CN102558348B - Single-chain antibody for resisting influenza viruses, preparation method for single-chain antibody, application of single-chain antibody - Google Patents
Single-chain antibody for resisting influenza viruses, preparation method for single-chain antibody, application of single-chain antibody Download PDFInfo
- Publication number
- CN102558348B CN102558348B CN201210063870.4A CN201210063870A CN102558348B CN 102558348 B CN102558348 B CN 102558348B CN 201210063870 A CN201210063870 A CN 201210063870A CN 102558348 B CN102558348 B CN 102558348B
- Authority
- CN
- China
- Prior art keywords
- antibody
- chain antibody
- chain
- variable region
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The invention discloses a single-chain antibody ScFv for resisting influenza viruses, a preparation method for the single-chain antibody ScFv, application of the single-chain antibody ScFv, a gene for encoding the single-chain antibody ScFv, a carrier containing the gene, a host cell and the like. The single-chain antibody ScFv for resisting the influenza viruses is one of the following proteins: 1) a single-chain antibody formed by connecting a heavy chain variable region and a light chain variable region of the antibody through a linker peptide, wherein an amino acid sequence of the light chain variable region and an amino acid sequence of the heavy chain variable region are shown as SEQ ID NO.1 and SEQ ID NO.2 in a sequence table respectively; and 2) a derived antibody obtained by improving the single-chain antibody in step 1), wherein the improvement comprises the deletion, substitution or insertion of amino acid, and the derived antibody has the antibody activity of resisting H1N1 influenza viruses. The molecular weight of the single-chain antibody is about 27kD; and the single-chain antibody can specifically identify the H1N1 influenza viruses and block the combination of the viruses and natural serum. The single-chain antibody can be used for diagnosing, preventing, controlling and treating the infection of the H1N1 influenza viruses, or is used for antiviral breeding of transgenic animals.
Description
Technical field
The invention belongs to bioengineering field.The present invention relates to single-chain antibody ScFv of a kind of anti-H1N1 influenza virus and its preparation method and application, and the gene of this single-chain antibody of encoding, the carrier and the host cell etc. that contain this gene.
Background technology
A type influenza virus can infect various birds except the mankind, mammal as pig, the raw Mammals of horse and sea etc., cause Acute respiratory infectious disease, its popular greatly harm humans health also brings about great losses to world economy, is one of mass-sending disease being difficult to radical cure.According to the difference of hemagglutinin (Hemagglutinin, HA) and neuraminidase (Neuraminidase, NA) protein antigenicity, 16 kinds of hypotypes and 9 kinds of hypotypes are identified respectively up to now.At present from all parts of the world be in succession separated to from pig have H1N1 at least, the influenza virus of the tens of kinds of different blood serum subtypes such as H1N2, H1N7, H2N3, H3N2, H4N6, H5N1, H9N2, wherein contacting with performance clinical symptom is the most again H1N1 and H3N2.
In March, 2009, starting in the Mexican Influenza A H1N1 extremely whole world of rapid spread in a short time, end in August, 2010, including China, the whole world has 214 countries and regions reports to find " Influenza A H1N1 ", confirmed cases have 18449 people's death at least, have greatly the gesture that causes global flu outbreak, world economy and social stability have been caused to tremendous influence, diagnosis and the prevention of the research of antibody and related reagent to influenza has extremely important public hygienics meaning.Although influenza virus sub-strain is numerous, but its NP is relatively conservative, research shows, the virus strain that different hosts separates is found, NP gene is quite conservative, and amino acid difference is no more than at most 11%, has the specificity of type and kind, being the basis of classification and the diagnosis of influenza virus type, is also the important object that research virological immunology reacts and develops vaccine.M2 albumen in M gene coded protein is the conservative non-glycosylated transmembrane protein of the peculiar a kind of structure of A type influenza virus, and outer region amino acid sequence (1st～25) high conservative of the film of M2 albumen, and the function that the antiserum(antisera) of M2 albumen has inhibition influenza virus to copy, in addition viral hemagglutinin is relevant to Virus entry host cell, in its antibody capable, with viral infectivity, is feasible in theory using Antibody of Influenza gene as disease-resistant gene as seen.Find the antibody gene corresponding to these albumen of virus, be used for prevention, control and cure the infection of influenza virus, and these need screen fast and efficiently platform-the phage antibody library technique of expression specificity antibody and gene thereof.
In addition, the variable region gene of clonal antibody is also imported fertilised non-human eggs and is carried out germline conversion, cultivates the transgenic animal containing this kind of gene, will provide another new way for anti-virus infection breeding.The report of the disease-resistant transgenic mouse of the external existing variable region gene that turns antibody.Domesticly yet there are no similar research report, but the gene that utilizes phage antibody library technique to obtain fast antiviral single-chain antibody comes true already, Animal Transgenic Technology is also in development and improvement.As long as two kinds of technology are combined, be expected to the Anti-virus Disease Breeding animal of the variable region gene that obtains antibody.
In immunotherapy method, excessive because of heterology and molecular weight between the kind of antibody in addition, can cause host's defensive reaction, single-chain antibody ScFv can avoid an above-mentioned treatment difficult problem; ScFv is the minimum antibody fragment with complete antibody binding site, and size is 1/6 of complete antibody, has the following advantages: (1) has kept the specificity of antibody, has greatly reduced immunogenicity; (2) tissue penetration is strong, and molecular weight is little, easily enters the microcirculation of target entity, and in body, removes also very fast; (3) without FC section, can be used as oriented carrier, with enzyme or cytokine and medicine connection structure bifunctional antibody, be beneficial to treatment and diagnosis; (4) be easy to genetic manipulation and engineered a large amount of production; (5) can in multiple different protokaryon, eukaryotic expression system, express, as expression systems such as intestinal bacteria, yeast, plant, insect, mammalian cells.Therefore, anti-swine flu phage single-chain antibody technology has great theory significance and using value.
About the domestic report that has no of research of influenza virus single-chain antibody ScFv, inside and outside the applicant country of Patents, also have no report at present.
Summary of the invention
Therefore, the technical problem to be solved in the present invention is just to provide single-chain antibody of resisiting influenza virus and its preparation method and application.
The technical scheme that the present invention solves the problems of the technologies described above is as follows:
One of technical scheme of the present invention is: a kind of single-chain antibody of resisiting influenza virus, and it is one of following protein:
1) single-chain antibody being formed by connecting by joint peptide by antibody heavy chain variable region and variable region of light chain, wherein the aminoacid sequence of variable region of light chain and weight chain variable region amino acid sequence are respectively as shown in SEQ ID NO.1 in sequence table and SEQ ID NO.2;
2) as 1) as described in single-chain antibody through the derivative antibody that obtains of transformation, described transformation comprises amino acid whose disappearance, replacement or insertion, and this derivative antibody has the antibody activity of resisiting influenza virus.
Wherein, described joint peptide can be conventional.Preferably, described joint peptide is 15-20 the small peptide that amino acid condensation forms.Preferred, its aminoacid sequence is GGGGSGGGGSGGGGS.Antibody heavy chain variable region and variable region of light chain are connected and composed single-chain antibody by these 15 amino acid whose flexible links.
Two of technical scheme of the present invention is: the gene of the antibody described in coding.
Preferably, described gene is one of following gene:
1) nucleotide sequence of this genes encoding antibody chain variable region and variable region of heavy chain is respectively as shown in SEQ ID NO.3 in sequence table and SEQ ID NO.4;
2) the DNA sequence dna hybridization that the nucleotide sequence of this genes encoding antibody chain variable region and variable region of heavy chain can limit with SEQ ID NO.3 and SEQ ID NO.4 respectively under rigorous condition, and the protein of this genes encoding has the antibody activity of resisiting influenza virus.
Three of technical scheme of the present invention is: the expression vector that contains described gene.
Wherein, described expression vector can be the various carriers of this area routine, as long as can copy in host and stably express, any plasmid and carrier can be used.A key character of expression vector is conventionally to contain copy-point, promotor, marker gene and translational control element.As commercially available plasmid (in intestinal bacteria, suitable carrier has pLG338, pACYC184, pBR322, pUC18, pUC19, pKC30, pRep4, pHS1, pHS2, pMBL etc.), clay (pHZ132), phage or virus vector (retrovirus vector, adenovirus carrier) etc. described plasmid represent a fraction of may plasmid, other plasmids are that technician is known.Preferably pET28a plasmid.Can adopt method well known in the art to build the recombinant expression vector of the single-chain antibody that contains described resisiting influenza virus, as extracorporeal recombinant DNA technology, recombinant technology etc. in DNA synthetic technology and body.The gene of the single-chain antibody of described resisiting influenza virus can be effectively connected in the suitable promotor of expression vector, to instruct synthesizing of mRNA.Described promotor can be conventional known various promotors, as long as can bring into play the function of promotor in host cell.As colibacillary lac or trp promotor, phage promoter, retrovirus and some other known promotor of can controlling gene expressing at protokaryon or eukaryotic cell or the heavy pound of its virus.Described expression vector also comprises ribosome bind site and the transcription terminator that translation initiation is used.In addition, how described expression is carried can also comprise one or more selected markers, to be provided for selecting the phenotypic character of the host cell transforming, as dihydrofolate reductase gene, neomycin resistance gene and green fluorescent protein (GFP) gene of eukaryotic cell cultivation use or for colibacillary tsiklomitsin or ampicillin resistance gene etc.
Four of technical scheme of the present invention is: the host of containing described expression vector.
Described host cell can be prokaryotic cell prokaryocyte, as bacterial cell; The low eukaryotic cell that waits, as yeast cell; Higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, streptomycete; The bacterial cell of Salmonella typhimurium; Eukaryotic cell is as yeast, vegetable cell; The insect cells such as fruit bat S2 or Sf9; The zooblasts such as CHO, COS, 293 cells or Bowes and melanoma cell.The preferred intestinal bacteria of described host cell.
Five of technical scheme of the present invention is: a kind of method of the single-chain antibody of preparing described anti-H1N1 influenza virus, comprise described expression vector conversion, transduction or transfection host cell, cultivate host cell, protein isolate from culture, obtains anti-H1N1 influenza virus single-chain antibody.
Available routine techniques well known to those skilled in the art, by recombinant DNA transformed host cell, cultivates transformant, abduction delivering target protein, and recombinant protein is carried out to separation and purification.
Substratum and culture condition all can be substratum and the culture condition of cultivating the host that sets out.
The separation purification method of recombinant protein also can adopt the separation method of the recombinant protein of this area routine, when the albumen of expression is inclusion body, also comprises the step to renaturing inclusion bodies.
Six of technical scheme of the present invention is: the application of described antibody in preparation Tamiflu.
The primer pair of any fragment of amplification single-chain antibody gene of the present invention is also within protection scope of the present invention.
The raw material that the present invention is used or reagent except special instruction, all commercially available obtaining.
Than prior art, beneficial effect of the present invention is as follows:
Single-chain antibody of the present invention is mouse, can resist H1N1 influenza virus, have neutralization activity.Molecular weight is about 27kD.When amalgamation and expression, add that label protein (6kD) molecular weight of amalgamation and expression has about 33KD altogether.Single-chain antibody of the present invention can specific recognition H1N1 influenza virus, and can blocking virus and the combination of natural sera.
Single-chain antibody gene of the present invention can prepare bivalent or multivalence single-chain antibody, intrabody and other small molecular antibodies, or as target launch vehicle.
Single-chain antibody of the present invention can be used for diagnosis, prevention, control and cure the infection of H1N1 influenza virus, or for antiviral transgenic animal breeding, for the preparation of relevant medicine or reagent.
Brief description of the drawings
Below in conjunction with brief description of the drawings feature of the present invention and beneficial effect.
Fig. 1 shows nucleotide sequence and the aminoacid sequence of SIVHL1 single-chain antibody, between variable region of heavy chain and light chain variable region sequence, is described flexible joint.
Fig. 2 shows nucleotide sequence and the aminoacid sequence of the variable region of heavy chain VH of SIVHL1, is the aminoacid sequence of expection under this nucleotide sequence, and at aminoacid sequence underscore is described VH-CDR1, VH-CDR2 and VH-CDR3.
Fig. 3 shows the core former times acid sequence of the variable region of light chain VL of SIVHL1, is the aminoacid sequence of expection under this core former times acid sequence.At aminoacid sequence underscore is described VL-CDR1, VL-CDR2 and VL-CDR3.
Fig. 4 is that the antibody of pcr amplification is heavy, the agarose electrophoresis figure of chain variable region gene.M:2000bpDNAmarker; 1,2: variable region of light chain VL gene amplification product; 3,4: variable region of heavy chain VH gene amplification product.
Fig. 5 is the PCR product electrophorogram of single-chain antibody ScFv gene.M:2000bp DNA marker; The scFv fragment of 1,2,3,4:SOE PCR assembling.
Fig. 6 is carrier pCANTAB5E-ScFv structural representation and multiple clone site.
Fig. 7 shows the multifarious analysis of single-chain antibody.
Fig. 8 SIVHL1-pET28a (+) recombinant plasmid enzyme is cut qualification gel electrophoresis figure.M1:15000bp DNA molecular quality standard; M2:2000bp DNA molecular quality standard; 1,2 is the double digestion qualification of recombinant plasmid pET28a (+)-SIVHL1.
Fig. 9 wherein a is the tomograph of SIVHL1 heavy chain VH, and b is the tomograph of light chain VL, and c is the tomograph of SIVHL1 total length.
The left figure of Figure 10 is the SDS-PAGE electrophorogram of the SIVHL1-Histag recombinant expression protein of solubility, describes the result of the SIVHL1 process refolding purifying of expressing, and right figure is the SIVHL1 that utilizes WesternBlot method qualification separation and purification to obtain.M
1, M
2for molecular weight of albumen Marker; 1 and 2, the SIVHL1-Histag recombinant protein of purifying, 3 and 4, blank; 5,6 is anti-Histag antibody test SIVHL1-Histag albumen.
Figure 11 is a graphic representation, describes the indirect ELISA experimental result of different concns single-chain antibody SIVHL1 and A/PR/8/H1N1 influenza virus specific binding.
Figure 12 is a graphic representation, describes the ELISA experimental result of different concns single-chain antibody SIVHL1 and the domestic A type H1N1 influenza virus specific binding separating of two strains.
Embodiment
The inventor, through research deeply and widely, has obtained the single-chain antibody of a strain anti-A type H1N1 influenza virus.Single-chain antibody immunogenicity is little, and tissue penetration is strong, easily enters target, is very beneficial for production operation.Single-chain antibody provided by the invention has the neutralization activity of influenza virus, can block the combination of influenza virus and serum, and H1N1 influenza virus is had to specificity avidity.The present invention also provides the preparation method and application of this single-chain antibody.
The inventor is by building phage display single-chain antibody library, and by the cyclical operation of " enrichment one wash-out one enrichment ", therefrom screening obtains this single-chain antibody.And then the inventor analyzes the gene that has obtained this single-chain antibody, and this gene is used for to recombinant vectors, build the genetic engineering bacterium of expressing this single-chain antibody, thereby can simply adopt in a large number bionic method to prepare this single-chain antibody, thereby completed the present invention.
The structure of phage display single-chain antibody library, screening
(1) light, the heavy chain mix primer of design and synthetic mouse antibodies, utilize primer to obtain its light, heavy chain variable region gene fragment through pcr amplification from the mouse boosting cell gene of H1N1 influenza infection, by oligonucleotide chain (Linker), described two fragments are connected, construct single-chain antibody gene fragment;
(2) through overlapping extension PCR (SOE-PCR), by flexible polypeptide Linker joint (Gly
4ser) by VH-Linker-VL mode, VH gene and VL gene are spliced into ScFv gene fragment at random.ScFv gene is connected after double digestion (sfiI and NotI) respectively with pCANTAB 5E carrier, transforms Host Strains TG1, coating SOB-AG flat board, 30 DEG C of overnight incubation.Recombinant plasmid is cultivated and extracted to the multiple single bacterium colonies of picking, utilizes the universal primer on expression vector pCANTAB5E to carry out PCR qualification order-checking, determines the diversity of antibody with this.
The primer of single-chain antibody heavy chain VH of wherein increasing is:
VHa：5-GTCCTCGCAACTGCGGCCCAGCCGGCC?ATGGCCSAGGTSMARCTGCAGSAGTC-3；
VHb：5-GCCAGAGCCACCTCCGCCTGAACCGCCTCCACC?TGAGGAGACGGTGACCGTGGT-3。
The primer of amplification single-chain antibody light chain VL is:
VLc：5-TCAGGCGGAGGTGGCTCTGGCGGTGGCGGATCGGACATYGAGCTCACYCAGTCTCC-3
VLd：5-GAGTCATTCTGCGGCCGCCCGTTTBAKYTCCARCTTKGTSCC-3。
Wherein antibody heavy chain variable region has nucleotide sequence and aminoacid sequence as shown in Figure 2.
Wherein antibody chain variable region has nucleotide sequence and aminoacid sequence as shown in Figure 3.
(3) restructuring phagemid transforms amber inhibition type e. coli tg1, through helper phage M13K07 rescue, builds phage antibody library.Taking H1N1 influenza virus as antigen coated immunity pipe, through the 3 affine enrichment screenings of taking turns, identify positive recombinant antibodies by Phage-ELISA, positive colony phage is checked order, obtain corresponding gene.And measure by the positive colony phage ScFv activity of virus blocking-up ELISA and acquisition that sandwich ELISA screens.
(4) by screening obtain positive antibody gene with protein expression vector pET-28a-c (+) respectively enzyme cut and be connected, be converted in non-amber inhibition type e. coli bl21 (DE3) and carry out IPTG abduction delivering, the single-chain antibody of expressing with inclusion body form is carried out to refolding renaturation, thereby obtain the soluble single-chain antibody of anti-swine flu, this soluble single-chain antibody is the product of the His-tag label amalgamation and expression on object single-chain antibody gene fragment and expression vector, taking this single-chain antibody as primary antibodie, taking anti-His-tag antibody as two anti-, adopt indirect ELISA technology for detection object single-chain antibody, confirm that this single-chain antibody can specific recognition H1N1 influenza virus.
The single-chain antibody of resisiting influenza virus
The single-chain antibody of anti-H1N1 influenza virus provided by the invention, 1) be the single-chain antibody being formed by connecting by joint peptide by antibody heavy chain variable region and variable region of light chain, wherein the aminoacid sequence of variable region of light chain and weight chain variable region amino acid sequence are respectively as shown in SEQ ID NO.1 in sequence table and SEQ ID NO.2.And joint peptide is wherein conventional, be that the joint peptide that connects antibody heavy chain variable region and variable region of light chain in conventional single-chain antibody can use in the present invention, preferably 15-20 the small peptide that amino acid condensation forms, best aminoacid sequence is GGGGSGGGGSGGGGS, and it is 15 amino acid whose flexible links.
A most preferred embodiment of the present invention is: the single-chain antibody (SIVHL1) of anti-H1N1 influenza virus, 732 Nucleotide of total length, have 244 amino acid (Fig. 1).There are 122 amino acid whose variable region of heavy chain (Fig. 2) and 107 amino acid whose variable region of light chain (Fig. 3), by 15 amino acid whose flexible links (GGGGSGGGGSGGGGS).
Single-chain antibody provided by the invention has the neutralization activity of H1N1 influenza virus, can block the combination of influenza virus and serum, and H1N1 influenza virus is had to specificity avidity.
The single-chain antibody of resisiting influenza virus provided by the invention can be also 2): as 1) as described in single-chain antibody through the derivative antibody that obtains of transformation, described transformation comprises amino acid whose disappearance, replacement or insertion, and this derivative antibody has the antibody activity of resisiting influenza virus.Wherein, disappearance, replace or the amino acid whose quantity inserted is one to several.Described " several " refer to that two to being less than 100, and better is less than 30.Such as adding the fusion rotein of an external secretion signal peptide or expressed sequence tag, as long as this fusion rotein still has the antibody activity of resisiting influenza virus, all within protection scope of the present invention.A preferred embodiments of the present invention is described single-chain antibody and the fusion rotein of His-tag, and wherein, His-tag is made up of multiple as 6 His amino acid.That is to say that as long as the present invention finds by 1) antibody activity of derivative protein resisiting influenza virus, and deriving mode is described above, can reach goal of the invention of the present invention.Described single-chain antibody can separate and obtain from the expressor of recombinant expressed this single-chain antibody, also can obtain by synthetic.
According to the present invention, in aminoacid sequence as shown in SEQ ID No.1 or 2, carry out the sudden change of 1-3 amino-acid residue, also can obtain above-mentioned derivative antibody, but still keep the antibody activity of resisiting influenza virus.
In the present invention, term " single-chain antibody ", claims again ScFv, is at DNA level, antibody heavy chain variable region gene and one section of suitable oligomerization core former times acid (joint) of chain variable region gene to be linked up, and making it to express becomes a single skin chain.ScFv molecular weight is little, simple in structure, is the minimum antibody fragment with complete antigen binding site.
Natural antibody comprises heavy chain (H chain) and light chain (L chain).Interchain is connect by disulfide linkage and non covalent bond.Heavy chain and light chain are all divided into constant region and variable region.Variable region is positioned at the two arm ends of " Y ".Comprising Fab (antigen-binding fragment, Fab), determine the specificity of this antibodies antigen.The shank of " Y " claims FC (crystalline fragment, crystallizable fragment), and sugar is combined on FC.And single-chain antibody only comprises heavy chain variable region gene and variable region of light chain, do not comprise constant region, do not comprise FC yet, molecular weight reduces greatly.Single-chain antibody is easier to express and transform at gene level.Be easy in multiple expression system as expressed in prokaryotic cell prokaryocyte, yeast, plant insect and cells of mamma animals, thus can produce in a large number and cost low.Heterology is low, penetrance is strong, clean up fast.Do not contain Fc section, not with Fc receptors bind, can reduce the disadvantageous effect that the Fc acceptor because extensively distributing brings, thereby be with a wide range of applications.Can be used as oriented carrier clinical some disease is carried out to Image Location diagnosis and targeted therapy, neutralization virus and toxin, the aspects such as intracellular immunity and immunodetection.
Complementary determining region CDR1, the CDR2 that the variable region of heavy chain of single-chain antibody of the present invention and variable region of light chain comprise and the sequence of CDR3 are shown in Fig. 2 and 3.
The encoding gene of single-chain antibody
The encoding gene of single-chain antibody of the present invention or derivative antibody is the gene of the various encode such amino acid sequences of routine, as long as this gene translation aminoacid sequence is out single-chain antibody of the present invention or derivative antibody.As is known to the person skilled in the art, antibody heavy chain variable region and variable region of light chain can be other any base sequences of aminoacid sequence shown in SEQ ID No.1 (or No.2) in code sequence list.For example, due to the degeneracy of codon, the base sequence of the aminoacid sequence of coding SEQ ID No.1 (or 2) is not only confined to SEQ ID No.3 (or 4).And wherein, a preferred embodiments is: the nucleotide sequence of encoding antibody variable region of light chain is as shown in SEQ ID NO.3 in sequence table; The nucleotide sequence of encoding antibody variable region of heavy chain is as shown in SEQ ID NO.4 in sequence table.
The present invention also can replace, lack, change, inserts or increase the homologue that a polynucleotide is provided by suitable introducing.In the present invention, the homologue of polynucleotide can make by one or more bases of base sequence SEQ ID NO.3, SEQ ID NO.4 are replaced, lacked or increase within the scope of maintenance enzymic activity.The homologue of polynucleotide also refers to promoter mutation body.Promotor before described base sequence or signal sequence can change by the replacement of one or more Nucleotide, insertion or disappearance, but these changes do not have negative impact to the function of promotor.And by changing the sequence of promotor or even using from the more effective promotor of difference kind organism and replace completely, can improve the expression level of target protein, for example can come from the promotor of Gram-negative bacteria the favourable adjusting sequence of the present invention, as cos, tac, trp, tet, trp-tet, lpp, lac, T7, T5, T3, gal, trc, ara, SP6 etc.; Or be present in Gram-positive promotor amy and SPO2; Or come from fungi or Yeast promoter ADC1, AC, P-60, CYC1, GAPDH, TEF, rp28, ADH etc.; Or from pyruvic carboxylase promotor or manual activation etc. of Hansenula.
The encoding gene of single-chain antibody of the present invention or derivative antibody can be also the DNA sequence dna hybridization that the nucleotide sequence of its antibody chain variable region and variable region of heavy chain under rigorous condition can limit with SEQ ID NO.3 and SEQ ID NO.4 respectively, and the protein of this genes encoding has the antibody activity of anti-H1N1 influenza virus.Wherein, under rigorous condition, hybridize and can carry out according to the mode of describing in " molecular cloning ": Cold Spring Harbor Laboratory Press, the general scheme (Current Protocols in Molecular Biology) in molecular biology.Specifically, hybridization can be carried out in accordance with the following steps, and film and a label probe that is loaded with transcribed DNA to be measured or RNA molecule is hybridized in hybridization buffer.The dilution inhibitor and 2～8 × SSC that consist of 0.1wt%SDS, 5wt% sulfuric acid dextran, a box 1/20 of hybridization buffer.20 × SSC is the solution of the citric acid composition of 3M sodium-chlor and 0.3M.Hybridization temperature is 50～70 DEG C.After cultivating several hours or spending the night, clean film with cleaning buffer solution.Cleaning temperature is room temperature, more preferably hybridization temperature.Cleaning buffer solution consist of 6 × SSC+0.1wt%SDS solution, more preferably 5 × SSC+0.1wt%SDS.When having cleaned after film with this cleaning buffer solution, just can identify DNA or RNA molecule by the mark on the probe of being hybridized in DNA or RNA molecule.
The expression vector that contains single-chain antibody gene
Recombinant expression vector of the present invention can be connected in single-chain antibody gene of the present invention on various expression vectors and build and form by this area ordinary method.Described carrier can be the various carriers of this area routine, as commercially available plasmid (in intestinal bacteria, suitable carrier has pLG338, pACYC184, pBR322, pUC18, pUC19, pKC30, pRep4, pHS1, pHS2, pMBL etc.), clay (pHZ132), phage or virus vector (retrovirus vector, adenovirus carrier) etc. described plasmid represent a fraction of may plasmid, other plasmids are that technician is known.Recombinant vectors of the present invention preferably adopts pET28a plasmid.
The host of containing single-chain antibody expression vector
Described host microorganism of the present invention can be the various host microorganisms of this area routine, as long as can meet copying voluntarily that recombinant expression vector can be stable, and entrained reductase gene of the present invention can be by effective expression.The preferred intestinal bacteria of the present invention, more preferably colon bacillus (E.coli) BL21 (DE3) or colon bacillus (E.coli) DH5 α.Aforementioned the present invention recombinant expression plasmid, by conventional method for transformation, is converted in E.coli BL21 (DE3), gets final product to obtain the preferred engineering strain of the present invention.
The preparation method of single-chain antibody
The method that the present invention prepares the single-chain antibody of described resisiting influenza virus can be synthetic, can be referring to various document, and as synthetic in the liquid phase of polypeptide or solid phase synthesis etc.Also can be the bionic method of utilizing, the expressor of single-chain antibody of the present invention be expressed in preparation, and from expressor, manufacture obtains.Comprise described expression vector conversion, transduction or transfection host cell, cultivate host cell, protein isolate from culture, obtains resisiting influenza virus single-chain antibody.Wherein, described recombinant expressed transformant is ditto given an account of and is continued, and the present invention can obtain by recombinant expressed son of the present invention is converted into host microorganism.Wherein, in the recombinant expressed transformant of described cultivation, substratum used can be that this area is any to be grown transformant and produce the substratum of nitrilase of the present invention, preferably LB substratum: peptone 10g/L, yeast extract paste 5g/L, NaCl 10g/L, pH 7.0.Cultural method and culture condition do not have special restriction, cultural method and culture condition can carry out appropriate selection by this area general knowledge according to the difference of the factor such as host type and cultural method, as long as make transformant can grow and produce single-chain antibody of the present invention.Other are cultivated transformant concrete operations and all can be undertaken by this area routine operation, preferred following method: by the present invention relates to recombination bacillus coli (preferably the recombinant expressed transformant of E.coli BL21 (DE3) is seeded in the LB substratum containing kantlex and cultivates, as the optical density(OD) OD of nutrient solution
600while reaching 0.5-0.7, be under the induction of sec.-propyl-β-D-sulfo-galactopyranoside (IPTG) of 0.1-1.0mmol/L (preferably 0.5mmol/L) at final concentration, high efficient expression single-chain antibody of the present invention.Target protein is mainly expressed with inclusion body form, and inclusion body protein is carried out to renaturation purifying.
The application of single-chain antibody
Single-chain antibody of the present invention is mouse, can resisiting influenza virus, to have neutralization active.Molecular weight is about 27kD.When amalgamation and expression, add that label protein (6kD) molecular weight of amalgamation and expression has about 33KD altogether.Single-chain antibody of the present invention can specific recognition H1N1 influenza virus, and can blocking virus and the combination of natural sera.Can be used for the product that preparation prevents and treats porcine influenza disease, can be used for prevention, control and cure the infection of H1N1 influenza virus, or for antiviral transgenic animal breeding, for the preparation of relevant medicine or reagent, and for the relevant diagnostic studies of porcine influenza, therapeutic studies.
Two or more scFv are connected into the multivalence scFv with multiple antigen binding sites, in structure, function, more approach parental antibody, be combined more responsively than monovalent scFv with antigen, avidity is higher, almost consistent with the antigen combined function of parental antibody.Single-chain antibody gene of the present invention can prepare bivalent or multivalence single-chain antibody, intrabody and other small molecular antibodies, or as target launch vehicle.
In Tamiflu, one of activeconstituents is single-chain antibody or the derivative antibody of anti-H1N1 influenza virus of the present invention.When needs, in said medicine, can also add one or more pharmaceutically acceptable carriers.Described carrier comprises thinner, vehicle, weighting agent, absorption enhancer or the absorption carrier etc. of pharmaceutical field routine.This medicine can be made the various ways such as injection, tablet, pulvis, capsule, oral liquid.According to the ordinary method preparation of pharmaceutical field.
Further illustrate the present invention with embodiment below, but the present invention is not limited.The experimental technique of unreceipted actual conditions in the following example, conventionally according to normal condition, or the condition of advising according to manufacturer." room temperature " described in embodiment refers to the temperature of the operation room of testing, and is generally 25 DEG C.
The extraction of total RNA of embodiment 1 immune mouse spleen cell reverse transcription synthesize complementary DNA
The extraction of total RNA of the splenocyte of 1.1 A/PR/8/H1N1 influenza infection mouse
((A/Puerto-ico/8/34 (H1N1), is the conventional virus in laboratory to influenza virus PR8, and its biological characteristics performance represents H1N1 influenza virus feature to get antigen influenza virus.(Lv Cuixia etc., the clear impact of mixture on influenza virus infection A/PR/8/H1N1 model mice macrophage phagocytic function of inducing sweat, Shandong Traditional Chinese Medicine University's journal, the 34th the 5th phase of volume, in September, 2010, the 457-458 page sought.) culture supernatant, this virus liquid is inoculated in to mdck cell (purchased from Institute Of Biochemistry And Cell Biology, Shanghai Institutes For Biological Sciences, Chinese Academy Of Sciences), after 48h, draw cell conditioned medium, this is containing virulent cell culture supernatant, and virus titer is 1 × 10 after measured
5tCID
50/ mL, puts-70 DEG C of cryogenic refrigerators and saves backup.
100 times of A/PR/8/H1N1 influenza virus cell culture fluid supernatant dilutions, adopt collunarium immunoinfective Balb/C mouse (purchased from Shanghai Slac Experimental Animal Co., Ltd.), and after two weeks, booster immunization once.Mouse tail venous blood sampling after one week; ELISA qualification has high titre protection antibody; the selection the highest mouse of tiring; after being put to death, take out spleen and add liquid nitrogen grinding; add 1mLTrizol reagent by 50-100mg spleen, room temperature leaves standstill 5min, adds 0.2mL chloroform to add chloroform by every 1mLTrizol; thermal agitation 15s repeatedly, room temperature leaves standstill 2-3 minute.4 DEG C, the centrifugal 15min of 12000g/min, draws aqueous portion in the centrifuge tube of another clean 1.5mL, adds 0.5mL Virahol to add Virahol by every 1mlTrizol, puts upside down and mixes, in-20 DEG C of precipitation 30-60min, the centrifugal 10min of 12000g/min.Retain precipitation, 70% washing with alcohol one time, dries in air, DEPC water dissolution precipitated rna.
1.2 reverse transcriptions synthesize cDNA
Reverse transcription is taking RNA as template, and under archaeal dna polymerase (reversed transcriptive enzyme) effect of instructing at RNA, utilizing 4 kinds of dNTP is raw material, in the 3 ' process of holding the DNA chain of and RNA complementation synthetic with 5 '-3 ' direction of primer.Be specially taking total RNA of the immune spleen cell that extracts as the step of the synthetic cDNA of template: get oligo (dt) 18 primer (0.5 μ g/ μ L) 1 μ L, the RNA volume calculating; It is 12 μ L that DEPC water is supplied, mix rearmounted 65 DEG C, 5min, be placed in rapidly on ice, according to reverse transcription test kit (specification sheets of (Promega company) adds each reagent successively, slight centrifugal after in 42 DEG C, 60min, 70 DEG C, 5min deactivation ThermoScript II, by reverse transcription product cDNA in-70 DEG C of preservations.
The amplification of 2.1 repertoire antibody variable region genes
Carry out PCR reaction increase respectively antibody gene heavy chain and variable region of light chain taking cDNA as template.Concrete steps are to add following reagent to carry out variable region of heavy chain amplification in a 0.2mlPCR pipe: immune spleen cell cDNA 4 μ L; 10 × PCR buffer, 5 μ L; DNTP (10mM) 5 μ L; Upstream and downstream primer 1 μ L; Taq (5U/ μ L) 0.5 μ L, adds sterilizing ultrapure water and puts 50 μ L.In another PCR reaction tubes, add following reagent to carry out variable region of light chain amplification: immune spleen cell cDNA4 μ L; 10 × PCR buffer, 5 μ L; DNTP (10mM) 5 μ L; The each 1 μ L of upstream and downstream primer; Taq (5 μ/μ L) 0.5 μ L, adds sterilizing ultrapure water and puts 50 μ L.Slowly with micro-rifle head mixing aforesaid liquid centrifugal momently.Amplification condition: 94 DEG C of denaturations 4 minutes, then 94 DEG C of sex change 30 seconds, 55 DEG C of annealing 30 seconds, 72 DEG C are extended 1 minute, totally 30 circulations.
The primer of VH of wherein increasing is:
VHa：5-GTCCTCGCAACTGC
ATGGCCSAGGTSMARCTGCAGSAGTC-3
VHb：5-
TGAGGAGACGGTGACCGTGGT-3。
The primer of amplification VL is:
VLc：5-
GACATYGAGCTCACYCAGTCTCC-3
VLd：5-GAGTCATTCT
CCGTTTBAKYTCCARCTTKGTSCC-3。
Note: B=T, C, G; K=T, G; M=A, C; R=A, G; S=G, C; W=A, T; Y=C, T.
Square frame is respectively restriction endonuclease SfiI and NotI.Italicized item is the part of amplification Linker sequence, and black matrix adds the complementary portion that italicized item is Linker.There is band respectively in PCR result, conform to the size of expection between about 360bp and 320bp, sees Fig. 4.
Random splicing and the purifying of 2.2 single-chain antibodies (scFv) segment
VH in scFv and VL are connected together by Linker (joint), the design of Linker has material impact to the avidity that keeps parental antibody, it should not disturb the spatial folding of VH and VL, not overslaugh antigen-binding site, do not cause that molecular dynamics changes, reduce as far as possible proteolytic enzyme and attack and prevent that ScFv from assembling.The most frequently used Linker sequence is by 3 coding wetting ability pentaamino acid (Gly of unit now
4ser) form.Wherein glycine is molecular mass minimum, and the amino acid that side chain is the shortest can increase the snappiness of side chain, and Serine is the amino acid that wetting ability is the strongest.Its orientation has two kinds of mode: VH-Linker-VL or VL-Linker-VH.Two kinds of building modes specificity and avidity to ScFv has no significant effect.But can cause the difference of intestinal bacteria secreting, expressing.The assembling of single-chain antibody ScFv of the present invention, adopts overlapping extension (SOE) joint (G
4s)
3dNA fragmentation light clone's antibody, heavy chain variable region gene are connected, form 5 ' VH-Linker-VL 3 ' form.Concrete steps are: by above-mentioned amplification to VH separate, reclaim with 1.5% agarose gel electrophoresis respectively with VL gene segment, then VH and VL balanced mix are carried out to overlapping extension PCR with assembling ScFv segment as template, condition is 94 DEG C of 1min sex change, 55 DEG C of 1min annealing, 72 DEG C of 1min extend, totally 30 circulations.PCR product is single-chain antibody gene segment, between VH and VL gene, is the linker sequence of 45bp: GGTGGAGGCGGTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGATCG, and 15 amino acid of encoding altogether, are (GGGGS)
3, the sepharose with 1.5% reclaims, and the results are shown in Figure 5.
Being connected of embodiment 3 single-chain antibodies and phasmid carrier, the structure in primary antibody storehouse and the analysis of antibody diversity
The structure of being connected of 3.1 single-chain antibody genes and phasmid carrier, single-chain antibody library
Use T4DNA ligase enzyme (Promega), the scFv fragment of cutting processing with NotI enzyme through sfiI is connected with pCANTAB5E carrier (purchased from Pharmacia company).Connection product is transformed into 100 μ L TG1 competent cells, then adds 2 × YT substratum of 37 DEG C of preheatings of 900 μ L, 37 DEG C of shaking culture 1h, get the bacterium liquid 100 μ L that cultivate after step transforms, do gradient doubling dilution with 2 × YT nutrient solution, coating SOB-AG flat board, 30 DEG C of overnight incubation.Single colony number on counting flat board, calculates that antibody library storage capacity is 3x10
6.The bacterium liquid that remaining conversion is cultivated afterwards, adds 10mL 2 × YTGA (Glucose:2%, Amp:100 μ g/mL), and 37 DEG C are cultured to A600=0.5, make bacterium reach logarithmic phase.Add 2 × 10
10phage M13K07 (purchased from Pharmacia company), cultivates 1h for 37 DEG C, the centrifugal 10min of 4000r/min, and the resuspended 200mL 2 × YT2A K (Amp:100 μ g/mL, kantlex: 50 μ g/mL) that is deposited in, 37 DEG C of shaking culture are spent the night.After the centrifugal 10min of 4000r/min, add the PEG/NaCl (20%PEG8000 of 1/5 volume, 2.5mol/LNaCl) in 4 DEG C of precipitation phage 30min, the centrifugal 20min of 9000r/min, precipitation phage is resuspended in to 2mL containing in the PBS of 10g/L BSA, the centrifugal 5min of 12000r/min, supernatant, through 0.45 μ m membrane filtration, obtains phage antibody library.
The multifarious analysis of 3.2 single-chain antibody
With S1, S6 (S1:5-CAACGTGAAAAAATTATTATT-3; S6:5-GTAAATGAATTTTCTGTATGAGG-3) for primer checks order, except 2 cloning and sequencings are without result, other 8 clones' (PHL1-PHL8) sequencing result shows that series arrangement mode is VH-Linker-VL, compares rear discovery all sequences all meet mouse weight chain variable region gene structure with mouse immuning ball protein variable region sequences database Kabat.VH part is 357-367bp left and right, and VL is 320-330bp left and right, and the linker base sequence between heavy chain and light chain is all correct.Utilize software DNAstar to carry out sequence alignment, homology reaches more than 82%, and other has comparatively notable difference, and homology is lower than 76%.The results are shown in Figure 7.
The enrichment of single-chain antibody library of embodiment 4 resisiting influenza virus and the screening of specific antibody
By coated effective immunity carbonate damping fluid, by A/PR/8/H1N1 influenza virus cell culture fluid supernatant, (titre is 1 × 10
5pFU/mL) by 1: 5 (volume ratio) dilution (package amount 2mL/ pipe), 4 DEG C are spent the night.Coated complete, wash and manage 3 times with PBS, pat dry; With confining liquid (2% skimming milk PBS, MPBS) sealing immunity pipe, 37 DEG C are sealed 2 hours; The deblocking liquid that inclines, washes pipe 3 times with PBS, pats dry; In washing process, by above-mentioned acquired elementary phage antibody library supernatant, according to MPBS: supernatant=2: 3 volume ratio mixes MPBS and phage supernatant, add the immunity pipe having sealed, 2mL/ pipe, after jog incubation 30min, then leaves standstill incubation 1.5 hours; Abandon phage supernatant in immunity pipe, with PBST washing 3 times, then with PBS washing 3 times, pat dry; Add glycine-hydrochloric acid (pH2.2) elutriant, 2mL/ pipe, after 37 DEG C of effect 6min, add rapidly Tris (2mol/L pH 7.4), the phage solution that 200 μ L/ pipe neutralizations elute, then add the TG1 bacterium liquid (purchased from Pharmacia company) (OD value is about 0.5) that 2mL is fresh, after 37 DEG C of effect 1h, now, complete naughty sieve of the first round, obtained one-level antibody library.Get part bacterium liquid and do after 10 times of gradient dilutions, coating SOBAG plate calculates the phage of output and washes in a pan sieve amount, and it is 100 μ g/mLamp and 2% glucose that residue bacterium liquid adds final concentration, adds approximately 4 × 10 simultaneously
10m13 K07 phage, leaves standstill after incubation 30min, then 250rpm shaking culture 30min; The centrifugal 10min of 1000 × g, remove supernatant, with gently outstanding cell of 100mL 2 × YT-AK, 37 DEG C, 250 turn, overnight incubation, starts next round and washes in a pan sieve, finally takes turns and washes in a pan sieve through 3, get the bacterium liquid of acquisition, do gradient doubling dilution with 2 × YT substratum, get diluent 100 μ L coating SOBAG flat boards, 30 DEG C of overnight incubation; Select the flat board of 100-200 the left and right bacterium colony of having an appointment, calculate bacterium colony number, be multiplied by extension rate, obtain corresponding storage capacity.Take turns specific enrichment through 3 and wash in a pan sieve, obtained titre and be about 5.0 × 10
4the phage recombinant antibodies storehouse of cfu/mL.Residue bacterium liquid according to: the above wash-out bacterium of 800 μ L liquid+200 μ L (containing 2 × YT of 80% sterile glycerol), after mixing ,-70 DEG C are frozen, are labeled as three grades of antibody libraries.
The centrifuge tube of getting 72 1.5mL is put on culturing rack as culture plate, and every hole adds 2 × YT-AG substratum, 400 μ L; The single bacterium colony growing on SOBAG flat board during picking is above-mentioned, is seeded to above in each hole, and this plate is labeled as Master Plate; Master Plate is placed in to shaking table, 30 DEG C, 250rpm, shaking culture is spent the night; Next day, separately get 72 well culture plates, get extremely every hole of 2 × YT-AG that 400 μ L contain 2.5 × 1010pfu/mL M13K07, this plate is designated as P1 Plate; From the Master Plate of incubated overnight, 40 μ L nutrient solutions are got to P1 Plate in every hole; P1 Plate is placed in to shaking table, 37 DEG C, 150rpm/min, shaking culture 2 hours, the centrifugal 20min of 1500 × g, carefully removes supernatant; Add 400 μ L 2 × YT-AK nutrient solutions to the every hole of P1 Plate, 37 DEG C, 250rpm, shaking culture is spent the night; The centrifugal 20min of 1500 × g, carefully gets supernatant stand-by.Getting the made 4 DEG C of coated elisa plates of A/PR/8/H1N1 influenza virus cell culture fluid supernatant of embodiment 1 spends the night, 2%M PBS (containing the PBS of 2% skimming milk) sealing, after washing, to obtain phagocytosis body fluid above as primary antibodie, hatch 2h for 37 DEG C, the anti-M13 monoclonal antibody of HRP mark is two anti-, 37 DEG C of reaction 1h, after washing, add TMB nitrite ion, 37 DEG C of reaction 30min, add 2M sulfuric acid color development stopping, under microplate reader 450nm wavelength, survey OD value, if M13K07 is coated with control wells (positive control) and blank coated control wells, find out positive colony (OD value >=0.3 and OD value/OD blank well >=3 can be defined as positive colony).ELISA measures the combination situation of each hole supernatant and A/PR/8/H1N1 influenza virus, found that 4 strain clones and antigen have positive reaction, tentatively determines that this 4 strain recombinant clone is positive.Wherein a strain phage antibody is strong positive, and called after WJY001 extracts this clone's recombinant plasmid, with S1, and S6 (S1:5-CAACGTGAAAAAATTATTATT-3; S6:5-GTAAATGAATTTTCTGTATGAGG-3) for primer does PCR qualification, the results are shown in Figure 5, object fragment is reclaimed after test kit reclaims and serves the order-checking of Hai Yingjun company with glue, sequencing result shows object ScFv sequence 743bp altogether, series arrangement mode is VH-Linker-VL, compares and finds that sequence meets mouse weight chain variable region gene structure with mouse immuning ball protein variable region sequences database Kabat.Called after SIVHL1, sequencing result is shown in Fig. 1.
The qualification of the phage single-chain antibody activity of embodiment 6 resisiting influenza virus
6.1 blocking-up ELISA qualification positive colony phage recombinant antibodies WJY001
According to the coated condition of the best, by coated influenza virus cells and supernatant made antigen embodiment 1 96 orifice plates, 4 DEG C of coated spending the night.2%MPBS (containing the PBS of 2% skimming milk) sealing, by the concentrated A/PR/8/H1N1 influenza virus liquid DMEM substratum dialysis equilibrium that is placed on, finally be condensed into 4 times, then use 2 gradients of DMEM substratum doubling dilution (to be equivalent to respectively 4 times, 2 times, the cell culture supernatant of the A/PR/8/H1N1 influenza virus of 1 times), each gradient, set up blocking-up hole and non-blocking-up hole, be respectively three repetitions, the each 50 μ L of virus liquid and positive colony phagocytosis body fluid room temperature reaction 30min outside hole, dislocation blocking-up hole, the non-blocking-up of dislocation hole after the reaction same with positive colony phagocytosis body fluid of DMEM cell culture fluid, 37 DEG C of reaction 1h, after washing, add the anti-M13 monoclonal antibody 100 μ L of HRP mark, 37 DEG C of reaction 1h, washing, colour developing: add 200 μ L/ hole TMB nitrite ions, hatch colour developing 15min left and right for 37 DEG C, stop: by 200 μ L/ hole stop buffers, color development stopping.Result show be used for blocking-up virus concentration higher, remaining can be coated on elisa plate to such an extent that viral phage single-chain antibody amount of reacting is fewer, the OD450 value of ELISA is less, the results are shown in Table 1, illustrate that the specificity of association reaction of WJY001 phage single-chain antibody and A/PR/8/H1N1 influenza virus is better.
The blocking-up ELISA result that the H1N1 influenza virus liquid of the different concentrated concentration of table 1. is combined with WJY001 phage single-chain antibody
6.2 couples of sandwich ELISA qualification positive bacteriophage recombinant antibodies WJY001
Positive bacteriophage liquid coated elisa plate, 4 DEG C are spent the night, 2%MPBS (containing the PBS of 2% skimming milk) sealing, adds A/PR/8/H1N1 influenza virus cell culture supernatant after washing, 37 DEG C of reaction 1h, after washing, add the mice serum (establishing two gradients 1: 2000 and 1: 4000) of anti-A/PR/8/H1N1 influenza virus, respectively do three repetitions, 37 DEG C are reacted 1h, add the sheep anti-mouse antibody of HRP mark after washing, 37 DEG C of reaction 1h, the same colour developing and mensuration OD value.Two sandwich ELISAs the results are shown in Table 2, illustrate that screened WJY001 phage single-chain antibody can suppress the how anti-and viral association reaction of mouse of natural anti influenza A/PR/8/H1N1 virus.
Two sandwich ELISA results that the mouse polyvalent antibody of the anti-H1N1 influenza virus of the different extension rates of table 2. and viral association reaction are suppressed by WJY001 phage single-chain antibody
The amplification of 7.1 single-chain antibody ScFvSIVHL1 gene fragments and the qualification of recombinant plasmid
According to the sequences Design pair of primers of SIVHL1,
VHL1-S:5 '
cCAGGATCCaTGGCCCAGGTCCAACT ' 3; Underscore place is BamHI restriction endonuclease,
VHL1-AGCA
gAGCTCcCGTTTTATTTCCAGCT, underscore place is SacI restriction endonuclease.In a 0.2mlPCR pipe, add following reagent to increase: template (taking in embodiment 5 obtain SIVHL1 gene fragment as template) 4 μ L; 10 × PCR buffer, 5 μ L; DNTP (10mM) 5 μ L; Upstream and downstream primer 1 μ L; Taq (5U/ μ L) 0.5 μ L; Add sterilizing ultrapure water and put 50 μ L.Purified pcr product, with protein expression vector pET-28a-c (+) (purchased from Novagen company) respectively enzyme after cutting, be connected, and proceed to TOP10 bacterial strain (being century Bioisystech Co., Ltd purchased from Beijing health) and be inoculated into containing in the LB substratum of kantlex (100pg/mL), 37 DEG C of concussions are spent the night, extract recombinant plasmid enzyme and cut qualification, the results are shown in Figure 8.PET28a (+)-scFvSIVHL1 having identified is served to the order-checking of Hai Yingjun company, and sequencing result, with embodiment 5, carries out three-dimensional structure prediction by the aminoacid sequence of its coding by Swiss-Model software online, the results are shown in Figure 9.
7.2 single-chain antibody ScFvSIVHL1 prokaryotic expression and purifying
Recombinant plasmid pET28a (+)-scFvSIVHL1 having identified is proceeded in BL21 (DE3) intestinal bacteria, be cultured to bacterium liquid absorbancy at approximately 0.6 o'clock at 37 DEG C, add isopropylthiogalactoside (isopropylthiogalactoside, IPTG) abduction delivering target protein, regulating the final concentration of IPTG is 1mmol/L, 25 DEG C of induction 6h, compare not add IPTG bacterium liquid, carry out SDS-PAGE and detect protein expression situation, result target protein is mainly expressed with inclusion body form, use the Protein Refolding Kit refolding proteins test kit (article No.: 70123-3) of Merk company to carry out renaturation purifying to inclusion body protein.Concrete steps are as follows: pET28a (+)-scFvSIVHL1/BL21 product after (1) abduction delivering is through 4 DEG C, and the centrifugal 15min of 6,500 × g, removes supernatant.(2) by the resuspended precipitation of 1 × IB Wash Buffer (20mMTris-Hcl, pH7.5,10mM EDTA, 1%Triton X-100) of 0.1 times of culture volume, fully mix.(3) operation on ice, makes the resuspended liquid of bacterium keep 4 DEG C, prevents heat production in lysis process, ultrasonic degradation bacterium.(4) ultrasonic after product is through 4 DEG C, and the centrifugal 10min of 10,000 × g collects inclusion body.(5) remove supernatant the thorough resuspended precipitation of 1 × IB Wash Buffer with 0.1 times of culture volume.(6) centrifugally operated of repeating step 4 reservation precipitation.(7) remove supernatant the thorough resuspended precipitation of 1 × IB Wash Buffer with 0.1 times of culture volume, resuspended liquid is transferred to clean weighing in centrifuge tube.(8) 10, the centrifugal 10min of 000 × g collects inclusion body, removes supernatant and centrifuge tube is upside down in and on thieving paper, removes residual liquid.(9) weighing centrifuge tube weighs and deducts its net weight and obtains inclusion body weight.(10) weighing inclusion body weight in wet base, is the volume that 20-30mg/mL calculates required 1 × IB Solubiliz-ation Buffer according to making resuspended thing final concentration.(11) volume required 1 × IB Solubilization Buffer, adding N-sarcosyl, to make its final concentration be 0.3%.(12) in inclusion body sample, add the 1 × IB Solubilization Buffer/N-sarcosyl that calculated volume, mix gently.Larger fragment can repeatedly be blown and beaten and make its dispersion with liquid-transfering gun.(13) incubated at room 15min.(14) 10, the centrifugal 10min of 000 × g room temperature makes solution clarification.The supernatant that contains soluble protein is transferred in a clean centrifuge tube.The dialysis operation of refolding proteins, (15) prepare dialysis buffer liquid, be greater than 50 times of sample volumes, altogether need 1L dialysis buffer liquid, when preparation, 20mL 50 × dialysis buffer liquid is diluted in 1L deionized water, adds 100 μ L 1M DTT (making its final concentration is 0.1mM).Dialyse 3 hours for (16) 4 DEG C, replace damping fluid and continue dialysis 3 hours.(17) continue dialysis 3 times with the dialysis buffer liquid that does not contain DTT, each more than 3 hours.
The qualification of single-chain antibody ScFv after 7.3 renaturation
7.3.1 albumen detects through 12%SDS-PAGE, and western-blot method qualification, by above-mentioned acquisition carry out SDS-PAGE electrophoresis through the restructuring ScFv of refolding purifying expressing protein, resolving gel concentration is 12%; 10V constant voltage transfer printing 20min, is transferred to pvdf membrane (purchased from Whatman) by albumen; Transfer printing finishes, by film room temperature sealing 1h in the PBST that contains 5% skimmed milk; PBST washes three times, each 5min.With the PBST that contains 5% skimmed milk by 1: 1000 dilution rabbit source anti-His antibody (Sigma), incubated at room 1h, PBST washing 3 times, each 5min; Press the goat-anti rabbit two anti-(Jackson ImmunoRearch) of 1: 10000 dilution HRP mark with the PBST of 5% skimmed milk, incubated at room 1h, PBST washing 3 times, each 5min; With DAB colouring reagents box colour developing (Wuhan doctor's moral).Result is indicated as recombinant single chain antibody ScFv albumen and obtains high efficient expression, the results are shown in Figure 10.BCA method is measured protein concentration, and freeze-drying is preserved.
7.3.2 indirect ELISA detects the activity of recombinant single chain antibody ScFv
According to the coated condition of the best, by coated the A/PR/8/H1N1 influenza virus of serial dilution 96 orifice plates, 4 DEG C of coated spending the night, set up positive control and negative control; Abandon coating buffer, with PBS washing 3 times, pat dry enzyme plate; Add 2% skimming milk PBS (MPBS) to expiring hole, 37 DEG C are sealed 1.5 hours; Abandon confining liquid, with PBS washing 3 times, pat dry enzyme plate; Add different dilution solubility recombinant single chain antibody ScFvSIVHL1, add in the enzyme mark hole of having sealed, 37 DEG C of association reactions 1 hour; Abandon recombinant antibodies liquid, with PBST washing 3 times, pat dry enzyme plate; The antibody of the anti-His of HRP mark is done to dilution in 1: 4000 with PBS, 100 μ L/ holes, 37 DEG C of incubation reaction 1 hour; Abandon enzyme labelled antibody liquid, with PBST washing 3 times, pat dry enzyme plate; Colour developing: add 100 μ L/ hole TMB nitrite ions, hatch colour developing 45min left and right for 37 DEG C; Stop: with 100 μ L/ hole stop buffers, color development stopping, in the 450nm place value of reading.The results are shown in Figure 11, result of indirect ELISA further verifies that the fusion recombinant single chain antibody of prokaryotic expression and A/PR/8/H1N1 influenza virus also have stronger binding ability.
7.3.3 block the activity that ELISA detects recombinant single chain antibody ScFv
Process is carried out according to embodiment 6.1, and according to the coated condition of the best, by influenza virus cells and supernatant made embodiment 1, (titre is 1 × 10
5pFU/mL) coated 96 orifice plates, 4 DEG C of coated spending the night.2%MPBS sealing, by the concentrated A/PR/8/H1N1 influenza virus liquid DMEM substratum dialysis equilibrium that is placed on, finally be condensed into 8 times, then use 2 gradients of DMEM substratum doubling dilution (to be equivalent to respectively 8 times, 4 times, 2 times, the cell culture supernatant of the A/PR/8/H1N1 influenza virus of 1 times), each gradient, set up blocking-up hole and non-blocking-up hole, be respectively three repetitions, the each 50 μ L of virus liquid and recombinant single chain antibody ScFv SIVHL1 (0.1mg/mL) room temperature reaction 30min outside hole, dislocation blocking-up hole, DMEM cell culture fluid and the non-blocking-up of dislocation hole after the same reaction of solubility recombinant single chain antibody ScFv SIVHL1, 37 DEG C of reaction 1h, after washing, add the anti-100 μ L of anti-His-tag bis-of HRP mark, 37 DEG C of reaction 1h, washing, colour developing: add 200 μ L/ hole TMB nitrite ions, hatch colour developing 15min left and right for 37 DEG C, stop: by 200 μ L/ hole stop buffers, color development stopping.Result show be used for blocking-up virus concentration higher, the remaining recombinant single chain antibody ScFv SIVHL1 amount that can react with the virus being coated on elisa plate is fewer, the OD450 value of ELISA is less, the results are shown in Table 3, the specificity of association reaction that ScFv SIVHL1 single-chain antibody and A/PR/8/H1N1 influenza virus are described is better, has certain blocking effect.
The blocking-up ELISA result that the H1N1 influenza virus liquid of the different concentrated concentration of table 3. is combined with single-chain antibody SIVHL1
7.3.4 the association reaction of ScFv SIVHL1 and other H1N1 strain isolateds
Choose the certain representational A type influenza virus of having of the domestic separation of two strains, be respectively people source A/swine/Guangdong/96/06 (H1N1) (Yu Hai etc., Annual Conference in 2009,320-326 page, Yu Hai, Email:yuhai shvri.ac.cn) and Europe be fowl source A/swine/zhejiang/1/07 (H1N1) (Yu Hai etc., Annual Conference in 2009,320-326 page, Yu Hai, Email:yuhai shvri.ac.cn).This two strains inactivation of viruses is coated with to elisa plate by optimum concn, the how anti-positive contrast of the anti-H1N1 influenza virus of mouse, other processes complete according to embodiment 7.3.2, result shows that ScFv SIVHL1 single-chain antibody all has certain combination activity to these strains, for may be the conservative region of H1N1 influenza virus.The results are shown in Figure 12.
Should be understood that, after having read foregoing of the present invention, those skilled in the art can make various changes or modifications the present invention, these equivalent form of values fall within the application's appended claims limited range equally.
Claims (10)
1. the single-chain antibody of a resisiting influenza virus, it is the single-chain antibody being formed by connecting by joint peptide by antibody heavy chain variable region and variable region of light chain, and wherein the aminoacid sequence of variable region of light chain and weight chain variable region amino acid sequence are respectively as shown in SEQ ID NO.1 in sequence table and SEQ ID NO.2.
2. single-chain antibody as claimed in claim 1, described joint peptide is 15-20 the small peptide that amino acid condensation forms.
3. the gene of coding single-chain antibody as claimed in claim 1 or 2.
4. gene as claimed in claim 3, is characterized in that, the nucleotide sequence of this genes encoding antibody chain variable region and variable region of heavy chain is respectively as shown in SEQ ID NO.3 in sequence table and SEQ ID NO.4.
5. contain the expression vector of gene described in claim 3 or 4.
6. expression vector as claimed in claim 5, is characterized in that, described carrier is plasmid pET28a.
7. contain the host of expression vector described in claim 5.
8. host as claimed in claim 7, is characterized in that, described host is intestinal bacteria.
9. prepare the method for the single-chain antibody of resisiting influenza virus claimed in claim 1 for one kind, it is characterized in that, comprise expression vector conversion claimed in claim 5, transduction or transfection host cell, cultivate host cell, protein isolate from culture, obtains anti-H1N1 influenza virus single-chain antibody.
10. the application of the single-chain antibody described in claim 1 or 2 in the anti-H1N1 influenza medicine of preparation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210063870.4A CN102558348B (en) | 2012-03-09 | 2012-03-09 | Single-chain antibody for resisting influenza viruses, preparation method for single-chain antibody, application of single-chain antibody |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210063870.4A CN102558348B (en) | 2012-03-09 | 2012-03-09 | Single-chain antibody for resisting influenza viruses, preparation method for single-chain antibody, application of single-chain antibody |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102558348A CN102558348A (en) | 2012-07-11 |
| CN102558348B true CN102558348B (en) | 2014-06-04 |
Family
ID=46405077
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210063870.4A Expired - Fee Related CN102558348B (en) | 2012-03-09 | 2012-03-09 | Single-chain antibody for resisting influenza viruses, preparation method for single-chain antibody, application of single-chain antibody |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102558348B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106749669A (en) * | 2016-12-30 | 2017-05-31 | 武汉金开瑞生物工程有限公司 | A kind of preparation method and application for recombinating internal reference GAPDH antibody |
| CN108728462B (en) * | 2018-05-30 | 2022-02-22 | 军事科学院军事医学研究院军事兽医研究所 | H3N2 type canine influenza virus shuttle intracellular antibody TAT-2C |
| CN108728461B (en) * | 2018-05-30 | 2022-02-22 | 军事科学院军事医学研究院军事兽医研究所 | H3N2 type canine influenza virus shuttle intracellular antibody TAT-4F |
| CN110845607B (en) * | 2019-11-14 | 2021-03-23 | 潍坊医学院 | H1N1 influenza virus antibody and application thereof in H1N1 virus ultramicro-detection |
| CN112028992B (en) * | 2020-06-23 | 2022-07-01 | 深圳市第二人民医院 | Artificial synthetic antibody of influenza A H1N1 virus, preparation method and detection kit thereof |
| CN115232207B (en) * | 2022-05-19 | 2023-06-13 | 河南大学 | Use of an antibody-lysin (SM-ScFv-Fc-Ly) for the treatment of Streptococcus mutans infection |
-
2012
- 2012-03-09 CN CN201210063870.4A patent/CN102558348B/en not_active Expired - Fee Related
Non-Patent Citations (4)
| Title |
|---|
| Accession No.HQ832613;Kabir,M.E.,et al.;《GenBank》;20110718 * |
| Kabir M.E. |
| 从人源大容量天然抗体库中筛选到抗禽流感病毒H5N1单链抗体;孙丽娜 等;《中国人兽共患病学报》;20111231;第27卷(第2期);86-90 * |
| 孙丽娜 等.从人源大容量天然抗体库中筛选到抗禽流感病毒H5N1单链抗体.《中国人兽共患病学报》.2011,第27卷(第2期),86-90. |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102558348A (en) | 2012-07-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102558348B (en) | Single-chain antibody for resisting influenza viruses, preparation method for single-chain antibody, application of single-chain antibody | |
| CN103476929B (en) | Resisiting influenza virus neutralizing antibody and its screening technique | |
| CN109438576B (en) | Preparation and application of anti-human CD47 monoclonal antibody | |
| CN111057145B (en) | Porcine reproductive and respiratory syndrome virus Nsp2 protein nano antibody and application thereof | |
| CN108641002A (en) | Influenza virus vaccine and application thereof | |
| CN103547676A (en) | Immunogenic compositions in particulate form and methods for producing the same | |
| CN102482345A (en) | Neutralizing molecules to influenza viruses | |
| CN103992988B (en) | A kind of monoclonal antibody of the anti-canine distemper disease viral N proteins of hybridoma cell strain and generation thereof | |
| Mwale et al. | Expression, purification, and characterization of anti-Zika virus envelope protein: polyclonal and chicken-derived single chain variable fragment antibodies | |
| CN106535932A (en) | Antibody guided vaccines and methods of use for generation of rapid mature immune responses | |
| CN110373393B (en) | Hybridoma cell strain 1H6 secreting monoclonal antibody against infectious bursal disease virus VP2 protein | |
| CN104710529B (en) | A kind of single-chain antibody of anti-fishes virus haemorrhagic septicaemia virus | |
| CN112608385B (en) | Preparation of canine Brain Natriuretic Peptide (BNP) monoclonal antibody | |
| CN104744572B (en) | Fowl and pig hepatitis E virus share antigen, monoclonal antibody and preparation method and application | |
| CN106188283A (en) | The nano antibody of type A avian influenza H7N2 and application thereof | |
| CN101222937A (en) | Anti-HIV neutralizing active immune body or its fragment without resisting to IL-2 | |
| CN108472343A (en) | The immunoglobulin (Ig) list variable domains antibody of F protein before anti-RSV fusions | |
| CN103030693B (en) | Neutralization molecule of high-pathogenicity avian influenza and preparation method thereof | |
| CN104045711B (en) | People source anti-H7N9 bird flu virus neutrality antibody B5, its preparation method and application | |
| CN101186644B (en) | H3 type flu virus hemagglutinin space conformation simulation antigen epitope and application thereof | |
| Guo et al. | Screening scFv antibodies against infectious bursal disease virus by co-expression of antigen and antibody in the bacteria display system | |
| CN114195889A (en) | SARS-Cov-2-N nano antibody and its derivative protein and application | |
| CN105859879B (en) | A kind of single-chain antibody of Antifish lymphocystis virus | |
| CN112608383B (en) | Single-chain antibody for resisting paralichthys rhabdovirus | |
| CN107266566B (en) | The anti-EV71 virus neutrality antibody E1 of source of people and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140604 Termination date: 20160309 |