemic.

Epiposition vaccine belongs to a kind of of subunit vaccine, and during epiposition vaccine, because the epi-position fragment is short, the expression product molecular weight is little in design, for insert the suitable immunostimulant factor carry out that coexpression provides maybe.The most important thing is that there is not the problem of recombination, integration in epiposition vaccine.H albumen is a kind of gp on the PPRV, and a kind of fibre that constitutes virus surface is prominent.H albumen stimulates body to produce neutralizing antibody, participates in the body fluid protective immunity.Researchs such as Makoto Sugiyama show, are the important structural protein of PPRV, and it mainly comprises two neutrality epitope area I and II.F albumen is that a kind of fibre on the PPRV virus surface is prominent, and can decision virus successfully infect, and can induce BAs such as producing cell hemolysin, cytogamy, startup virus infected cell.H, F albumen all are the main protective antigens of PPRV.

Up to now, though the several times innovation of PPR production of vaccine technology, malicious seedling a little less than widely used being still; Though the meliority of dna vaccination, recombiant vaccine etc. and the achievement that is obtained have caused extensive concern; But the history of research is shorter, not deep enough after all, in practical application, inevitably has a lot of problems; Like the safety issue of application, immunotolerance problem etc., these all are that epiposition vaccine has problem to be solved.

Summary of the invention

In order to solve the deficiency that prior art exists; The present invention provides a kind of PPR virus H, F proteantigen epitope gene fragment; The design parallel-series 10 B cell antigen epi-positions and Universal T-cell epitopes of F, H gene; With flexible glycocoll at interval, and in prokaryotic system, express between each epi-position, can be used for the PPR virus new generation vaccine.

Its technical scheme is:

F, H Argine Monohydrochloride sequence according to PPRV Nigeria 75/1 strain predict the outcome at forecasting software Bcepred; The wetting ability of analysis-by-synthesis F, H protein, accessibility, beta corner etc., the F that dopes at last, H protein 10 bar B cell antigen epi-position aminoacid sequence are seen shown in the table 1.

Table 1

Each epitope of prediction screening is connected with flexible amino acid fragment; Add the general helper T cell epi-position of an external source PADRE again; Derive nucleotide sequence according to the epitope aminoacid sequence,, and add the TAA terminator codon endways at 5 of series connection epi-position aminoacid sequence ' add BamH I and Xho I restriction enzyme site respectively with 3 ' end; Having synthesized length is the target gene fragment of 456bp, and said epitope aminoacid sequence is (underscore partly is the glycocoll joint):

TKDVLTPLFKI GGGGGTGCLGRT GGGGDYRSCLL GGGGTVEKLYLSSHR GGGGSSYFYPV

RLN GGGGILAVQGVQDY GGGGTSCVFTPE GGGGPDKLLTVI GGGGYPDSVYLHEIDL GGG

GKSYVRSL GGGG?AKFVAAWTLKAAA

The said nucleotides sequence of deriving is classified (underscore partly is respectively BamH I and Xho I restriction enzyme site) as:

GGATCCATGACTAAGGATGTCTTAACTCCCCTGTTTAAAATCGGTGGTGGAGGTGGGAC

AGGCTGTCTCGGCAGGACAGGGGGCGGGGGTGACTATCGGAGCTGTCTTTTAGGCGGT

GGAGGAACGGTGGAGAAACTCTATTTATCCTCACATAGGGGAGGGGGTGGATCATCTTA

CTTCTACCCAGTCCGATTGAATGGCGGGGGCGGAATACTGGCGGTACAGGGCGTCCAA

GACTATGGGGGCGGTGGAACGTCATGCGTCTTCACTCCAGAGGGAGGTGGCGGGCCTG

ATAAACTACTAACTGTTATAGGTGGGGGTGGTTACCCAGATTCTGTATACCTACATGAAA

TAGACTTAGGGGGTGGGGGCAAGTCGTACGTGAGATCACTGGGTGGTGGGGGGGCCA

AGTTCGTGGCTGCCTGGACCCTGAAGGCTGCCGCTTAATAACTCGAG

A kind of PPR virus H, the segmental purifying expression method of F proteantigen epitope gene:

The structure of expression vector:

Synthetic antigen epitope genes, PET30a (+) carrier with BamH I and Xho I double digestion, are reclaimed endonuclease bamhi, connect; Make up PET30a (+) expression vector, connect product and transform DH5a, picking list colony inoculation LB liquid nutrient medium; Amplification, purifying and recovering plasmid also carry out enzyme and cut the positive recombinant chou of evaluation and screening; Through order-checking, confirm that reading frame is correct, recombinant plasmid called after PET30a-BW;

The abduction delivering of recombinant protein:

The correct recombinant plasmid transformed bacterium of order-checking is seeded to the LB nutrient solution that contains that penicillium mould of card, and 37 ℃ of shaking culture are to nutrient solution OD ₆₀₀When reaching 0.6-0.8, adding final concentration is the IPTG of 0.2mol/L～1.0mol/L, 37 ℃ of abduction delivering 2h～8h; Induce finish back 4 ℃, the centrifugal collection thalline of 12000r/min; Behind the multigelation 3 times in the ice bath ultrasonic disruption handle 10-15min, make thalline all broken as far as possible, the bacterium liquid that ultrasonication is good can become rarer from thickness; 4 ℃ afterwards, 12000r/min are centrifugal; Collect respectively and go up cleer and peaceful deposition, deposition is with the PBS dissolving that contains 8M urea, the last above-mentioned collection component of SDS-PAGE electrophoretic analysis;

The purifying of inclusion body form recombinant protein:

The reorganization bacterium 200 μ L that the expression amount of picking out is high are inoculated in the 20mL Kan/LB liquid medium, and 37 ℃, 230r/min shaking culture 10-12h;

Get the 6mL overnight culture and insert in the 600mL Kan/LB nutrient solution, 37 ℃, in the 2L Erlenmeyer flask in the about 2h to OD of shaking culture _600nm=0.6～0.8;

Adding IPTG is 1mmol/L to final concentration, and 37 ℃ are continued inducing culture 8h;

The bacteria-induction culture in 4 ℃ with the centrifugal 15min of 3500r/min, abandon supernatant, collect bacterial sediment; Thalline is washed 3 times with PBS, at every turn with 4 ℃, the centrifugal 20min of 3500r/min; Be resuspended in afterwards in the PBS damping fluid of 15mL, multigelation 3 times is to the thalline thickness;

Ultrasonic degradation bacterial sediment in 4 ℃ of ice baths is treated ultrasonic end back in 4 ℃, the centrifugal collection inclusion body of 6000rpm/20min;

DOC 30ml (solutionA preparation) mixing of adding 0.2%, room temperature leaves standstill 30min, and 4 ℃, 9000-10000rpm * 20min centrifugal collecting precipitation inclusion body;

It is centrifugal that DOC 30ml with 0.2% cleans inclusion body 7500rpm * 20min once more;

DOC 30ml with 2% (solutionA preparation) mixing inclusion body, room temperature leaves standstill 30min; 4 ℃ of 9000-10000rpm * 20min centrifugal collecting precipitation inclusion bodys;

With the SKL of solutionA preparation 0.9%, room temperature dissolving inclusion body 1.5-2h; 4 ℃ of 7500rpm * 20min are centrifugal, collect supernatant;

Nickel sepharose FF adorns post, and column volume is about 10mL;

The damping fluid 1 balance pillar that adds at least 5 column volumes, flow velocity 1ml/min;

0.45 μ m filter treatment inclusion body sample with the filler mixing, is put into 2～3h on the shaking table;

The packing samples of mixing is refunded in the post,, leave standstill, natural subsidence is then opened switch, emits stream and wears liquid;

Wash 2～5 column volumes again with damping fluid 1, flow velocity is 1mL/min;

Be respectively 100mmol/L, 200mmol/L, 300mmol/L elution buffer wash-out with imidazole concentration, after 15min is respectively left standstill in the centre, carry out the albumen wash-out; Collect each stepwise elution peak, detect the molecular weight size and the purity of fusion rotein with SDS-PAGE;

With the damping fluid 1 wash-out pillar of 5 column volumes, after 20% the Ethanol Treatment, take out filler, 4 ℃ of preservations.

Further preferred, said induction time is 8h.

Further preferred, said IPTG concentration is 1.0mmol/L.

Further preferred, said imidazole concentration is respectively 100mmol/L.

PPR virus H of the present invention, the application of F proteantigen epitope gene fragment in preparation PPR epitope vaccine.

Beneficial effect of the present invention:

1. the H and proteic 10 the epitope peptide sections of F of prediction have been synthesized in manual work of the present invention; Use indirect ELISA method its biological function has been carried out preliminary evaluation; The result shows these 10 polypeptide all ability and PPR positive serum generation specific reaction, has good reactionogenicity.

2. glutaraldehyde method is with 10 epitope peptide sections and carrier B SA coupling, mixed immunity new zealand white rabbit.Detect the antibody that resists each synthetic polypeptide in the immune serum with indirect ELISA, the antibody except the equal ability of other 9 antigen epitope polypeptides of H4 inducing producing specificity has good immunogenicity; And polypeptide immune serum can produce specific reaction to 75/1 poison, and antibody titers can reach 1: 1600; Show with experiment in the serum that this antiserum(antisera) can induce laboratory animal to produce neutralizing antibody, has the effect of neutralization virus.

4.H, proteic 10 the B cell antigen epi-positions series connection of F; Add an external source Universal T-cell epitopes; With glycocoll at interval, synthetic is the epitope coding gene sequence more than one between the epi-position, makes up prokaryotic expression carrier pET30a (+); It is the expressing protein of 19kD that successful expression has obtained molecular weight, and ELISA and Western result show that this albumen can infect positive serum generation specific immune response with PPRV.

5. PPR virus H of the present invention, F proteantigen epitope gene fragment not only have sound response originality but also have good immunogenicity.

6. PPR epitope vaccine safety of the present invention, be easy to produce, be convenient to storage and use.

Description of drawings

Fig. 1 is SDS electrophoresis evaluation figure after the polypeptide coupling according to the invention;

Fig. 2 is that recombinant plasmid PET30a-BW enzyme according to the invention is cut qualification result figure, and wherein 1: recombinant plasmid PET30a-BW enzyme is cut the result, the M:DNA molecular weight standard;

Fig. 3 is recombinant protein prokaryotic expression figure according to the invention, wherein 1: the PET30a-BW of abduction delivering not; The PET30a-BW of 2,3 abduction deliverings, M: protein molecule quality standard;

Fig. 4 is the influence figure of induction time according to the invention to the recombinant protein expression amount, wherein M: protein Marker; 2-6: induce the back sample, induction time 2,4,6,8,10; 1: do not induce sample;

Fig. 5 is the influence figure of IPTG concentration of the present invention to the recombinant protein expression amount, wherein M: protein Marker; 1: do not induce sample; 2-6: induce the back sample, the IPTG final concentration is respectively 0.2,0.4,0.6,0.8,1.0mmol/L;

Fig. 6 is recombinant protein soluble analysis figure according to the invention, wherein M: protein Marker; 1: inductive pET-30a (+) does not precipitate; 2: inductive recombinant expression plasmid supernatant; 3: inductive recombinant expression plasmid deposition;

Fig. 7 is the SDS-PAGE analysis behind the expression product purifying according to the invention, wherein M. protein molecule quality standard; 1,2:100mM imidazoles elutriant;

Fig. 8 is the immunoblotting assay figure of expression product according to the invention, wherein M: protein Marker; 1,2: the positive serum immunoblotting;

Fig. 9 is the ELISA reaction result figure of recombinant protein according to the invention and positive serum.

Embodiment

Below in conjunction with accompanying drawing and embodiment the present invention is done explanation in further detail.

Its technical scheme is:

F, H Argine Monohydrochloride sequence according to PPRV Nigeria 75/1 strain predict the outcome at forecasting software Bcepred; The wetting ability of analysis-by-synthesis F, H protein, accessibility, beta corner etc., the F that dopes at last, H protein 10 bar B cell antigen epi-position aminoacid sequence are seen shown in the table 1.

Each epitope of prediction screening is connected with flexible amino acid fragment; Add the general helper T cell epi-position of an external source PADRE again; Derive nucleotide sequence according to the epitope aminoacid sequence,, and add the TAA terminator codon endways at 5 of series connection epi-position aminoacid sequence ' add BamH I and Xho I restriction enzyme site respectively with 3 ' end; Having synthesized length is the target gene fragment of 456bp, and said epitope aminoacid sequence is (underscore partly is the glycocoll joint):

TKDVLTPLFKI GGGGGTGCLGRT GGGGDYRSCLL GGGGTVEKLYLSSHR GGGGSSYFYPV

RLN GGGGILAVQGVQDY GGGGTSCVFTPE GGGGPDKLLTVI GGGGYPDSVYLHEIDL GGG

GKSYVRSL GGGGAKFVAAWTLKAAA

The said nucleotides sequence of deriving is classified (underscore partly is respectively BamH I and Xho I restriction enzyme site) as:

GGATCCATGACTAAGGATGTCTTAACTCCCCTGTTTAAAATCGGTGGTGGAGGTGGGAC

AGGCTGTCTCGGCAGGACAGGGGGCGGGGGTGACTATCGGAGCTGTCTTTTAGGCGGT

GGAGGAACGGTGGAGAAACTCTATTTATCCTCACATAGGGGAGGGGGTGGATCATCTTA

CTTCTACCCAGTCCGATTGAATGGCGGGGGCGGAATACTGGCGGTACAGGGCGTCCAA

GACTATGGGGGCGGTGGAACGTCATGCGTCTTCACTCCAGAGGGAGGTGGCGGGCCTG

ATAAACTACTAACTGTTATAGGTGGGGGTGGTTACCCAGATTCTGTATACCTACATGAAA

TAGACTTAGGGGGTGGGGGCAAGTCGTACGTGAGATCACTGGGTGGTGGGGGGGCCA

AGTTCGTGGCTGCCTGGACCCTGAAGGCTGCCGCTTAATAA CTCGAG

A kind of PPR virus H, the segmental purifying expression method of F proteantigen epitope gene:

The structure of expression vector:

Synthetic antigen epitope genes, PET30a (+) carrier with BamH I and Xho I double digestion, are reclaimed endonuclease bamhi, connect; Make up PET30a (+) expression vector, connect product and transform DH5a, picking list colony inoculation LB liquid nutrient medium; Amplification, purifying and recovering plasmid also carry out enzyme and cut the positive recombinant chou of evaluation and screening; Through order-checking, confirm that reading frame is correct, recombinant plasmid called after PET30a-BW;

The abduction delivering of recombinant protein:

The correct recombinant plasmid transformed bacterium of order-checking is seeded to the LB nutrient solution that contains that penicillium mould of card, and 37 ℃ of shaking culture are to nutrient solution OD ₆₀₀When reaching 0.6-0.8, adding final concentration is the IPTG of 0.2mol/L～1.0mol/L, 37 ℃ of abduction delivering 2h～8h; Induce finish back 4 ℃, the centrifugal collection thalline of 12000r/min; Behind the multigelation 3 times in the ice bath ultrasonic disruption handle 10-15min, make thalline all broken as far as possible, the bacterium liquid that ultrasonication is good can become rarer from thickness; 4 ℃ afterwards, 12000r/min are centrifugal; Collect respectively and go up cleer and peaceful deposition, deposition is with the PBS dissolving that contains 8M urea, the last above-mentioned collection component of SDS-PAGE electrophoretic analysis;

The purifying of inclusion body form recombinant protein:

The reorganization bacterium 200 μ L that the expression amount of picking out is high are inoculated in the 20mL Kan/LB liquid medium, and 37 ℃, 230r/min shaking culture 10-12h;

Get the 6mL overnight culture and insert in the 600mL Kan/LB nutrient solution, 37 ℃, in the 2L Erlenmeyer flask in the about 2h to OD of shaking culture _600nm=0.6～0.8;

Adding IPTG is 1mmol/L to final concentration, and 37 ℃ are continued inducing culture 8h;

The bacteria-induction culture in 4 ℃ with the centrifugal 15min of 3500r/min, abandon supernatant, collect bacterial sediment; Thalline is washed 3 times with PBS, at every turn with 4 ℃, the centrifugal 20min of 3500r/min; Be resuspended in afterwards in the PBS damping fluid of 15mL, multigelation 3 times is to the thalline thickness;

Ultrasonic degradation bacterial sediment in 4 ℃ of ice baths is treated ultrasonic end back in 4 ℃, the centrifugal collection inclusion body of 6000rpm/20min;

DOC 30ml (solutionA preparation) mixing of adding 0.2%, room temperature leaves standstill 30min, and 4 ℃, 9000-10000rpm * 20min centrifugal collecting precipitation inclusion body;

It is centrifugal that DOC 30ml with 0.2% cleans inclusion body 7500rpm * 20min once more;

DOC 30ml with 2% (solutionA preparation) mixing inclusion body, room temperature leaves standstill 30min; 4 ℃ of 9000-10000rpm * 20min centrifugal collecting precipitation inclusion bodys;

With the SKL of solutionA preparation 0.9%, room temperature dissolving inclusion body 1.5-2h; 4 ℃ of 7500rpm * 20min are centrifugal, collect supernatant;

Nickel sepharose FF adorns post, and column volume is about 10mL;

The damping fluid 1 balance pillar that adds at least 5 column volumes, flow velocity 1ml/min;

0.45 μ m filter treatment inclusion body sample with the filler mixing, is put into 2～3h on the shaking table;

The packing samples of mixing is refunded in the post,, leave standstill, natural subsidence is then opened switch, emits stream and wears liquid;

Wash 2～5 column volumes again with damping fluid 1, flow velocity is 1mL/min;

Be respectively 100mmol/L, 200mmol/L, 300mmol/L elution buffer wash-out with imidazole concentration, after 15min is respectively left standstill in the centre, carry out the albumen wash-out; Collect each stepwise elution peak, detect the molecular weight size and the purity of fusion rotein with SDS-PAGE;

With the damping fluid 1 wash-out pillar of 5 column volumes, after 20% the Ethanol Treatment, take out filler, 4 ℃ of preservations.

Further preferred, said induction time is 8h.

Further preferred, said IPTG concentration is 1.0mmol/L.

Further preferred, said imidazole concentration is respectively 100mmol/L.

PPR virus H of the present invention, the application of F proteantigen epitope gene fragment in preparation PPR epitope vaccine.

Main agents

Bovine serum albumin (BSA), isinglass, the goat-anti rabbit two of HRP mark is anti-, Freund's complete adjuvant and Freund are U.S. Sigma Company products; DMEM, foetal calf serum are U.S. Gibco Company products.

50% LUTARALDEHYDE, Lys pressed powder are given birth to the worker available from Shanghai;

TMB is the Promega Company products;

The anti-PPRV Nigeria 75/1 strain polyclonal antibody of rabbit is preserved by this prepared in laboratory.

Restriction endonuclease BamH I, Xho I, T4DNA ligase enzyme, the little extraction reagent kit of plasmid, dna gel reclaim test kit available from OMIGA company;

DNA Marker, Protein marker, available from full formula gold biotechnology Services Co., Ltd;

Nickel sepharose FF is available from the rich favour chromatogram Science and Technology Ltd. of Beijing Webster;

Bacterial classification and carrier

E.coli DH5 α, BL21 are preserved by this laboratory; PET30a (+) is given by doctor Zhai Junjun.

Laboratory animal

2-3 monthly age new zealand white rabbit is provided by Lanzhou veterinary institute Experimental Animal Center.

Main consumptive material and instrument

96 hole enzyme linked immunological suction discs, 96 porocyte culture plates (Nunc, the U.S.)

CO2gas incubator (SANYO, Japan)

Ultraviolet gel imaging appearance (Syngene, the U.S.)

Inverted microscope (optical instrument factory, XS2-D Chongqing)

DYY-31A type voltage stabilization and current stabilization electrophoresis apparatus (Beijing Liu Yichang)

Electro-heating standing-temperature cultivator (DNP-9272 type, the grand experimental installation of last Nereid ltd)

Bechtop (safe and sound company of Su Jing group)

Gel Cheng Xiangyi (SYNGENE): ADIVISION OF SYNOPTICS LTD;

Ice-making machine (Scotsman, the U.S.).

Main solution and preparation preparation

Encapsulate damping fluid (CBS)

NaHCO ₃2.9g, Na ₂CO ₃1.5g, add distilled water and be settled to 1000ml, transfer pH to 9.6,4 ℃ of preservations are subsequent use.

Phosphate buffered saline buffer (PBS) and washings (PBST)

Take by weighing KH ₂PO40.2g, KCl 0.2g, Na ₂HPO ₄-12H ₂O 2.93g, NaCI 80g add deionized water to IO00ml, and packing 100ml/ bottle, 4 ℃ of preservations.In phosphate buffered saline buffer, add 0.5% Tween-20, washings.

Sample diluting liquid

Taking by weighing 0.1g bovine serum albumin (BSA) joins among the PBS of 100ml0.01mol/LpH7.4.

Confining liquid

Take by weighing import isinglass 0.8g and add PBS to 100ml, 37 ℃ of water-baths can be used to dissolving fully.

Stop buffer (the H of 2mol/L ₂SO ₄)

Measure the 711ml deionized water, dropwise add the 89ml vitriol oil (98%), room temperature preservation behind the mixing.

0.2% glutaraldehyde solution

0.01mol/LpH7.4 PBS 100ml

50% LUTARALDEHYDE, 40 μ L

The Lys solution of 1mol/L

The Lys pressed powder that takes by weighing 146.19mg joins in the 1ml deionized water, 4 ℃ of preservations behind the mixing.

The used main agents of polyacrylamide gel electrophoresis

The Tris-damping fluid: Tris Base 1.5g, glycocoll 9.4g, SDS 0.5g are dissolved in the 500mL deionized water.

2 * SDS-PAGE sample-loading buffer: 100mmol/L Tris-HCl pH8.0,4%SDS, 0.2% bromjophenol blue, 20% glycerine, 200mmol/L mercaptoethanol, concussion is to mixing 4 ℃ of preservations.

Coomassie brilliant blue staining liquid: take by weighing the 0.25g Coomassie brilliant blue and be dissolved in 45mL methyl alcohol, 10mL Glacial acetic acid min. 99.5, the 45mL water.

Destainer: measure methyl alcohol 150mL, glacial acetic acid 50mL, zero(ppm) water 300mL is destainer after mixing.

Protein transfer printing agents useful for same

Transfering buffering liquid: take by weighing 2.9g glycocoll, 5.8g Tris base, 0.37g SDS, and add 200mL methyl alcohol, adding distil water is to TV 1000mL.

PBS and PBST see 2.1.4.

Confining liquid: contain the PBS of 3%BSA, measure PBS 50mL, the ratio in 3% adds 1.5g BSA (bovine serum albumin), mixing.

The DAB liquid that develops the color: take by weighing diaminobenzidine (DAB) 25mg and NSC 51149 15mg, add contain 0.5% tween 20 PBS (pH 7.2) to 50mL, add 30.0% hydrogen peroxide, 50 μ L in use.

Washing inclusion body and protein purification are used solution

The used main solution of washing inclusion body:

SolutionA:50mM Tris-HCl, 0.5mM EDTA, 5% glycerine, 50mM NaCl 0.2mMDTT

The used damping fluid of nickel sepharose FF purifying band His label reorganization inclusion body protein is formed: specifically see product description.

TP

The prediction of PPRV-F protein B cell antigen epitope

With epitope forecasting software Bcepred, this proteic wetting ability of analysis-by-synthesis, accessibility, beta corner etc. are predicted its B cell antigen epi-position at last with the proteic aminoacid sequence of F of PPRV Nigeria 75/1 strain.

The prediction of PPRV-H protein B cell antigen epitope

The proteic aminoacid sequence of H of PPRV Nigeria 75/1 strain is analyzed with Bcepred software equally, and this proteic wetting ability of analysis-by-synthesis, accessibility, beta corner etc. are predicted its B cell antigen epi-position.

Synthesizing of epitope

Send GeneScript company synthetic 10 epitope aminoacid sequences and 1 irrelevant peptide sequence of software screening prediction with Peptide synthesizer; (high performance liquid chromatography HPLC) analyzes polypeptide synthetic purity and amino acid whose exactness with performance liquid chromatography in synthetic back.

Indirect ELISA detects the antigenicity of synthetic epitope peptide section

The indirect ELISA schedule of operation is following:

1. encapsulate: using the damping fluid that encapsulates of pH9.6 is 2 μ g/100 μ L with the purifying protein dilution, encapsulates the ELISA Sptting plate with 10 epitope peptide sections and 1 irrelevant peptide section respectively, and 4 ℃ are spent the night.

2. washing: take out antigen coated ELISA Sptting plate, outwell coating buffer, PBST washes plate 3 times

3. sealing: in the micro-reaction hole, add confining liquid, every hole adds confining liquid 100 μ L, 37 ℃ of effect 2h;

4. application of sample: discard confining liquid, PBST washing 3 times is clapped and is done, and negative serum, positive serum are done 1: 200 times of dilution respectively, adds the micro-reaction hole, every hole 100 μ L, 37 ℃ of effect 60min.

5. the goat-anti rabbit ELIAS secondary antibody that adds the HRP mark: take out micro-reaction plate, liquid in the hole of inclining, PBST washing 3 times is clapped and is done, and every then hole adds the good ELIAS secondary antibody 100 μ L of dilution in 1: 15000,37 ℃ of effect 60min.

6. colour developing: take out Sptting plate, liquid in the hole of inclining is washed 3 times with PBST, claps and does, and every then hole adds 100 μ L substrate TMB colour developing, puts 37 ℃ of colour developing 5min in the magazine.

7. every hole 50 μ L stop buffer termination reactions detect each hole OD with enzyme mark detector _450nmValue.

Polypeptide and BSA coupling

Adopt glutaraldehyde method to carry out coupling, the concrete operations step is following:

1. first water is diluted to 1mg/ml with polypeptide;

2. take by weighing 2mg carrier B SA and be dissolved in the PBS damping fluid of 2ml0.01mol/L Ph7.4, in the PBS damping fluid, stir dialysed overnight under the room temperature;

3. will dilute good polypeptide taking-up 1ml and join in the carrier soln of 2ml, the limit edged stirs, and in above-mentioned mixed solution, drips the glutaraldehyde solution of 1ml0.2%, and the limit edged stirs.

4. stir under the room temperature after 4 hours, in above-mentioned mixed solution, add the Lys solution of 120 μ l1mol/L, continue to stir 1 hour, make it termination reaction;

5. last, above-mentioned mixed solution is packed in the dialysis tubing, with 4 ℃ of dialysed overnight of PBS liquid; With the packing of peptide carrier coupling liquid ,-20 ℃ of preservations.

6. the protein product after the coupling carries out the evaluation of SDS-PAGE electrophoresis.

The polypeptide immune animal

With the antigen epitope polypeptide balanced mix after 10 couplings.Select 6 healthy rabbits, be divided into 3 groups at random, one group two.3 groups are respectively mixing epitope peptide, BSA contrast and blank negative control.Use for the first time Freund's complete adjuvant, use Freund's incomplete adjuvant for the second time, do not add adjuvant for the last time, immune pure protein, immunizing dose is 1.0mg/, whenever once at a distance from immunity in 14 days, 3 immunity back 2 all heart blood samplings, collection serum.

Indirect ELISA detects the antibody of immunize rabbit serum to each polypeptide

Schedule of operation is following:

1. encapsulate: with coating buffer 10 epitope peptides and irrelevant polypeptide are diluted to 20 μ g/mL, and get 100 μ L and encapsulate the ELISA batten, put under 4 ℃ and spend the night.

2. washing: take out antigen coated micro-reaction plate, liquid in the hole of inclining with PBST washing 3 times, and is all clapped the dry reaction plate at every turn;

3. sealing: in the micro-reaction hole, add confining liquid, every hole 100 μ L, 37 ℃ of effect 60min;

4. application of sample: take out the good micro-reaction plate of sealing, discard confining liquid,, clap and do, three kinds of serum are done 1: 100 times of dilution respectively, add the micro-reaction hole, every hole 100 μ L, 37 ℃ of effect 60min with PBST washing 3 times.

5. the goat-anti rabbit ELIAS secondary antibody that adds the HRP mark: take out micro-reaction plate, liquid in the hole of inclining, PBST washing 3 times is clapped and is done, and adds the good ELIAS secondary antibody of dilution then, every hole 100 μ L, 37 ℃ of effect 60min.

6. colour developing: take out micro-reaction plate, liquid in the hole of inclining, PBST washing 3 times is clapped and is done, and adds substrate TMB colour developing then, and 37 ℃ of colour developing 5min in the magazine with the stop buffer termination reaction, measure the OD value with ELIASA at the 450nm place.

ELISA detects the antibody titers to PPRV Nigeria 75/1 virus strain

, get every hole 100 μ L and encapsulate the ELISA Sptting plate 1: 50 times of dilution of PPRV Nigeria 75/1 venom with coating buffer, put under 4 ℃ and spend the night.PBST washing 3 times; 37 ℃ of sealings of gelatin with 0.8% 1h; The various antiserum(antisera)s that add 1: 100,1: 200,1: 400,1: 800,1: 1600 serial dilution, 37 ℃ hatch 1h.PBST PBST washing 3 times after, add the goat anti-rabbit igg of HRP mark; Hatch TMB colour developing after the 1h.PBST washing 4 times for 37 ℃, 450nm place surveys OD value .450nm place's survey OD value.

In the serum and the experiment

Specified operational procedure is following:

1. will measure TCID ₅₀Viral liquid be diluted to 100 TCID ₅₀Viral suspension.

2. in 96 hole microtest plates, the antiserum(antisera) after the mixed polypeptide immunity (56 ℃ of deactivation 30min in advance) was made continuous doubling dilution up to 1: 256 since 1: 2, each extent of dilution is done 5 holes.

3. in above-mentioned each hole, add the good viral liquid of 50 μ l dilution, put into 37 ℃ of 5%CO behind the mixing ₂Act on 60min in the incubator.Establish the contrast of positive and negative serum simultaneously, virus control and normal cell contrast, wherein virus control will be made 200 TCID ₅₀, 20 TCID ₅₀, 2 TCID ₅₀, 0.2 TCID ₅₀The contrast of 4 different concns.

4. every hole added 100 μ l cell suspensions (Vero) after sense was done to accomplish, and put 37 ℃ of 5%CO ₂Incubator is cultivated, and observes and write down the result day by day, observes 5-7 days.

The result

The prediction of epitope and polypeptide are synthetic

F, H Argine Monohydrochloride sequence according to PPRV Nigeria 75/1 strain predict the outcome at forecasting software Bcepred; The wetting ability of analysis-by-synthesis F, H protein, accessibility, beta corner etc., the F that dopes at last, H protein 10 bar B cell antigen epi-position aminoacid sequence are seen shown in the table 1.

Through efficient liquid phase chromatographic analysis, synthetic polypeptide purity all >=85%; Each amino acid whose ratio and expection is consistent in the polypeptide, explains that polypeptide is synthetic correct.

The antigenicity of synthetic polypeptide

Table 2

10 polypeptide of OD value analysis revealed in the table 2 all can react with the PPRV positive serum, and OD value significance is higher than irrelevant polypeptide, and OD _Male/female＞2, show to have good antigenicity.

The coupling of polypeptide

The SDS-PAGE electrophoresis result shows 10 polypeptide all success and BSA coupling, and the result sees Fig. 1.ELISA detects the specific antibody to each polypeptide

Behind hybrid antigen epitope peptide immune rabbit, detect the antibody of anti-each synthetic polypeptide in the immune serum with indirect ELISA.Is contrast with the BSA immune serum with normal negative serum.The result is as shown in table 3 except H ₄The reactivity of other 9 polypeptide and mixed polypeptide immune serum is significantly higher than irrelevant polypeptide, and OD _Polypeptide/ OD _BSA＞2, and OD _Positive/ OD _Negative＞2, interpretation of result shows except H ₄Other 9 antigen epitope polypeptides are the antibody of ability inducing producing specificity all, has good immunogenicity.

Table 3

ELISA detects to 75/1 malicious antibody titers

Immune serum is as shown in table 4 to the specific antibody that 75/1 venom produces, and the result shows that polypeptide immune serum can produce specific reaction to 75/1 poison, and antibody titers can reach 1: 1600

Table 4

In the serum and the experiment

Table 5

Show with experiment in table 5 serum that this antiserum(antisera) can induce laboratory animal to produce neutralizing antibody, has the effect of neutralization virus, explain inside these epitopes and have plenty of the neutrality epi-position.

The preparation of PPR standard positive serum

With PPRV Nigeria 75/1 strain immune health 6 the monthly age goat prepare the PPR positive serum, each 5000 TCID of subcutaneous vaccination ₅₀, 15d uses Freund's complete adjuvant for the first time at interval; Freund's incomplete adjuvant is used in second and third time; Use totivirus fourth, fifth time, five exempted from the back since the 10th day, blood sampling every three days; Indirect elisa method (envelope antigen is PPRV Nigeria75/1) is measured antibody titer, tests the sheep separation of serum extremely tiring to cut open when reaching mxm..

The structure of epitope recombinant prokaryotic expression vector

The acquisition of series connection antigen epitope genes

Each H that predicts, F epitope are connected with flexible glycocoll fragment; The general helper T cell epi-position of external source (PADRE) of connecting again; And 5 ' add BamH I and Xho I restriction enzyme site respectively with 3 ' end; Add the TAA terminator codon endways, it is synthetic that this series connection antigen epitope genes sequence that designs is served sea living worker biotech firm.

The enzyme switchback of purpose fragment and carrier is received

Prepare the endonuclease reaction system by following system:

Instantaneous centrifugal behind the mixing, put in 37 ℃ of thermostat water baths enzyme and cut 4h.65 ℃ of water-bath 5min deactivation restriction endonucleases.The electrophoresis detection enzyme is cut product, downcuts the purpose band, with the dna gel recovery test kit recovery purpose fragment and the carrier segments (concrete operation method is seen the test kit specification sheets) of OMEGA company, electrophoresis detection recovering state.

The purpose fragment is connected with expression vector

After getting the purpose fragment 5 μ L and pET-30a (+) carrier 1 μ L (50 μ g/ μ L) mixing of glue recovery, add 10 * ligase buffer, 2 μ L, T4DNA ligase enzyme 1 μ L (3U/ μ L), mending deionized water to final volume is 20 μ L, the rearmounted 4 ℃ of connections of mixing are spent the night.

Connect the conversion of product

1. after competent cell thaws, under aseptic condition, will connect product 20 μ L and all add in the competent cell, gentleness is shaken mixing, and ice bath is placed 30min.

2. mixture is placed 42 ℃ of water-bath heat shock 90s, immediately ice bath 5min.；

3. in the eppendorf pipe that bacterium liquid is housed, add the LB nutrient solution of 800 μ L preheatings, 37 ℃, the gentle vibration of 150r/min 1h make bacterium liquid recover resistance;

4. take out the eppendorf pipe, the centrifugal 5min of 5000r/min abandons supernatant, stays deposition.

5. in the bacterium liquid precipitate, add 50 μ L LB nutrient solutions, blow and beat mixing gently, evenly coat on the LB agar plate that contains Amp (100 μ g/mL).

6. plate is inverted observations after 37 ℃ of incubators are cultivated 12～16h.

The extraction of recombinant plasmid and evaluation

Alkaline lysis extracts plasmid in a small amount

See OMEGA test kit specification sheets.

The evaluation of recombinant plasmid

1. the enzyme of recombinant plasmid is cut evaluation: according to the described double digestion system of this chapter digested plasmid, enzyme is cut back agarose gel electrophoresis detection enzyme and is cut the result, uses blank plasmid as negative control simultaneously.

2. the order-checking of recombinant plasmid: preliminary enzyme cut be accredited as male bacterium liquid incubated overnight, send the order-checking of the precious biotech firm in Dalian.Sequencing result is analyzed positive recombinant plasmid called after PET30a-BW with softwares such as NCBI Blast to sequence.

The abduction delivering of recombinant protein

The correct recombinant plasmid transformed bacterium of order-checking is seeded to the LB nutrient solution that contains that penicillium mould of card, and 37 ℃ of shaking culture are to nutrient solution OD ₆₀₀When reaching 0.6-0.8, adding IPTG is 0.8mM to final concentration, 37 ℃ of abduction delivering 8h.Induce finish back 4 ℃, the centrifugal collection thalline of 12000r/min; Behind the multigelation 3 times in the ice bath ultrasonic disruption handle 10-15min; Make thalline as far as possible all broken, the bacterium liquid that ultrasonication is good can become rarer from thickness, and 4 ℃ afterwards, 12000r/min are centrifugal; Collect respectively and go up cleer and peaceful deposition, deposition is with the PBS dissolving that contains 8M urea.The last above-mentioned collection component of SDS-PAGE electrophoretic analysis.

The SDS-PAGE electrophoresis of expression product

Schedule of operation is described below: concrete grammar is seen the molecular cloning guide.

The optimization of expression of recombinant proteins condition

To confirm that the proteic bacterial classification of successful expression is transferred on the LB liquid nutrient medium that contains that penicillium mould of card (Kan), its expression condition will be optimized.In culture, add the inductor that final concentration is 0.2mol/L, 0.4mol/L, 0.6mol/L, 0.8mol/L, 1.0mol/L (IPTG) respectively; 37 ℃ of abduction deliverings; Simultaneously with 37 ℃ of difference abduction delivering 2h, 4h, 6h, 8h and 10h, to confirm to induce Best Times.Collect and the processing thalline according to the process of 3.2.3.6,, confirm the Best Times and the righttest IPTG concentration of abduction delivering through SDS-PAGE electrophoresis evaluating and optimizing effect.

The soluble analysis of recombinant protein

Get overnight culture, join in 1: 100 ratio (volume ratio) and contain in the kantlex LB nutrient solution, 37 ℃, 230r/min quick oscillation are cultured to OD ₆₀₀Value is 0.8 o'clock, and it is 1mmol/L that adding IPTG makes its final concentration, 37 ℃, 230r/min inducing culture 8h.Thick inoculum is centrifugal with inducing, and thalline is with PBS damping fluid washing 2 times, at every turn with 4 ℃; The centrifugal 20min of 4000r/min is resuspended in the PBS damping fluid afterwards, multigelation 3 times; Bacteria suspension places 4 ℃ of ice baths to carry out ultrasonic degradation; The back is in 4 ℃ fully in cracking, and the centrifugal 10min of 12000r/min collects respectively and goes up cleer and peaceful deposition.Get deposition, add 8mol/L urea cracking 1 hour, add appearance buffering on isopyknic 2 * protein electrophoresis again; Directly get supernatant, add the protein electrophoresis sample-loading buffer of equivalent, will precipitate and supernatant is put simultaneously and boiled 5min in the water-bath, respectively get 15 μ L and carry out the SDS-PAGE protein electrophoresis.

The purifying of inclusion body form recombinant protein

The collection of recombinant protein inclusion body expression-form

1. the expression amount of picking out is high reorganization bacterium 200 μ L are inoculated in the 20mL Kan/LB liquid medium, and 37 ℃, 230r/min shaking culture 10-12h.

2. get the 6mL overnight culture and insert in the 600mL Kan/LB nutrient solution, 37 ℃, in the 2L Erlenmeyer flask in the about 2h to OD of shaking culture _600nm=0.6～0.8.

3. adding IPTG is 1mmol/L to final concentration, and 37 ℃ are continued inducing culture 8h.

4. the bacteria-induction culture in 4 ℃ with the centrifugal 15min of 3500r/min, abandon supernatant, collect bacterial sediment; Thalline is washed 3 times with PBS, at every turn with 4 ℃, the centrifugal 20min of 3500r/min; Be resuspended in afterwards in the PBS damping fluid of 15mL, multigelation 3 times is to the thalline thickness.

5. ultrasonic degradation bacterial sediment in 4 ℃ of ice baths is treated ultrasonic end back in 4 ℃, the centrifugal collection inclusion body of 6000rpm/20min.

6. add 0.2% DOC 30ml (solutionA preparation) mixing, room temperature leaves standstill 30min, and 4 ℃, 9000-10000rpm * 20min centrifugal collecting precipitation inclusion body.

7. it is centrifugal to clean inclusion body 7500rpm * 20min once more with 0.2% DOC 30ml.

8. use 2% DOC 30ml (solutionA preparation) mixing inclusion body, room temperature leaves standstill 30min; 4 ℃ of 9000-10000rpm * 20min centrifugal collecting precipitation inclusion bodys.

9. with the SKL of solutionA preparation 0.9%, room temperature is dissolved inclusion body 1.5-2h; 4 ℃ of 7500rpm * 20min are centrifugal, collect supernatant.

The purifying of inclusion body form recombinant protein

Purification process is carried out in nickel sepharose FF purifying explanation according to the rich favour chromatogram Science and Technology Ltd. of Beijing Webster, and concrete steps are following:

1. nickel sepharose FF adorns post, and column volume is about 10mL;

2. the damping fluid 1 balance pillar that adds at least 5 column volumes, flow velocity 1ml/min;

3. 0.45 μ m filter treatment inclusion body sample with the filler mixing, is put on the shaking table 2～3h;

4. the packing samples of mixing is refunded in the post, leave standstill, natural subsidence is then opened switch, emits stream and wears liquid;

5. wash 2～5 column volumes again with damping fluid 1, flow velocity is 1mL/min;

6. be respectively 100m, 200m, 300m elution buffer wash-out with imidazole concentration, after 15min is respectively left standstill in the centre, carry out the albumen wash-out; Collect each stepwise elution peak, detect the molecular weight size and the purity of fusion rotein with SDS-PAGE;

6. use the damping fluid 1 wash-out pillar of 5 column volumes, after 20% the Ethanol Treatment, take out filler, 4 ℃ of preservations.The Western-blotting of expression product detects

Behind the SDS-PAGE electrophoresis expression product being carried out Western detects: one anti-be positive serum and the negative serum of sheep of the anti-PPR Nigeria75/1 of 1: 100 times of dilution; The ELIAS secondary antibody of the mouse anti goat of the horseradish peroxidase-labeled of 1: 2000 times of dilution develops the color with DAB.

Indirect ELISA detects the proteic reactivity of recombinant antigen epi-position

Purified recombinant albumen and H+F full-length proteins are diluted to 10ug/ml with the 0.05mol/L carbonate buffer solution, coated elisa plate, every hole 100uL, 4 ℃ are spent the night.Discard coating buffer, PBST washing 3 times, the gelatin sealing of adding 1%, every hole 100uL, 37 ℃ of sealing 1h.After the PBST washing, add respectively with the good yin and yang attribute serum of PBST dilution, every hole 100uL establishes blank simultaneously, 37 ℃ of effect 1h, PBST washing.Two of the anti-goat of adding HRPO mark resists, and every hole 1OOuL37 ℃ acts on 1 hour.After the PBST washing, every hole adds the 100uLTMB colour developing, and last every hole adds 50uL2mol/LH ₂SO ₄Stop, measure OD ₄₅₀Value.

The result

The preparation of PPR standard positive serum

As envelope antigen, detect PPRV standard positive serum that immune goat prepare with indirect ELISA method with PPRV Nigeria 75/1 virus, its antibody titer is 1: 12000, and this is the PPRV standard positive serum.

Synthesizing of antigen epitope genes

Synthetic sequencer address of gene and comparison diagram spectrum analysis show that manual work successfully synthesizes the target gene fragment that length is 456pb.

The structure of recombinant antigen epi-position expression vector

BamH I and Xho I double digestion Screening and Identification positive recombinant carry out 1% agarose gel electrophoresis, obtained with the expection about 456bp of the same size target gene fragment, see Fig. 2.The sequencing result nucleotide sequence is consistent with original design sequence, shows the construction of recombinant plasmid success.

The prokaryotic expression of recombinant antigen epitope gene

Recombinant plasmid transformed is expressed bacterium BL21, when being cultured to the OD value for 0.6-0.8, induces with IPTG, separates a protein band and white Marker contrast with SDS-PAGE after the cracking, and electrophoresis result shows that expressing protein is consistent with the expection size, sees Fig. 3.

The optimization of expression of recombinant proteins condition

Under different induction times, P albumen expression amount when 8h that the reorganization bacterium is expressed is maximum.Induce down at different concns IPTG, expression amount is maximum during 1.0mmol/L.Specifically see Fig. 4, Fig. 5.

The soluble analysis of recombinant protein

The abduction delivering thalline does not carry out the SDS-PAGE analysis revealed to last cleer and peaceful precipitation after cracking, specifically see Fig. 6, and expressing protein is present in the insoluble inclusion body deposition of thalline in a large number, has only in a spot of supernatant that is present in solubility content seldom.

The purifying of expressing protein

Inclusion body after expression product is handled is after the nickel sepharose is crossed column separating purification; To carry out SDS-PAGE with this elutriant of collecting analyzes; Result such as Fig. 7 show that target protein content is bigger in the elutriant when imidazole concentration is 100mmol/L, and band is single; Size is coincide with the target protein band, explains that purifying has obtained purer albumen.

The Western-Blot of recombinant protein analyzes

The expression product of purifying reacts with the PPR standard positive serum through transferring to behind the SDS-PAGE on the NC film, and the result shows have a specific band to occur in the residing position of target protein, specifically sees Fig. 8, explains that expressing protein has reactive behavior.

ELISA detects the reaction of recombinant protein and positive serum

Encapsulate the ELISA Sptting plate with PPR virus H+F full-length proteins and epitope recombinant protein respectively, package amount is the 1ug/ hole, and every kind of antigen is done two holes and repeated, and with each sero-reaction, serum is all done 1: 800 times of dilution, reads OD ₄₅₀, with the MV mapping, the result is as shown in Figure 9, and the reactivity of epitope recombinant protein is a little less than the reactivity of H+F total length, but OD _P/NGreater than 2, show that recombinant protein and positive serum also have good reactivity.

Claims (6)

1. a PPR virus H, F proteantigen epitope gene fragment; It is characterized in that; Each epitope of prediction screening is connected with flexible amino acid fragment, add the general helper T cell epi-position of an external source PADRE again, derive nucleotide sequence according to the epitope aminoacid sequence; At 5 of series connection epi-position aminoacid sequence ' add BamH I and Xho I restriction enzyme site respectively with 3 ' end; And add the TAA terminator codon endways, and having synthesized length is the target gene fragment of 456bp, said epitope aminoacid sequence is:

TKDVLTPLFKI GGGGGTGCLGRT GGGGDYRSCLL GGGGTVEKLYLSSHR GGGGSSYFYPV

RLN GGGGILAVQGVQDY GGGGTSCVFTPE GGGGPDKLLTVI GGGGYPDSVYLHEIDL GGG

GKSYVRSL GGGGAKFVAAWTLKAAA

The said nucleotides sequence of deriving is classified as:

GGATCCATGACTAAGGATGTCTTAACTCCCCTGTTTAAAATCGGTGGTGGAGGTGGGAC

AGGCTGTCTCGGCAGGACAGGGGGCGGGGGTGACTATCGGAGCTGTCTTTTAGGCCGGT

GGAGGAACGGTGGAGAAACTCTATTTATCCTCACATAGGGGAGGGGGTGGATCATCTTA

CTTCTACCCAGTCCGATTGAATGGCGGGGGCGGAATACTGGCGGTACAGGGCGTCCAA

GACTATGGGGGCGGTGGAACGTCATGCGTCTTCACTCCAGAGGGAGGTGGCGGGCCTG

ATAAACTACTAACTGTTATAGGTGGGGGTGGTTACCCAGATTCTGTATACCTACATGAAA

TAGACTTAGGGGGTGGGGGCAAGTCGTACGTGAGATCACTGGGTGGTGGGGGGGCCA

AGTTCGTGGCTGCCTGGACCCTGAAGGCTGCCGCTTAATAA CTCGAG。

2. the described PPR virus H of claim 1, the segmental purifying expression method of F proteantigen epitope gene is characterized in that,

The structure of expression vector:

Synthetic antigen epitope genes, PET30a (+) carrier with BamH I and Xho I double digestion, are reclaimed endonuclease bamhi, connect; Make up PET30a (+) expression vector, connect product and transform DH5a, picking list colony inoculation LB liquid nutrient medium; Amplification, purifying and recovering plasmid also carry out enzyme and cut the positive recombinant chou of evaluation and screening; Through order-checking, confirm that reading frame is correct, recombinant plasmid called after PET30a-BW;

The abduction delivering of recombinant protein:

The correct recombinant plasmid transformed bacterium of order-checking is seeded to the LB nutrient solution that contains that penicillium mould of card, and 37 ℃ of shaking culture are to nutrient solution OD ₆₀₀When reaching 0.6-0.8, adding final concentration is the IPTG of 0.2mol/L～1.0mol/L, 37 ℃ of abduction delivering 2h～8h; Induce finish back 4 ℃, the centrifugal collection thalline of 12000r/min; Behind the multigelation 3 times in the ice bath ultrasonic disruption handle 10-15min, make thalline all broken as far as possible, the bacterium liquid that ultrasonication is good can become rarer from thickness; 4 ℃ afterwards, 12000r/min are centrifugal; Collect respectively and go up cleer and peaceful deposition, deposition is with the PBS dissolving that contains 8M urea, the last above-mentioned collection component of SDS-PAGE electrophoretic analysis;

The purifying of inclusion body form recombinant protein:

The reorganization bacterium 200 μ L that the expression amount of picking out is high are inoculated in the 20mL Kan/LB liquid medium, and 37 ℃, 230r/min shaking culture 10-12h;

Get the 6mL overnight culture and insert in the 600mL Kan/LB nutrient solution, 37 ℃, in the 2L Erlenmeyer flask in the about 2h to OD of shaking culture _600nm=0.6～0.8;

Adding IPTG is 1mmol/L to final concentration, and 37 ℃ are continued inducing culture 8h;

The bacteria-induction culture in 4 ℃ with the centrifugal 15min of 3500r/min, abandon supernatant, collect bacterial sediment; Thalline is washed 3 times with PBS, at every turn with 4 ℃, the centrifugal 20min of 3500r/min; Be resuspended in afterwards in the PBS damping fluid of 15mL, multigelation 3 times is to the thalline thickness;

Ultrasonic degradation bacterial sediment in 4 ℃ of ice baths is treated ultrasonic end back in 4 ℃, the centrifugal collection inclusion body of 6000rpm/20min;

Add the DOC 30ml mixing of 0.2% usefulness solutionA preparation, room temperature leaves standstill 30min, and 4 ℃, 9000-10000rpm * 20min centrifugal collecting precipitation inclusion body;

It is centrifugal that DOC 30ml with 0.2% cleans inclusion body 7500rpm * 20min once more;

With 2% with solutionA preparation DOC 30ml mixing inclusion body, room temperature leaves standstill 30min; 4 ℃ of 9000-10000rpm * 20min centrifugal collecting precipitation inclusion bodys;

With the SKL of solutionA preparation 0.9%, room temperature dissolving inclusion body 1.5-2h; 4 ℃ of 7500rpm * 20min are centrifugal, collect supernatant;

Nickel sepharose FF adorns post, and column volume is about 10mL;

The damping fluid 1 balance pillar that adds at least 5 column volumes, flow velocity 1ml/min;

0.45 μ m filter treatment inclusion body sample with the filler mixing, is put into 2～3h on the shaking table;

The packing samples of mixing is refunded in the post,, leave standstill, natural subsidence is then opened switch, emits stream and wears liquid;

Wash 2～5 column volumes again with damping fluid 1, flow velocity is 1mL/min;

Be respectively 100mmol/L, 200mmol/L, 300mmol/L elution buffer wash-out with imidazole concentration, after 15min is respectively left standstill in the centre, carry out the albumen wash-out; Collect each stepwise elution peak, detect the molecular weight size and the purity of fusion rotein with SDS-PAGE;

With the damping fluid 1 wash-out pillar of 5 column volumes, after 20% the Ethanol Treatment, take out filler, 4 ℃ of preservations.

3. PPR virus H according to claim 2, the segmental purifying expression method of F proteantigen epitope gene is characterized in that said induction time is 8h.

4. PPR virus H according to claim 2, the segmental purifying expression method of F proteantigen epitope gene is characterized in that said IPTG concentration is 1.0mmol/L.

5. PPR virus H according to claim 2, the segmental purifying expression method of F proteantigen epitope gene is characterized in that said imidazole concentration is respectively 100mmol/L.

6. each described PPR virus H of claim 1-5, the application of F proteantigen epitope gene fragment in preparation PPR epitope vaccine.

Images