CN102558348A - Single-chain antibody for resisting influenza viruses, preparation method for single-chain antibody, application of single-chain antibody - Google Patents
Single-chain antibody for resisting influenza viruses, preparation method for single-chain antibody, application of single-chain antibody Download PDFInfo
- Publication number
- CN102558348A CN102558348A CN2012100638704A CN201210063870A CN102558348A CN 102558348 A CN102558348 A CN 102558348A CN 2012100638704 A CN2012100638704 A CN 2012100638704A CN 201210063870 A CN201210063870 A CN 201210063870A CN 102558348 A CN102558348 A CN 102558348A
- Authority
- CN
- China
- Prior art keywords
- antibody
- chain antibody
- chain
- variable region
- influenza virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention discloses a single-chain antibody ScFv for resisting influenza viruses, a preparation method for the single-chain antibody ScFv, application of the single-chain antibody ScFv, a gene for encoding the single-chain antibody ScFv, a carrier containing the gene, a host cell and the like. The single-chain antibody ScFv for resisting the influenza viruses is one of the following proteins: 1) a single-chain antibody formed by connecting a heavy chain variable region and a light chain variable region of the antibody through a linker peptide, wherein an amino acid sequence of the light chain variable region and an amino acid sequence of the heavy chain variable region are shown as SEQ ID NO.1 and SEQ ID NO.2 in a sequence table respectively; and 2) a derived antibody obtained by improving the single-chain antibody in step 1), wherein the improvement comprises the deletion, substitution or insertion of amino acid, and the derived antibody has the antibody activity of resisting H1N1 influenza viruses. The molecular weight of the single-chain antibody is about 27kD; and the single-chain antibody can specifically identify the H1N1 influenza viruses and block the combination of the viruses and natural serum. The single-chain antibody can be used for diagnosing, preventing, controlling and treating the infection of the H1N1 influenza viruses, or is used for antiviral breeding of transgenic animals.
Description
Technical field
The invention belongs to bioengineering field.The present invention relates to the single-chain antibody ScFv of a kind of anti-H1N1 influenza virus, and the gene of this single-chain antibody of encoding, contain carrier and host cell of this gene etc.
Background technology
A type influenza virus can infect various birds, mammal such as pig, horse and the extra large living Mammals etc. except that human; Cause the acute respiratory transmissible disease; Its popular greatly harm humans is healthy and world economy brought about great losses, and is one of mass-sending property disease that is difficult to effect a radical cure.According to hemagglutinin (Hemagglutinin, HA) and neuraminidase (Neuraminidase, the NA) difference of protein antigenicity have identified 16 kinds of hypotypes and 9 kinds of hypotypes up to now respectively.At present from all parts of the world only be separated to from pig in succession have H1N1 at least, the influenza virus of tens of kinds of different blood serum subtypes such as H1N2, H1N7, H2N3, H3N2, H4N6, H5N1, H9N2, wherein getting in touch with the performance clinical symptom is the most again H1N1 and H3N2.
In March, 2009; Running initially, rapid spread is extremely global in a short time in Mexican Influenza A H1N1, by in August, 2010, comprises that China whole world has 214 countries and regions reports to find " Influenza A H1N1 "; Confirmed cases have at least 18449 people dead; Have much the gesture that causes global flu outbreak, world economy and social stability have been caused tremendous influence, the research of antibody and related reagent has extremely important public hygienics meaning to the diagnosis and the prevention of influenza.Though influenza virus sub-strain is numerous, its NP is conservative relatively, and research shows; The isolating virus strain of different hosts is found; The NP gene is quite conservative, and the amino acid difference is no more than 11% at most, has the specificity of type and kind; Being the basis of the classification and the diagnosis of influenza virus type, also is the important object that the research virological immunology reacts and develops vaccine.M2 albumen in the M gene coded protein is the conservative non-glycosylated transmembrane protein of the peculiar a kind of structure of A type influenza virus; And outer region amino acid sequence (the 1st～25) high conservative of the proteic film of M2; And the function that the proteic antiserum(antisera) of M2 has the inhibition influenza virus to duplicate; Viral hemagglutinin is relevant with virus intrusion host cell in addition, and with viral infectivity, visible is feasible with the Antibody of Influenza gene as disease-resistant gene in theory in its antibody capable.Seek the corresponding antibody gene of these albumen of virus, be used for preventing, controlling and cure the infection of influenza virus, and these need to screen fast and efficiently platform-the phage antibody library technique of expression specificity antibody and gene thereof.
In addition, the variable region gene of clonal antibody and it is imported that fertilised non-human eggs carries out kind is conversion is cultivated the transgenic animal that contain this kind gene, will another new way be provided for the anti-virus infection breeding.The report of the disease-resistant transgenic mouse of the variable region gene of external existing commentaries on classics antibody.Domesticly also do not see similar research report, but the gene that utilizes phage antibody library technique to obtain antiviral single-chain antibody fast comes true already, during the animal transgenic technology also is in development and improves.As long as two kinds of technology are combined, be expected to obtain the antiviral breeding animal of the variable region gene of antibody.
In immunotherapy method, excessive in addition because of heterology and molecular weight between the kind of antibody, can cause host's defensive reaction, single-chain antibody ScFv then can avoid an above-mentioned treatment difficult problem; ScFv is the minimum antibody fragment with complete antibody binding site, and size is 1/6 of a complete antibody, and have the following advantages: (1) has kept the specificity of antibody, has significantly reduced immunogenicity; (2) tissue penetration is strong, and molecular weight is little, is prone to get into the microcirculation of target entity, and removes also very fast in the body; (3) no FC section can be used as oriented carrier, with enzyme or cytokine and medicine connection structure bifunctional antibody, is beneficial to treatment and diagnosis; (4) be easy to genetic manipulation and engineered mass production; (5) can in multiple different protokaryon, eukaryotic expression system, express, like expression systems such as intestinal bacteria, yeast, plant, insect, mammalian cells.Therefore, anti-swine flu phage single-chain antibody technology has important in theory meaning and using value.
About domestic not the appearing in the newspapers of research of influenza virus single-chain antibody ScFv, also do not appear in the newspapers inside and outside the applicant country of related patent U.S. Patent No. at present.
Summary of the invention
Therefore, the present invention's technical problem that will solve just provides the single-chain antibody of resisiting influenza virus.
The technical scheme that the present invention solves the problems of the technologies described above is following:
One of technical scheme of the present invention is: a kind of single-chain antibody of resisiting influenza virus, and it is one of following protein:
1) single-chain antibody that is formed by connecting through the joint peptide antibody heavy chain variable region and variable region of light chain, wherein the aminoacid sequence of variable region of light chain and weight chain variable region amino acid sequence are respectively shown in SEQ ID NO.1 in the sequence table and SEQ ID NO.2;
2) as 1) described single-chain antibody is through transforming the antibody of deriving that obtains, and described transformation comprises amino acid whose disappearance, replacement or insertion, and this antibody of deriving has the antibody activity of resisiting influenza virus.
Wherein, described joint peptide can be conventional.Preferably, described joint peptide is 15-20 the small peptide that amino acid condensation forms.Preferred, its aminoacid sequence is GGGGSGGGGSGGGGS.These 15 amino acid whose flexible links connect and compose single-chain antibody with antibody heavy chain variable region and variable region of light chain.
Two of technical scheme of the present invention is: the gene of the described antibody of encoding.
Preferably, described gene is one of following gene:
1) nucleotide sequence of this genes encoding antibody chain variable region and variable region of heavy chain is respectively shown in SEQ ID NO.3 in the sequence table and SEQ ID NO.4;
2) nucleotide sequence of this genes encoding antibody chain variable region and variable region of heavy chain can be hybridized with the dna sequence dna that SEQ ID NO.3 and SEQ ID NO.4 limit respectively under rigorous condition, and the protein of this genes encoding has the antibody activity of resisiting influenza virus.
Three of technical scheme of the present invention is: contain said expression carrier.
Wherein, described expression vector can be the conventional various carriers in this area, as long as can in the host, duplicate and stably express, any plasmid and carrier can be used.A key character of expression vector is to contain copy-point, promotor, marker gene and translational control element usually.Like commercially available plasmid (suitable carrier has pLG338, pACYC184, pBR322, pUC18, pUC19, pKC30, pRep4, pHS1, pHS2, pMBL etc. in the intestinal bacteria), clay (pHZ132), phage or virus vector (retrovirus vector; Adenovirus carrier) etc. said plasmid representative is a fraction of maybe plasmid, and other plasmids are that the technician is known.Preferred pET28a plasmid.Can adopt method structure well known in the art to contain the recombinant expression vector of the single-chain antibody of said resisiting influenza virus, like the extracorporeal recombinant DNA technology, the interior recombinant technology of DNA synthetic technology and body etc.The gene of the single-chain antibody of said resisiting influenza virus can effectively be connected on the suitable promotor of expression vector, and is synthetic to instruct mRNA's.Described promotor can be conventional known various promotors, as long as can in host cell, bring into play the function of promotor.Like colibacillary lac or trp promotor, phage promoter, retrovirus and some other known may command gene in protokaryon or an eukaryotic cell or the heavy pound of its a virus expression promoter.Said expression vector also comprises ribosome bind site and the transcription terminator that translation initiation is used.In addition; How described expression is carried can also comprise one or more selected markers; To be provided for selecting the phenotypic character of transformed host cells, to cultivate dihydrofolate reductase gene, neomycin resistance gene and green fluorescent protein (GFP) gene of usefulness or be used for colibacillary tsiklomitsin or ampicillin resistance gene etc. like eukaryotic cell.
Four of technical scheme of the present invention is: the host of containing said expression vector.
Described host cell can be a prokaryotic cell prokaryocyte, like bacterial cell; The low eukaryotic cell that waits is like yeast cell; Higher eucaryotic cells is like mammalian cell.Representative example has: intestinal bacteria, streptomycete; The bacterial cell of Salmonella typhimurium; Eukaryotic cell such as yeast, vegetable cell; Insect cells such as fruit bat S2 or Sf9; CHO, COS, 293 cells or zooblasts such as Bowes and melanoma cell.The preferred intestinal bacteria of described host cell.
Five of technical scheme of the present invention is: a kind of method for preparing the single-chain antibody of described anti-H1N1 influenza virus; Comprise described expression vector conversion, transduction or transfection host cell; Cultivate host cell, protein isolates from culture obtains anti-H1N1 influenza virus single-chain antibody.
Available routine techniques well known to those skilled in the art, with the recombinant DNA transformed host cell, culture transformation son, the abduction delivering target protein, and recombinant protein carried out separation and purification.
Substratum and culture condition all can be substratum and the culture condition of cultivating the host that sets out.
The separation purification method of recombinant protein also can adopt the separation method of the conventional recombinant protein in this area, when expressed proteins is inclusion body, also comprises the step to renaturing inclusion bodies.
Six of technical scheme of the present invention is: the application of described antibody in the preparation Tamiflu.
Any segmental primer of amplification single-chain antibody gene of the present invention is to also within protection scope of the present invention.
Raw material that the present invention is used or reagent except that specifying, all commercially available getting.
Than prior art, beneficial effect of the present invention is following:
Single-chain antibody of the present invention is a mouse source property, can resist the H1N1 influenza virus, have the neutralization activity.Molecular weight is about 27kD.During amalgamation and expression, add that label protein (6kD) molecular weight of amalgamation and expression has about 33KD altogether.Single-chain antibody of the present invention can specific recognition H1N1 influenza virus, and can blocking virus and the combining of natural sera.
Single-chain antibody gene of the present invention can prepare two valencys or multivalence single-chain antibody, intrabody and other small molecular antibodies, perhaps as the target vehicle.
Single-chain antibody of the present invention can be used for diagnosing, prevent, controlling and cure the infection of H1N1 influenza virus, perhaps is used for antiviral transgenic animal breeding, is used to prepare relevant medicine or reagent.
Description of drawings
Below in conjunction with description of drawings characteristic of the present invention and beneficial effect.
Fig. 1 shows the nucleotide sequence and the aminoacid sequence of SIVHL1 single-chain antibody, between variable region of heavy chain and light chain variable region sequence, is described flexible joint.
Fig. 2 shows nucleotide sequence and the aminoacid sequence of the variable region of heavy chain VH of SIVHL1, is the aminoacid sequence of expection under this nucleotide sequence, and at the aminoacid sequence underscore is said VH-CDR1, VH-CDR2 and VH-CDR3.
Fig. 3 shows the nuclear former times acid sequence of the variable region of light chain VL of SIVHL1, is the aminoacid sequence of expection under this nuclear former times acid sequence.At the aminoacid sequence underscore is said VL-CDR1, VL-CDR2 and VL-CDR3.
Fig. 4 is that the antibody of pcr amplification is heavy, the agarose electrophoresis figure of chain variable region gene.M:2000bpDNAmarker; 1,2: variable region of light chain VL gene amplification product; 3,4: variable region of heavy chain VH gene amplification product.
Fig. 5 is the PCR product electrophorogram of single-chain antibody ScFv gene.M:2000bp DNA marker; 1,2,3, the scFv fragment of 4:SOE PCR assembling.
Fig. 6 is carrier pCANTAB5E-ScFv structural representation and MCS.
Fig. 7 shows the multifarious analysis of single-chain antibody.
Fig. 8 SIVHL1-pET28a (+) recombinant plasmid enzyme is cut the evaluation gel electrophoresis figure.M1:15000bp dna molecular quality standard; M2:2000bp dna molecular quality standard; 1,2 is the double digestion evaluation of recombinant plasmid pET28a (+)-SIVHL1.
Fig. 9 wherein a is the tomograph of SIVHL1 heavy chain VH, and b is the tomograph of light chain VL, and c is the tomograph of SIVHL1 total length.
The left figure of Figure 10 is the SDS-PAGE electrophorogram of the SIVHL1-Histag recombinant expression protein of solubility, describes the result of the SIVHL1 process refolding purifying of expressing, and right figure utilizes the WesternBlot method to identify the SIVHL1 that separation and purification obtains.M
1, M
2Be molecular weight of albumen Marker; 1 and 2, the SIVHL1-Histag recombinant protein of purifying, 3 and 4, blank; 5,6 is anti-Histag antibody test SIVHL1-Histag albumen.
Figure 11 is a graphic representation, describes different concns single-chain antibody SIVHL1 and A/PR/8/H1N1 influenza virus specificity bonded indirect ELISA experimental result.
Figure 12 is a graphic representation, describes different concns single-chain antibody SIVHL1 and the domestic isolating A type H1N1 influenza virus specificity bonded ELISA experimental result of two strains.
Embodiment
The inventor is extensive studies through going deep into, and has obtained the single-chain antibody of a strain anti-A type H1N1 influenza virus.The single-chain antibody immunogenicity is little, and tissue penetration is strong, is prone to get into target, is very beneficial for production operation.It is active that single-chain antibody provided by the invention has the neutralization of influenza virus, can block combining of influenza virus and serum, and the H1N1 influenza virus is had specificity avidity.The present invention also provides the preparation method and the application of this single-chain antibody.
The inventor is through making up the phage display single-chain antibody library, and through the cyclical operation of " one enrichment of enrichment one wash-out ", therefrom screening obtains this single-chain antibody.And then the inventor analyzes the gene that has obtained this single-chain antibody; And this gene is used for recombinant vectors; Make up the genetic engineering bacterium of expressing this single-chain antibody, thereby can simply adopt bionic this single-chain antibody of method preparation in a large number, thereby accomplished the present invention.
The structure of phage display single-chain antibody library, screening
(1) light, the heavy chain mix primer of design and synthetic mouse antibodies; Utilize primer from the mouse boosting cell gene of H1N1 influenza infection, to obtain its light, heavy chain variable region gene fragment through pcr amplification; Through oligonucleotide chain (Linker) said two fragments are connected, construct the single-chain antibody gene fragment;
(2) through overlapping extension PCR (SOE-PCR), through flexible polypeptide Linker joint (Gly
4Ser) by the VH-Linker-VL mode VH gene and VL gene are spliced into the ScFv gene fragment at random.The ScFv gene is connected double digestion (sfiI and NotI) back respectively with pCANTAB 5E carrier, transforms host bacterium TG1, coating SOB-AG is dull and stereotyped, 30 ℃ of overnight cultures.The a plurality of single bacterium colonies of picking are cultivated and are extracted recombinant plasmid, utilize the universal primer on the expression vector pCANTAB5E to carry out PCR evaluation and order-checking, confirm the variety of antibody with this.
The primer of single-chain antibody heavy chain VH of wherein increasing is:
VHa：5-GTCCTCGCAACTGCGGCCCAGCCGGCC?ATGGCCSAGGTSMARCTGCAGSAGTC-3；
VHb：5-GCCAGAGCCACCTCCGCCTGAACCGCCTCCACC?TGAGGAGACGGTGACCGTGGT-3。
The primer of amplification single-chain antibody light chain VL is:
VLc：5-TCAGGCGGAGGTGGCTCTGGCGGTGGCGGATCGGACATYGAGCTCACYCAGTCTCC-3
VLd：5-GAGTCATTCTGCGGCCGCCCGTTTBAKYTCCARCTTKGTSCC-3。
Wherein antibody heavy chain variable region has nucleotide sequence as shown in Figure 2 and aminoacid sequence.
Wherein antibody chain variable region has nucleotide sequence as shown in Figure 3 and aminoacid sequence.
(3) the reorganization phagemid transforms amber inhibition type e. coli tg1, through helper phage M13K07 rescue, makes up the phage single-chain antibody storehouse.With the H1N1 influenza virus is antigen coated immunity pipe, through the 3 affine enrichment screenings taken turns, identifies positive recombinant antibodies through Phage-ELISA, and the positive colony phage is checked order, and obtains corresponding gene.And screen the positive colony phage ScFv activity that obtains with virus blocking-up ELISA and sandwich ELISA and measure.
(4) will screen the positive antibody gene that obtains with protein expression vector pET-28a-c (+) respectively enzyme cut and be connected; Be converted in the non-amber inhibition type e. coli bl21 (DE3) and carry out the IPTG abduction delivering; Single-chain antibody to the inclusion body formal representation carries out refolding renaturation, thereby obtains the soluble single-chain antibody of anti-swine flu, and this soluble single-chain antibody is the product of the His-tag label amalgamation and expression on purpose single-chain antibody gene fragment and the expression vector; With this single-chain antibody is one anti-; With anti-His-tag antibody is two anti-, adopts indirect ELISA technology for detection purpose single-chain antibody, but confirms this single-chain antibody specific recognition H1N1 influenza virus.
The single-chain antibody of resisiting influenza virus
The single-chain antibody of anti-H1N1 influenza virus provided by the invention; 1) be the single-chain antibody that is formed by connecting through the joint peptide antibody heavy chain variable region and variable region of light chain, wherein the aminoacid sequence of variable region of light chain and weight chain variable region amino acid sequence are respectively shown in SEQ ID NO.1 in the sequence table and SEQ ID NO.2.And joint peptide wherein is conventional; The joint peptide that connects antibody heavy chain variable region and variable region of light chain in the promptly conventional single-chain antibody can use in the present invention; 15-20 small peptide that amino acid condensation forms preferably; Best aminoacid sequence is GGGGSGGGGSGGGGS, and it is 15 amino acid whose flexible links.
A most preferred embodiment of the present invention is: the single-chain antibody of anti-H1N1 influenza virus (SIVHL1), 732 Nucleotide of total length have 244 amino acid (Fig. 1).Have 122 amino acid whose variable region of heavy chain (Fig. 2) and 107 amino acid whose variable region of light chain (Fig. 3), through 15 amino acid whose flexible links (GGGGSGGGGSGGGGS).
It is active that single-chain antibody provided by the invention has the neutralization of H1N1 influenza virus, can block combining of influenza virus and serum, and the H1N1 influenza virus is had specificity avidity.
The single-chain antibody of resisiting influenza virus provided by the invention also can be 2): as 1) described single-chain antibody is through transforming the antibody of deriving that obtains; Described transformation comprises amino acid whose disappearance, replacement or insertion, and this antibody of deriving has the antibody activity of resisiting influenza virus.Wherein, disappearance, replace or the amino acid whose quantity inserted is one to several.Described " several " are meant two to less than 100, and are better for 30.Such as the fusion rotein that adds an external secretion signal peptide or EST, as long as this fusion rotein still has the antibody activity of resisiting influenza virus, all within protection scope of the present invention.A preferred embodiments of the present invention is the fusion rotein of described single-chain antibody and His-tag, and wherein, His-tag is made up of a plurality of as 6 His amino acid.That is to say that as long as the present invention finds by 1) antibody activity of deutero-protein resisiting influenza virus, and deriving mode is as stated, then can reach goal of the invention of the present invention.Described single-chain antibody can separate acquisition from the expressor of recombinant expressed this single-chain antibody, also can obtain by synthetic.
According to the present invention, in aminoacid sequence shown in SEQ ID No.1 or 2, carry out the sudden change of 1-3 amino-acid residue, also can obtain the above-mentioned antibody of deriving, but still keep the antibody activity of resisiting influenza virus.
Among the present invention, ScFv claimed again in term " single-chain antibody ", is at dna level antibody heavy chain variable region gene and chain variable region gene to be linked up with one section suitable oligomerization nuclear former times acid (joint), and making it to express becomes a single skin chain.The ScFv molecular weight is little, and is simple in structure, is the minimum antibody fragment with complete antigen binding site.
Natural antibody comprises heavy chain (H chain) and light chain (L chain).Interchain is connect by disulfide linkage and non covalent bond.Heavy chain and light chain all are divided into constant region and variable region.The variable region is positioned at the two arms end of " Y ".Comprising Fab (antigen-binding fragment, Fab), determined the antigenic specificity of this antibodies.The shank of " Y " is claimed FC (crystalline fragment, crystallizable fragment), and sugar is combined on the FC.And single-chain antibody only comprises heavy chain variable region gene and variable region of light chain, does not comprise constant region, does not also comprise FC, and molecular weight reduces greatly.Single-chain antibody is easier to express and transform at gene level.Be easy in multiple expression system as expressing in prokaryotic cell prokaryocyte, yeast, plant insect and the cells of mamma animals, thus can mass production and cost low.Heterology is low, penetrance is strong, clean up fast.Do not contain the Fc section, not with the Fc receptors bind, can reduce the disadvantageous effect of bringing because of the Fc acceptor that extensively distributes, thereby be with a wide range of applications.Can be used as oriented carrier clinical some disease is carried out video picture level diagnosis and targeted therapy, neutralization virus and toxin, aspects such as intracellular immunity and immunodetection.
The sequence of complementary determining region CDR1, CDR2 and CDR3 that the variable region of heavy chain of single-chain antibody of the present invention and variable region of light chain comprise is seen Fig. 2 and 3.
The encoding sox of single-chain antibody
The encoding sox of the single-chain antibody of the present invention or the antibody of deriving is the gene of the various encode such amino acid sequences of routine, as long as the aminoacid sequence that this gene translation comes out is the single-chain antibody of the present invention or the antibody of deriving.As is known to the person skilled in the art, antibody heavy chain variable region and variable region of light chain can be other any base sequences of aminoacid sequence shown in the SEQ ID No.1 (or No.2) in the code sequence tabulation.For example, because the degeneracy of codon, the base sequence of the aminoacid sequence of coding SEQ ID No.1 (or 2) not only is confined to SEQ ID No.3 (or 4).And wherein, a preferred embodiments is: the nucleotide sequence of encoding antibody variable region of light chain is shown in SEQ ID NO.3 in the sequence table; The nucleotide sequence of encoding antibody variable region of heavy chain is shown in SEQ ID NO.4 in the sequence table.
The present invention also can or increase the homologue that a polynucleotide is provided through suitable introducing replacement, disappearance, change, insertion.The homologue of polynucleotide can make through one or more bases of base sequence SEQ ID NO.3, SEQ ID NO.4 are replaced, lacked or increase in keeping the enzymic activity scope among the present invention.The homologue of polynucleotide also refers to the promoter mutation body.Promotor or signal sequence before described base sequence can change through replacement, insertion or the disappearance of one or more Nucleotide, but these functions that change promotor do not have negative impact.And the sequence through changing promotor or even use more effective promotor wholly replace from difference kind organism; Can improve the expression level of target protein; For example can come from the promotor of Gram-negative bacteria, like cos, tac, trp, tet, trp-tet, lpp, lac, T7, T5, T3, gal, trc, ara, SP6 etc. the favourable adjusting sequence of the present invention; Or be present among Gram-positive promotor amy and the SPO2; Or come from fungi or Yeast promoter ADC1, AC, P-60, CYC1, GAPDH, TEF, rp28, ADH etc.; Perhaps from the pyruvic carboxylase promotor of Hansenula or manual activation etc.
The encoding sox of the single-chain antibody of the present invention or the antibody of deriving also can be that the nucleotide sequence of its antibody chain variable region and variable region of heavy chain under rigorous condition can be hybridized with the dna sequence dna that SEQ ID NO.3 and SEQ ID NO.4 limit respectively, and the protein of this genes encoding has the antibody activity of anti-H1N1 influenza virus.Wherein, Under rigorous condition, hybridize and to carry out according to the mode of describing in " molecular cloning ": Cold Spring Harbor Laboratory Press, the general scheme in the molecular biology (Current Protocols in Molecular Biology).Specifically, hybridization can be carried out according to following steps, is loaded with the DNA to be measured that transcribed or film and label probe of RNA molecule hybridized with one in hybridization buffer.The dilution suppressor factor and 2～8 * SSC that consist of 0.1wt%SDS, 5wt% sulfuric acid DEXTRAN 500.000, a box 1/20 of hybridization buffer.20 * SSC is the solution that the Hydrocerol A of 3M sodium-chlor and 0.3M is formed.Hybridization temperature is 50～70 ℃.After cultivating several hrs or spending the night, clean film with cleaning buffer solution.Cleaning temperature is room temperature, more preferably hybridization temperature.Cleaning buffer solution consist of 6 * SSC+0.1wt%SDS solution, more preferably 5 * SSC+0.1wt%SDS.After having cleaned film, just can discern DNA or RNA molecule through the mark on the probe of being hybridized at DNA or RNA intramolecularly with this cleaning buffer solution.
The expression vector that contains single-chain antibody gene
Recombinant expression vector of the present invention can be connected in single-chain antibody gene of the present invention to make up on the various expression vectors and form through this area ordinary method.Described carrier can be the conventional various carriers in this area; Like commercially available plasmid (suitable carrier has pLG338, pACYC184, pBR322, pUC18, pUC19, pKC30, pRep4, pHS1, pHS2, pMBL etc. in the intestinal bacteria), clay (pHZ132), phage or virus vector (retrovirus vector; Adenovirus carrier) etc. said plasmid representative is a fraction of maybe plasmid, and other plasmids are that the technician is known.Recombinant vectors according to the invention preferably adopts the pET28a plasmid.
The host of containing the single-chain antibody expression vector
Described host microorganism according to the invention can be the conventional various host microorganisms in this area, as long as can satisfy duplicating voluntarily that recombinant expression vector can be stable, and entrained reductase gene of the present invention can be got final product by effective expression.The preferred intestinal bacteria of the present invention, more preferably ETEC (E.coli) BL21 (DE3) or ETEC (E.coli) DH5 α.The aforementioned recombinant expression plasmid of the present invention through conventional method for transformation, is converted among the E.coli BL21 (DE3), get final product the preferred engineering strain of the present invention.
The preparation method of single-chain antibody
The method that the present invention prepares the single-chain antibody of described resisiting influenza virus can be a synthetic, can be referring to various document, and the synthetic or solid phase synthesis etc. like the liquid phase of polypeptide.Also can be the bionic method of utilizing, the expressor of single-chain antibody of the present invention be expressed in preparation, from expressor, produces to prepare.Comprise that with described expression vector conversion, transduction or transfection host cell cultivate host cell, protein isolates from culture obtains the resisiting influenza virus single-chain antibody.Wherein, described recombinant expressed transformant is ditto given an account of and is continued, and the present invention can obtain through recombinant expressed son of the present invention is converted into host microorganism.Wherein, used substratum can be any substratum that makes the transformant growth and produce nitrilase of the present invention in this area in the recombinant expressed transformant of described cultivation, preferred LB substratum: peptone 10g/L, and yeast extract paste 5g/L, NaCl 10g/L, pH 7.0.Cultural method and culture condition do not have special limitation; Cultural method can carry out appropriate selection with the different of factor such as cultural methods by this area general knowledge according to host type with culture condition, as long as make transformant can grow and produce single-chain antibody of the present invention.Other culture transformation body concrete operations all can be undertaken by this area routine operation; Preferred following method: will the present invention relates to recombination bacillus coli (the preferred recombinant expressed transformant of E.coli BL21 (DE3) is seeded in the LB substratum that contains kantlex and cultivates, as the optical density(OD) OD of nutrient solution
600When reaching 0.5-0.7, be under the inducing of sec.-propyl-β-D-sulfo-galactopyranoside (IPTG) of 0.1-1.0mmol/L (preferred 0.5mmol/L) at final concentration, efficiently express single-chain antibody of the present invention.Target protein carries out renaturation and purifying mainly with the inclusion body formal representation to inclusion body protein.
The application of single-chain antibody
Single-chain antibody of the present invention is a mouse source property, can resisiting influenza virus, to have a neutralization active.Molecular weight is about 27kD.During amalgamation and expression, add that label protein (6kD) molecular weight of amalgamation and expression has about 33KD altogether.Single-chain antibody of the present invention can specific recognition H1N1 influenza virus, and can blocking virus and the combining of natural sera.Can be used for preparing the product of preventing and treating the porcine influenza disease; Can be used for preventing, controlling and cure the infection of H1N1 influenza virus; Perhaps be used for antiviral transgenic animal breeding, be used to prepare relevant medicine or reagent, and be used for porcine influenza relevant diagnostic studies, therapeutic studies.
Two or more scFv are connected into multivalence scFv with a plurality of antigen binding sites; On structure, function more near parental antibody; More responsive with antigen binding ratio monovalent scFv, avidity is higher, and almost the antigen combined function with parental antibody is consistent.Single-chain antibody gene of the present invention can prepare two valencys or multivalence single-chain antibody, intrabody and other small molecular antibodies, perhaps as the target vehicle.
In Tamiflu, one of activeconstituents is the single-chain antibody or the antibody of deriving of anti-H1N1 influenza virus of the present invention.When needing, in said medicine, can also add one or more pharmaceutically acceptable carriers.Described carrier comprises thinner, vehicle, weighting agent, absorption enhancer or the absorption carrier etc. that pharmaceutical field is conventional.This medicine can be processed various ways such as injection, tablet, pulvis, capsule, oral liquid.Ordinary method preparation according to pharmaceutical field.
Further specify the present invention with embodiment below, but the present invention is not limited.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, or the condition of advising according to manufacturer." room temperature " described in the embodiment is meant the temperature of the operation room that makes an experiment, and is generally 25 ℃.
The extraction of total RNA of embodiment 1 immune mouse spleen cell and rt synthesize complementary DNA
1.1 the extraction of total RNA of the splenocyte of A/PR/8/H1N1 influenza infection mouse
((A/Puerto-ico/8/34 (H1N1) is laboratory virus commonly used to influenza virus PR8, and its biological characteristics can be represented H1N1 influenza virus characteristics to get the antigen influenza virus.(Lv Cuixia etc., clear battalion induce sweat mixture to the influence of influenza virus infection A/PR/8/H1N1 model mice macrophage phagocytic function, Shandong Traditional Chinese Medicine University's journal, the 34th the 5th phase of volume, in September, 2010,457-458 page or leaf.) culture supernatant; Should be inoculated in mdck cell (available from Institute Of Biochemistry And Cell Biology, Shanghai Institutes For Biological Sciences, Chinese Academy Of Sciences) by virus liquid; Draw cell conditioned medium behind the 48h, this is the cell culture supernatant that contains virus, is 1 * 10 through measuring virus titer
5TCID
50/ mL is put-70 ℃ of cryogenic refrigerators and is preserved subsequent use.
Collunarium immunoinfective Balb/C mouse (available from Shanghai Slac Experimental Animal Co., Ltd.) is adopted in 100 times of A/PR/8/H1N1 influenza virus cell culture fluid supernatant dilutions, and booster immunization once after two weeks.The mouse tail vein is got blood after one week, and ELISA identifies to have high titre protection antibody, selects to tire the highest mouse; It is put to death the back take out spleen adding liquid nitrogen grinding; Press the 50-100mg spleen and add 1mLTrizol reagent, room temperature leaves standstill 5min, adds the 0.2mL chloroform by every 1mLTrizol and adds chloroform; Thermal agitation 15s repeatedly, room temperature left standstill 2-3 minute.4 ℃, the centrifugal 15min of 12000g/min draws aqueous portion in the centrifuge tube of another clean 1.5mL, adds the 0.5mL Virahol by every 1mlTrizol and adds Virahol, puts upside down mixing, in-20 ℃ of deposition 30-60min, the centrifugal 10min of 12000g/min.Keep deposition, 70% washing with alcohol one time is dried in the air, DEPC water dissolution precipitated rna.
1.2 rt synthesizes cDNA
Rt is to be template with RNA, under archaeal dna polymerase (reversed transcriptive enzyme) effect that RNA instructs, utilizes 4 kinds of dNTP to be raw material, holds process synthetic with 5 '-3 ' direction and RNA complementary DNA chain at 3 ' of primer.With total RNA of the immune spleen cell that extracts is that the step of the synthetic cDNA of template is specially: get oligo (dt) 18 primer (0.5 μ g/ μ L) 1 μ L, the RNA volume that calculates; It is 12 μ L that DEPC water is supplied, and mixes rearmounted 65 ℃, and 5min places rapidly on ice; (specification sheets of (Promega company) adds each reagent successively, and is slight centrifugal back in 42 ℃, 60min according to the reverse transcription test kit; 70 ℃, 5min deactivation ThermoScript II, with reverse transcription product cDNA in-70 ℃ of preservations.
2.1 the amplification of repertoire antibody variable region gene
Be that template is carried out PCR reaction increase respectively antibody gene heavy chain and variable region of light chain with cDNA.Concrete steps are in a 0.2mlPCR pipe, to add following reagent and carry out the variable region of heavy chain amplification: immune spleen cell cDNA 4 μ L; 10 * PCR buffer, 5 μ L; DNTP (10mM) 5 μ L; Upstream and downstream primer 1 μ L; Taq (5U/ μ L) 0.5 μ L adds the sterilization ultrapure water and puts 50 μ L.Add following reagent in the another PCR reaction tubes and carry out the variable region of light chain amplification: immune spleen cell cDNA4 μ L; 10 * PCR buffer, 5 μ L; DNTP (10mM) 5 μ L; Each 1 μ L of upstream and downstream primer; Taq (5 μ/μ L) 0.5 μ L adds the sterilization ultrapure water and puts 50 μ L.Slowly with little rifle head mixing aforesaid liquid and centrifugal momently.Amplification condition: 94 ℃ of preparatory sex change 4 minutes, 94 ℃ of sex change are 30 seconds then, 55 ℃ of annealing 30 seconds, 72 ℃ were extended totally 30 circulations 1 minute.
The primer of VH of wherein increasing is:
VHa：5-GTCCTCGCAACTGC
ATGGCCSAGGTSMARCTGCAGSAGTC-3
VHb：5-
TGAGGAGACGGTGACCGTGGT-3。
The primer of amplification VL is:
VLc：5-
GACATYGAGCTCACYCAGTCTCC-3
VLd：5-GAGTCATTCT
CCGTTTBAKYTCCARCTTKGTSCC-3。
Annotate: B=T, C, G; K=T, G; M=A, C; R=A, G; S=G, C; W=A, T; Y=C, T.
Square frame is respectively restriction endonuclease SfiI and NotI.Italicized item is the part of amplification Linker sequence, and black matrix adds the complementary portion that italicized item is Linker.PCR result band occurs respectively between about 360bp and 320bp, conform to the size of expection, sees Fig. 4.
2.2 single-chain antibody (scFv) pulsating splicing and purifying at random
VH among the scFv and VL are connected together by Linker (joint); The design of Linker has material impact to the avidity that keeps parental antibody; It should not disturb the spatial folding of VH and VL; Not overslaugh antigen-binding site does not cause that molecular dynamics changes, and reduces proteolytic enzyme as far as possible and attacks and prevent the ScFv gathering.The most frequently used Linker sequence is by 3 coding wetting ability pentaamino acid (Gly of unit now
4Ser) constitute.Wherein glycocoll is that molecular mass is minimum, and the amino acid that side chain is the shortest can increase the snappiness of side chain, and Serine is the strongest amino acid of wetting ability.Its orientation has dual mode: VH-Linker-VL or VL-Linker-VH.Two kinds of building modes do not have obvious influence to specificity and the avidity of ScFv.But can cause the difference of intestinal bacteria secreting, expressing.The assembling of single-chain antibody ScFv of the present invention adopts overlapping extension (SOE) with joint (G
4S)
3Dna fragmentation clone's antibody is light, heavy chain variable region gene connect, constitute 5 ' VH-Linker-VL, 3 ' form.Concrete steps are: the above-mentioned VH that increases and VL gene segment are separated, reclaim with 1.5% agarose gel electrophoresis respectively; Then VH and VL balanced mix are carried out overlapping extension PCR with assembling ScFv segment as template; Condition is 94 ℃ of 1min sex change; 55 ℃ of 1min annealing, 72 ℃ of 1min extend totally 30 circulations.The PCR product is the single-chain antibody gene segment, is the linker sequence of 45bp: GGTGGAGGCGGTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGATCG between VH and the VL gene, and 15 amino acid of encoding altogether are (GGGGS)
3, the sepharose with 1.5% reclaims, and the result sees Fig. 5.
Being connected of embodiment 3 single-chain antibodies and phasmid carrier, the structure in primary antibody storehouse and the analysis of antibody diversity
3.1 the structure of being connected of single-chain antibody gene and phasmid carrier, single-chain antibody library
Use T4DNA ligase enzyme (Promega), will be connected with pCANTAB5E carrier (available from Pharmacia company) with the scFv fragment that the NotI enzyme is cut processing through sfiI.To connect product and be transformed into 100 μ L TG1 competent cells, add 2 * YT substratum of 37 ℃ of preheatings of 900 μ L then, 37 ℃ of shaking culture 1h; Get the bacterium liquid 100 μ L that the step transforms the back cultivation; Do the gradient doubling dilution with 2 * YT nutrient solution, coating SOB-AG is dull and stereotyped, 30 ℃ of overnight cultures.Single colony count on the counting flat board calculates that the antibody library storage capacity is 3x10
6The remaining bacterium liquid that transforms the back cultivation adds 10mL 2 * YTGA (Glucose:2%, Amp:100 μ g/mL), and 37 ℃ are cultured to A600=0.5, make bacterium reach logarithmic phase.Add 2 * 10
10Phage M13K07 (available from Pharmacia company) cultivates 1h for 37 ℃, and the centrifugal 10min of 4000r/min resuspendedly is deposited in 200mL 2 * YT2A K (Amp:100 μ g/mL, kantlex: 50 μ g/mL), 37 ℃ of shaking culture are spent the night.Behind the centrifugal 10min of 4000r/min; (20%PEG8000 is 2.5mol/LNaCl) in 4 ℃ of deposition phage 30min, the centrifugal 20min of 9000r/min to add the PEG/NaCl of 1/5 volume; The deposition phage is resuspended among the PBS that 2mL contains 10g/L BSA; The centrifugal 5min of 12000r/min, supernatant promptly obtains the phage single-chain antibody storehouse through 0.45 μ m membrane filtration.
3.2 the multifarious analysis of single-chain antibody
10 clones of picking at random are with sfiI and NotI double digestion, preliminary evaluation positive colony.Plasmid extracts and endonuclease reaction is operated identical with above step.The pCANTAB5E-scFv synoptic diagram is seen Fig. 6.
With S1, S6 (S1:5-CAACGTGAAAAAATTATTATT-3; S6:5-GTAAATGAATTTTCTGTATGAGG-3) check order for primer; Remove 2 cloning and sequencings and do not have the result; Other 8 clones' (PHL1-PHL8) sequencing result shows that the series arrangement mode is VH-Linker-VL, finds that with mouse immuning ball protein variable region sequences DB Kabat comparison back all sequences all meets mouse weight chain variable region gene structure.VH partly is about 357-367bp, and VL is about 320-330bp, and the linker base sequence between heavy chain and the light chain is all correct.Utilize software DNAstar to carry out sequence alignment, homology reaches more than 82%, and other has comparatively notable difference, and homology is lower than 76%.The result sees Fig. 7.
The enrichment of the single-chain antibody library of embodiment 4 resisiting influenza virus and the screening of specific antibody
The effective carbonate of immunity is encapsulated damping fluid, and (titre is 1 * 10 with A/PR/8/H1N1 influenza virus cell culture fluid supernatant
5PFU/mL) by 1: 5 (volume ratio) dilution (package amount 2mL/ pipe), 4 ℃ are spent the night.Encapsulate and finish, wash pipe 3 times, clap and do with PBS; (37 ℃ were sealed 2 hours for 2% skimming milk PBS, MPBS) sealing immunity pipe with confining liquid; The deblocking liquid that inclines is washed pipe 3 times with PBS, claps and does; In washing process, with above-mentioned acquired elementary phage single-chain antibody storehouse supernatant, according to MPBS: the volume ratio of supernatant=2: 3 is carried out mixing with MPBS and phage supernatant; Add the good immunity pipe of sealing; The 2mL/ pipe behind the jog incubation 30min, left standstill incubation 1.5 hours again; Abandon phage supernatant in the immunity pipe,, with PBS washing 3 times, clap and do again with PBST washing 3 times; Add glycocoll-hydrochloric acid (pH2.2) elutriant, the 2mL/ pipe is behind 37 ℃ of effect 6min; Add Tris (2mol/L pH 7.4) rapidly, the phage solution that the neutralization of 200 μ L/ pipe elutes adds the fresh TG1 bacterium liquid (available from Pharmacia company) (the OD value is about 0.5) of 2mL again; Behind 37 ℃ of effect 1h; At this moment, accomplish the first round and washed in a pan sieve, obtained the one-level antibody library.After getting part bacterium liquid and doing 10 times of gradient dilutions, coating SOBAG plate calculates the phage of output and washes in a pan the sieve amount, and it is 100 μ g/mLamp and 2% glucose that residue bacterium liquid adds final concentration, adds about 4 * 10 simultaneously
10M13 K07 phage, leave standstill incubation 30min after, 250rpm shaking culture 30min again; The centrifugal 10min of 1000 * g removes supernatant, with the gently outstanding cell of 100mL 2 * YT-AK; 37 ℃, 250 change overnight cultures; The beginning next round is washed in a pan sieve, finally takes turns through 3 and washes in a pan sieve, gets the bacterium liquid of acquisition; Do the gradient doubling dilution with 2 * YT substratum, it is dull and stereotyped to get diluent 100 μ L coating SOBAG, 30 ℃ of overnight cultures; Select the flat board of 100-200 the left and right sides bacterium colony of having an appointment, calculate the bacterium colony number, multiply by extension rate, promptly get corresponding storage capacity.Take turns specific enrichment through 3 and wash in a pan sieve, obtained titre and be about 5.0 * 10
4The phage recombinant antibodies storehouse of cfu/mL.Residue bacterium liquid according to: (contain 2 * YT) of 80% sterile glycerol, behind the mixing ,-70 ℃ are frozen, are labeled as three grades of antibody libraries for the above wash-out bacterium of 800 μ L liquid+200 μ L.
The centrifuge tube of getting 72 1.5mL is put on the culturing rack as culture plate, and every hole adds 2 * YT-AG substratum, 400 μ L; The single bacterium colony that grows on the SOBAG flat board during picking is above-mentioned is seeded in top each hole, and this plate is labeled as Master Plate; Master Plate is placed shaking table, 30 ℃, 250rpm, shaking culture is spent the night; Next day, other gets 72 well culture plates, gets 2 * YT-AG that 400 μ L contain 2.5 * 1010pfu/mL M13K07 to every hole, and this plate is designated as P1 Plate; 40 μ L nutrient solutions are got to P1 Plate in every hole from the Master Plate of incubated overnight; P1 Plate is placed shaking table, 37 ℃, 150rpm/min, shaking culture 2 hours, the centrifugal 20min of 1500 * g carefully removes supernatant; Add 400 μ L, 2 * YT-AK nutrient solution to the every hole of P1 Plate, 37 ℃, 250rpm, shaking culture is spent the night; The centrifugal 20min of 1500 * g, it is for use carefully to get supernatant.Get embodiment 1 made 4 ℃ of coated elisa plates of A/PR/8/H1N1 influenza virus cell culture fluid supernatant and spend the night, 2%M PBS (PBS that contains 2% skimming milk) sealing is after the washing; With top acquisition phagocytosis body fluid is one anti-, hatches 2h for 37 ℃, and the anti-M13 monoclonal antibody of HRP mark is two anti-; 37 ℃ of reaction 1h, the washing back adds TMB colour developing liquid, 37 ℃ of reaction 30min; Add 2M sulfuric acid color development stopping; ELIASA 450nm wavelength is surveyed down the OD value, establishes that M13K07 encapsulates control wells (positive control) and blank encapsulates control wells, finds out positive colony (positive colony can be confirmed as in OD value >=0.3 and OD value/OD blank well >=3).ELISA measures the situation that combines of each hole supernatant and A/PR/8/H1N1 influenza virus, and the result finds that 4 strain clones and antigen have positive reaction, and tentatively definite this 4 strain recombinant clone is positive.Wherein a strain phage antibody is a strong positive, and called after WJY001 extracts this clone's recombinant plasmid, with S1, and S6 (S1:5-CAACGTGAAAAAATTATTATT-3; S6:5-GTAAATGAATTTTCTGTATGAGG-3) being PCR for primer identifies; The result sees Fig. 5; The purpose fragment reclaimed with glue serve the order-checking of Hai Yingjun company after test kit reclaims; Sequencing result shows purpose ScFv sequence 743bp altogether, and the series arrangement mode is VH-Linker-VL, finds that with mouse immuning ball protein variable region sequences DB Kabat comparison sequence meets mouse weight chain variable region gene structure.Called after SIVHL1, sequencing result is seen Fig. 1.
The active evaluation of phage single-chain antibody of embodiment 6 resisiting influenza virus
6.1 blocking-up ELISA identifies positive colony phage recombinant antibodies WJY001
Encapsulate condition according to the best, antigen embodiment 1 made influenza virus cells and supernatant is encapsulated 96 orifice plates, 4 ℃ encapsulate and spend the night.2%MPBS (PBS that contains 2% skimming milk) seals, and A/PR/8/H1N1 influenza virus liquid is concentrated be placed on DMEM substratum dialysis equilibrium, finally is condensed into 4 times; Use 2 gradients of DMEM substratum doubling dilution (cell culture supernatant that is equivalent to 4 times, 2 times, 1 times A/PR/8/H1N1 influenza virus respectively) then, each gradient is set up blocking-up hole and non-blocking-up hole; Respectively be three repetitions; Each 50 μ L of virus liquid and positive colony phagocytosis body fluid are room temperature reaction 30min outside the hole, dislocation blocking-up hole, and DMEM cell culture fluid and positive colony phagocytosis body fluid react the non-blocking-up of back dislocation hole equally; 37 ℃ of reaction 1h; The washing back adds the anti-M13 monoclonal antibody 100 μ L of HRP mark, 37 ℃ of reaction 1h, washing; Colour developing: add 200 μ L/ hole TMB colour developing liquid, hatch about colour developing 15min for 37 ℃; Stop: with 200 μ L/ hole stop buffers, color development stopping.The result shows that the virus concentration that is used for blocking is high more; Remaining can be coated on the elisa plate to such an extent that the phage single-chain antibody amount of viral reaction is few more; The OD450 value of ELISA is more little; The result sees table 1, explains that the specificity of association reaction of WJY001 phage single-chain antibody and A/PR/8/H1N1 influenza virus is better.
Different H1N1 influenza virus liquid and the WJY001 phage single-chain antibody bonded blocking-up ELISA results that concentrate concentration of table 1.
6.2 double fastener heart ELISA identifies positive bacteriophage recombinant antibodies WJY001
Positive bacteriophage liquid coated elisa plate, 4 ℃ are spent the night, 2%MPBS (PBS that contains 2% skimming milk) sealing; The washing back adds A/PR/8/H1N1 influenza virus cell culture supernatant, 37 ℃ of reaction 1h, and the washing back adds the mice serum (establishing two gradients 1: 2000 and 1: 4000) of anti-A/PR/8/H1N1 influenza virus; Respectively do three repetitions, 37 ℃ of reaction 1h, the washing back adds the sheep anti-mouse antibody of HRP mark; 37 ℃ of reaction 1h, the same colour developing and mensuration OD value.Double fastener heart ELISA result sees table 2, explains that the WJY001 phage single-chain antibody that is screened can suppress many anti-with the viral association reactions of mouse of natural influenza A/PR/8/H1N1 virus.
The double fastener heart ELISA result that mouse polyvalent antibody of the anti-H1N1 influenza virus of the different extension rates of table 2. and viral association reaction are suppressed by the WJY001 phage single-chain antibody
7.1 the amplification of single-chain antibody ScFvSIVHL1 gene fragment and the evaluation of recombinant plasmid
According to a pair of primer of the sequences Design of SIVHL1,
VHL1-S:5 '
CCAGGATCCATGGCCCAGGTCCAACT ' 3; The underscore place is the BamHI restriction endonuclease,
VHL1-AGCA
GAGCTCCCGTTTTATTTCCAGCT, underscore place are the SacI restriction endonuclease.In a 0.2mlPCR pipe, adding following reagent increases: template (the SIVHL1 gene fragment that obtains in embodiment 5 is a template) 4 μ L; 10 * PCR buffer, 5 μ L; DNTP (10mM) 5 μ L; Upstream and downstream primer 1 μ L; Taq (5U/ μ L) 0.5 μ L; Add the sterilization ultrapure water and put 50 μ L.Purified pcr product; Be connected after enzyme is cut respectively with protein expression vector pET-28a-c (+) (available from Novagen company); And change over to during TOP10 bacterial strain (is century Bioisystech Co., Ltd available from Beijing health) is inoculated in the LB substratum that contains kantlex (100pg/mL); 37 ℃ of concussions are spent the night, and extract the recombinant plasmid enzyme and cut evaluation, and the result sees Fig. 8.With identifying that good pET28a (+)-scFvSIVHL1 serves the order-checking of Hai Yingjun company, sequencing result predicts that through the online three-dimensional structure of carrying out of Swiss-Model software the result sees Fig. 9 with its amino acid sequence coded with embodiment 5.
7.2 single-chain antibody ScFvSIVHL1 prokaryotic expression and purifying
With identifying that good recombinant plasmid pET28a (+)-scFvSIVHL1 changes in BL21 (DE3) intestinal bacteria; Be cultured to bacterium liquid absorbancy at about 0.6 o'clock at 37 ℃, add isopropylthiogalactoside (isopropylthiogalactoside, IPTG) abduction delivering target protein; The final concentration of regulating IPTG is 1mmol/L; Induce 6h for 25 ℃, do not compare, carry out SDS-PAGE and detect the protein expression situation to add IPTG bacterium liquid; Target protein uses the Protein Refolding Kit refolding proteins test kit (article No.: 70123-3) inclusion body protein is carried out renaturation and purifying of Merk company mainly with the inclusion body formal representation as a result.Concrete steps are following: the pET28a (+) behind (1) abduction delivering-scFvSIVHL1/BL21 product is through 4 ℃, and the centrifugal 15min of 6,500 * g removes supernatant.(2) with the resuspended deposition of 1 * IB Wash Buffer (20mMTris-Hcl, pH7.5,10mM EDTA, 1%Triton X-100) of 0.1 times of culture volume, abundant mixing.(3) operation on ice makes the resuspended liquid of bacterium keep 4 ℃, prevents heat production in the lysis process, the ultrasonic degradation bacterium.(4) ultrasonic after product is through 4 ℃, and the centrifugal 10min of 10,000 * g collects inclusion body.(5) remove supernatant and with the thorough resuspended deposition of 1 * IB Wash Buffer of 0.1 times of culture volume.(6) centrifugally operated of repeating step 4 and reservation deposition.(7) remove supernatant also with the thorough resuspended deposition of 1 * IB Wash Buffer of 0.1 times of culture volume, resuspended liquid is transferred in the clean centrifuge tube of weighing.(8) 10, the centrifugal 10min of 000 * g collects inclusion body, removes supernatant and centrifuge tube is upside down in to remove residual liquid on the thieving paper.(9) the weighing centrifuge tube weighs and deducts its net weight and obtains inclusion body weight.(10) weighing inclusion body weight in wet base is the volume that 20-30mg/mL calculates required 1 * IB Solubiliz-ation Buffer according to making resuspended thing final concentration.(11) volume required 1 * IB Solubilization Buffer, adding the N-sarcosyl, to make its final concentration be 0.3%.(12) in the inclusion body sample, add the 1 * IB Solubilization Buffer/N-sarcosyl that calculated volume, mixing gently.Bigger fragment can be blown and beaten repeatedly with liquid-transfering gun and make its dispersion.(13) incubated at room 15min.(14) 10, the centrifugal 10min of 000 * g room temperature makes the solution clarification.The supernatant that will contain soluble protein is transferred in the clean centrifuge tube.The dialysis operation of refolding proteins, dialysis buffer liquid is prepared in (15), greater than 50 times of sample volumes; Need 1L dialysis buffer liquid altogether; During preparation, 20mL 50 * dialysis buffer liquid is diluted in the 1L deionized water, adds 100 μ L 1M DTT (making its final concentration is 0.1mM).Dialysed 3 hours for (16) 4 ℃, the replacement damping fluid also continues dialysis 3 hours.(17) continue dialysis 3 times with the dialysis buffer liquid that does not contain DTT, each more than 3 hours.
7.3 the evaluation of the single-chain antibody ScFv after the renaturation
7.3.1 albumen detects through 12%SDS-PAGE and the western-blot method is identified, with above-mentioned acquisition carry out the SDS-PAGE electrophoresis through refolding purified recombinant ScFv expressing protein, resolving gel concentration is 12%; 10V constant voltage transfer printing 20min is transferred to pvdf membrane (available from Whatman) with albumen; Transfer printing finishes, with film room temperature sealing 1h in the PBST that contains 5% skimmed milk; PBST gives a baby a bath on the third day after its birth time, each 5min.Diluted rabbit source anti-His antibody (Sigma) with the PBST that contains 5% skimmed milk by 1: 1000, incubated at room 1h, PBST washing 3 times, each 5min; PBST with 5% skimmed milk resists (Jackson ImmunoRearch) by the goat-anti rabbit of diluting the HRP mark at 1: 10,000 two, incubated at room 1h, PBST washing 3 times, each 5min; With DAB colouring reagents box colour developing (Wuhan doctor's moral).The result is indicated as recombinant single chain antibody ScFv albumen and obtains to efficiently express, and the result sees Figure 10.The BCA method is measured protein concentration, and freeze-drying is preserved.
7.3.2 indirect ELISA detects the activity of recombinant single chain antibody ScFv
Encapsulate condition according to the best, the A/PR/8/H1N1 influenza virus of serial dilution is encapsulated 96 orifice plates, 4 ℃ encapsulate and spend the night, and set up positive control and negative control; Abandon coating buffer,, clap dried enzyme plate with PBS washing 3 times; Add 2% skimming milk PBS (MPBS) to expiring the hole, 37 ℃ were sealed 1.5 hours; Abandon confining liquid,, clap dried enzyme plate with PBS washing 3 times; Add different dilution solubility recombinant single chain antibody ScFvSIVHL1, add in the good enzyme mark hole of sealing, 37 ℃ of association reactions 1 hour; Abandon recombinant antibodies liquid,, clap dried enzyme plate with PBST washing 3 times; The antibody of the anti-His of HRP mark is done dilution in 1: 4000 with PBS, 100 μ L/ holes, 37 ℃ of incubation reaction 1 hour; Abandon enzyme labelled antibody liquid,, clap dried enzyme plate with PBST washing 3 times; Colour developing: add 100 μ L/ hole TMB colour developing liquid, hatch about colour developing 45min for 37 ℃; Stop: with 100 μ L/ hole stop buffers, color development stopping, the value of reading at the 450nm place.The result sees Figure 11, and the indirect ELISA result verifies that further the fusion recombinant single chain antibody of prokaryotic expression and A/PR/8/H1N1 influenza virus also have stronger binding ability.
7.3.3 blocking-up ELISA detects the activity of recombinant single chain antibody ScFv
Process is carried out according to embodiment 6.1, encapsulates condition according to the best, and (titre is 1 * 10 with embodiment 1 made influenza virus cells and supernatant
5PFU/mL) encapsulate 96 orifice plates, 4 ℃ encapsulate and spend the night.2%MPBS seals, and A/PR/8/H1N1 influenza virus liquid is concentrated be placed on DMEM substratum dialysis equilibrium, finally is condensed into 8 times; Use 2 gradients of DMEM substratum doubling dilution (cell culture supernatant that is equivalent to 8 times, 4 times, 2 times, 1 times A/PR/8/H1N1 influenza virus respectively) then, each gradient is set up blocking-up hole and non-blocking-up hole; Respectively be three repetitions; Each 50 μ L of virus liquid and recombinant single chain antibody ScFv SIVHL1 (0.1mg/mL) are room temperature reaction 30min outside the hole, dislocation blocking-up hole, and DMEM cell culture fluid and solubility recombinant single chain antibody ScFv SIVHL1 react the non-blocking-up of back dislocation hole equally; 37 ℃ of reaction 1h; The washing back adds the anti-His-tag two anti-100 μ L of HRP mark, 37 ℃ of reaction 1h, washing; Colour developing: add 200 μ L/ hole TMB colour developing liquid, hatch about colour developing 15min for 37 ℃; Stop: with 200 μ L/ hole stop buffers, color development stopping.The result shows that the virus concentration that is used for blocking is high more; Being left can be few more with the recombinant single chain antibody ScFv SIVHL1 amount that is coated on the virus reaction on the elisa plate; The OD450 value of ELISA is more little; The result sees table 3, explains that the specificity of association reaction of ScFv SIVHL1 single-chain antibody and A/PR/8/H1N1 influenza virus is better, and certain blocking effect is arranged.
Different H1N1 influenza virus liquid and the single-chain antibody SIVHL1 bonded blocking-up ELISA results that concentrate concentration of table 3.
7.3.4 the association reaction of ScFv SIVHL1 and other H1N1 strain isolateds
Choosing the domestic isolating certain representational A type influenza virus that has of two strains, is respectively people source A/swine/Guangdong/96/06 (H1N1) (Yu Hai etc., academic annual meeting in 2009; The 320-326 page or leaf, in the sea, Email:yuhaishvri.ac.cn) and Europe be fowl source A/swine/zhejiang/1/07 (H1N1) (Yu Hai etc.; Academic annual meeting in 2009; The 320-326 page or leaf is in the sea, Email:yuhaishvri.ac.cn).This two strains inactivation of viruses is encapsulated elisa plate by optimum concn; The how anti-positive contrast of mouse anti H1N1 influenza virus; Other processes are accomplished according to embodiment 7.3.2; It is active that the result shows that ScFv SIVHL1 single-chain antibody all has certain combination to these strains, to possibly be the conservative region of H1N1 influenza virus.The result sees Figure 12.
Should be understood that after having read foregoing of the present invention those skilled in the art can do various changes or modification to the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Claims (10)
1. the single-chain antibody of a resisiting influenza virus, it is one of following protein:
1) single-chain antibody that is formed by connecting through the joint peptide antibody heavy chain variable region and variable region of light chain, wherein the aminoacid sequence of variable region of light chain and weight chain variable region amino acid sequence are respectively shown in SEQ ID NO.1 in the sequence table and SEQ ID NO.2;
2) as 1) described single-chain antibody is through transforming the antibody of deriving that obtains, and described transformation comprises amino acid whose disappearance, replacement or insertion, and this antibody of deriving has the antibody activity of resisiting influenza virus.
2. single-chain antibody as claimed in claim 1, described joint peptide are 15-20 the small peptides that amino acid condensation forms.
3. the coding gene of antibody according to claim 1 or claim 2.
4. gene as claimed in claim 3 is characterized in that, is one of following gene:
1) nucleotide sequence of this genes encoding antibody chain variable region and variable region of heavy chain is respectively shown in SEQ ID NO.3 in the sequence table and SEQ ID NO.4;
2) nucleotide sequence of this genes encoding antibody chain variable region and variable region of heavy chain can be hybridized with the dna sequence dna that SEQ ID NO.3 and SEQ ID NO.4 limit respectively under rigorous condition, and the protein of this genes encoding has the antibody activity of anti-H1N1 influenza virus.
5. contain claim 3 or 4 said expression carrier.
6. expression vector as claimed in claim 5 is characterized in that, described carrier is plasmid pET28a.
7. the host of containing the said expression vector of claim 5.
8. host as claimed in claim 7 is characterized in that described host is intestinal bacteria.
9. method for preparing the single-chain antibody of the described anti-H1N1 influenza virus of claim 1; It is characterized in that; Comprise the described expression vector conversion of claim 5, transduction or transfection host cell; Cultivate host cell, protein isolates from culture obtains anti-H1N1 influenza virus single-chain antibody.
10. claim 1 or the 2 described antibody application in the preparation Tamiflu.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210063870.4A CN102558348B (en) | 2012-03-09 | 2012-03-09 | Single-chain antibody for resisting influenza viruses, preparation method for single-chain antibody, application of single-chain antibody |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210063870.4A CN102558348B (en) | 2012-03-09 | 2012-03-09 | Single-chain antibody for resisting influenza viruses, preparation method for single-chain antibody, application of single-chain antibody |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102558348A true CN102558348A (en) | 2012-07-11 |
| CN102558348B CN102558348B (en) | 2014-06-04 |
Family
ID=46405077
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210063870.4A Expired - Fee Related CN102558348B (en) | 2012-03-09 | 2012-03-09 | Single-chain antibody for resisting influenza viruses, preparation method for single-chain antibody, application of single-chain antibody |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102558348B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106749669A (en) * | 2016-12-30 | 2017-05-31 | 武汉金开瑞生物工程有限公司 | A kind of preparation method and application for recombinating internal reference GAPDH antibody |
| CN108728461A (en) * | 2018-05-30 | 2018-11-02 | 军事科学院军事医学研究院军事兽医研究所 | H3N2 type canine influenza virus shuttle intracellular antibodies TAT-4F |
| CN108728462A (en) * | 2018-05-30 | 2018-11-02 | 军事科学院军事医学研究院军事兽医研究所 | H3N2 type canine influenza virus shuttle intracellular antibodies TAT-2C |
| CN110845607A (en) * | 2019-11-14 | 2020-02-28 | 潍坊医学院 | H1N1 influenza virus antibody and application thereof in H1N1 virus ultramicro-detection |
| CN112028992A (en) * | 2020-06-23 | 2020-12-04 | 深圳市第二人民医院 | Artificial synthetic antibody of influenza A H1N1 virus, preparation method and detection kit thereof |
| CN115232207A (en) * | 2022-05-19 | 2022-10-25 | 河南大学 | Use of antibody-lysin (SM-ScFv-Fc-Ly) for the treatment of Streptococcus mutans infections |
-
2012
- 2012-03-09 CN CN201210063870.4A patent/CN102558348B/en not_active Expired - Fee Related
Non-Patent Citations (2)
| Title |
|---|
| KABIR,M.E.,ET AL.: "Accession No.HQ832613", 《GENBANK》 * |
| 孙丽娜 等: "从人源大容量天然抗体库中筛选到抗禽流感病毒H5N1单链抗体", 《中国人兽共患病学报》 * |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106749669A (en) * | 2016-12-30 | 2017-05-31 | 武汉金开瑞生物工程有限公司 | A kind of preparation method and application for recombinating internal reference GAPDH antibody |
| CN108728461A (en) * | 2018-05-30 | 2018-11-02 | 军事科学院军事医学研究院军事兽医研究所 | H3N2 type canine influenza virus shuttle intracellular antibodies TAT-4F |
| CN108728462A (en) * | 2018-05-30 | 2018-11-02 | 军事科学院军事医学研究院军事兽医研究所 | H3N2 type canine influenza virus shuttle intracellular antibodies TAT-2C |
| CN108728461B (en) * | 2018-05-30 | 2022-02-22 | 军事科学院军事医学研究院军事兽医研究所 | H3N2 type canine influenza virus shuttle intracellular antibody TAT-4F |
| CN108728462B (en) * | 2018-05-30 | 2022-02-22 | 军事科学院军事医学研究院军事兽医研究所 | H3N2 type canine influenza virus shuttle intracellular antibody TAT-2C |
| CN110845607A (en) * | 2019-11-14 | 2020-02-28 | 潍坊医学院 | H1N1 influenza virus antibody and application thereof in H1N1 virus ultramicro-detection |
| CN110845607B (en) * | 2019-11-14 | 2021-03-23 | 潍坊医学院 | H1N1 influenza virus antibody and application thereof in H1N1 virus ultramicro-detection |
| CN112028992A (en) * | 2020-06-23 | 2020-12-04 | 深圳市第二人民医院 | Artificial synthetic antibody of influenza A H1N1 virus, preparation method and detection kit thereof |
| CN112028992B (en) * | 2020-06-23 | 2022-07-01 | 深圳市第二人民医院 | Artificial synthetic antibody of influenza A H1N1 virus, preparation method and detection kit thereof |
| CN115232207A (en) * | 2022-05-19 | 2022-10-25 | 河南大学 | Use of antibody-lysin (SM-ScFv-Fc-Ly) for the treatment of Streptococcus mutans infections |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102558348B (en) | 2014-06-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111732638B (en) | Vaccine against SARS-CoV-2 | |
| CN102558348B (en) | Single-chain antibody for resisting influenza viruses, preparation method for single-chain antibody, application of single-chain antibody | |
| CN111057145B (en) | Porcine reproductive and respiratory syndrome virus Nsp2 protein nano antibody and application thereof | |
| CN103547676A (en) | Immunogenic compositions in particulate form and methods for producing the same | |
| CN103992988B (en) | A kind of monoclonal antibody of the anti-canine distemper disease viral N proteins of hybridoma cell strain and generation thereof | |
| CN113150083B (en) | Recombinant avian influenza subunit vaccine and preparation method thereof | |
| CN113354743A (en) | Multi-epitope antigen and vaccine for piglet diarrhea as well as preparation method and application of multi-epitope antigen and vaccine | |
| CN110144011A (en) | For the single domain antibody of T lymphocyte immunoglobulin Mucin 3 | |
| CN110272473A (en) | General virus-like particle of Flu-A and its preparation method and application | |
| CN102816246B (en) | Human cytomegalo virus immunogen fusion protein as well as preparation method and usage thereof | |
| CN104710529B (en) | A kind of single-chain antibody of anti-fishes virus haemorrhagic septicaemia virus | |
| CN102210860A (en) | Mycobacterium tuberculosis TB10.4-F1 fusion protein vaccine and preparation method thereof | |
| CN111607605B (en) | Construction method of multivalent epitope and subunit vaccine | |
| CN106188283A (en) | The nano antibody of type A avian influenza H7N2 and application thereof | |
| CN106905434A (en) | A kind of recombination fusion protein comprising hoof bat hepatitis B core protein and its preparation method and application | |
| CN103030693B (en) | Neutralization molecule of high-pathogenicity avian influenza and preparation method thereof | |
| CN106397602B (en) | A kind of reinforced chicken Marek's disease protein engineering vaccine of molecule adjuvant | |
| CN101407546A (en) | Human anti-human tumor necrosis factor-alpha single chain antibody | |
| CN101186644B (en) | H3 type flu virus hemagglutinin space conformation simulation antigen epitope and application thereof | |
| CN107216387B (en) | Influenza B virus broad-spectrum neutralizing antibody, preparation method and application thereof | |
| Guo et al. | Screening scFv antibodies against infectious bursal disease virus by co-expression of antigen and antibody in the bacteria display system | |
| CN109593136B (en) | Avian paramyxovirus fusion protein, preparation method and application thereof, and APMV vaccine for pigeons | |
| CN105859879B (en) | A kind of single-chain antibody of Antifish lymphocystis virus | |
| CN112608383B (en) | Single-chain antibody for resisting paralichthys rhabdovirus | |
| CN106188285B (en) | A kind of single domain antibody neutralizing xinjiang hemorrhagic fever virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140604 Termination date: 20160309 |