CN102533964A - Predominant bacteria in microbial population of Pu'er tea and spectrum for predominant bacteria - Google Patents
Predominant bacteria in microbial population of Pu'er tea and spectrum for predominant bacteria Download PDFInfo
- Publication number
- CN102533964A CN102533964A CN2010106227665A CN201010622766A CN102533964A CN 102533964 A CN102533964 A CN 102533964A CN 2010106227665 A CN2010106227665 A CN 2010106227665A CN 201010622766 A CN201010622766 A CN 201010622766A CN 102533964 A CN102533964 A CN 102533964A
- Authority
- CN
- China
- Prior art keywords
- primer
- add
- amplification
- centrifugal
- pillar
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a molecular identification method for a predominant flora structure in the pile-fermentation process of Pu'er tea. The molecular identification method comprises the following steps of: 1) taking Pu'er tea subjected to different pile-turning frequencies at different positions in the pile-fermentation process as samples to be detected; 2) extracting total DNA from the samples to be detected, and purifying; 3) performing polymerase chain reaction (PCR) amplification by taking the total DNA of the samples to be detected as a template under the guide of special primers, and recovering and purifying target fragments; 4) performing denatured gradient gel electrophoresis (DGGE) on the purified target fragments, and dyeing to obtain a DGGE fingerprint; 5) recovering predominant bands from the gel, performing PCR amplification by taking the predominant bands as templates under the guide of an upstream primer 338F and a downstream primer R518, and recovering, purifying and sequencing the target fragments; and 6) comparing sequencing results in the step 5) with a sequence of a standard flora to determine the predominant florae in the pile-fermentation process of the Pu'er tea.
Description
Technical field
The present invention relates to identify authentication method and the primer special and the DGGE fingerprint spectrogram of predominant bacteria flora structure in the Leaf of Assam Tea pile-fermentation process.
Background technology
Folium camelliae assamicae (processed) is that the solar dried green tea with the peculiar daye tea in Yunnan [Camellia sinensis (Linn) var.assamica (Masters) Kitamura] is a raw material, under action of microorganisms, and the secondary fermentation teas that forms through artificial wet pile-after-fermentation fast.Mikrobe plays an important role in the pile-fermentation production process of Leaf of Assam Tea; Left mikrobe; The quality of Leaf of Assam Tea and local flavor will can not get guaranteeing that the present invention has studied the superior microorganism flora in the pile-fermentation Leaf of Assam Tea, and authentication method is provided; If these dominant microfloras are used for the pile-fermentation production process of Leaf of Assam Tea, will help the production of Leaf of Assam Tea and improve the quality.
At present, the research of mikrobe in the pile-fermentation Leaf of Assam Tea mainly is to use methods such as traditional mikrobe separation, purifying, evaluation.Traditional research method is at first from specific sample, to take a sample; Adopt the various substratum and the condition of simulating natural environment to carry out separation and Culture; Behind pure culture acquisition bacterial strain, again the character (morphology, biochemical reactions and cell are formed the observation of constituent structure) of its phenotypic characteristic, cell is observed collection, carry out the experiment of a series of numerous and diverse morphological specificitys and Physiology and biochemistry simultaneously; Could describe its characteristic, this method is known as classical way again.
Use the mikrobe that traditional method can separation and Culture and be not necessarily dominant microflora, just they be fit to and can be under the artificial culture condition separated purifying, growth conditions that can not dynamic reflection Daqu microorganism species.On experimental technique, the Leaf of Assam Tea microbe research still rests on cell levels, mainly studies single colonial morphology of bacterium, mould, yeast and actinomycetes and purebred growth characteristics.On experimental result, can not reflect the Phylogenetic Relationships between isolate, can not obtain the real general picture of microbial diversity.Therefore traditional dependence cultured method has restricted the objective understanding of people to microbial ecological, correctly is familiar with biological community structure and function for people, correctly is familiar with Microbial resources, correctly develops and utilizes these resources to cause serious obstacle.
The sudden change that denaturing gradient gel electrophoresis (DGGE) is used to gene at first detects, and the dna fragmentation and the primary dna fragmentation of the single base mutation in site can be separated arbitrarily, through sequencing and the site that relatively just can find out sudden change.Denaturing gradient gel electrophoresis to the separation principle of different dna fragmentations be in the denaturing gradient gel electrophoresis (DGGE) same length but have not homotactic dna fragmentation can be separated because the reduction of the electrophoretic mobility of the double chain DNA molecule that part is unwind in the polyacrylamide gel electrophoresis that contains the mixture that is linear increase gradient denaturing agent (urea and first phthalein amine).Have not homotactic dna molecular the different behaviors of unwinding is arranged, will stop migration at the different positions of gel.Denaturing gradient gel electrophoresis (DGGE) since nineteen ninety-three is used to the structure of community that mikrobe in the research environment sample is come in the environmental microorganism field; It is to be based upon on the basis of amplification of the interval dna segment of 16S rRNA (prokaryotic organism) and the 18S rRNA conservative genes such as (eukaryotes) of all mikrobes in the PCR reaction pair environmental sample; These dna segments that amplified can be represented the information of all different microorganisms; These use same primer that the dna segment of the different microorganisms that amplifies is had identical base number; Therefore general electrophoresis can't be separated them, and this has has just further researched and proposed new problem for follow-up.Because denaturing gradient gel electrophoresis (DGGE) can separate the dna fragmentation of the identical size of Different Alkali base sequence, so PCR-DGGE can study the microflora in the environmental sample.
Yet; The chemistry of pile-fermentation Leaf of Assam Tea and municipal sewage sludge and agricultural land soil, physical properties height are heterogeneous; Microbe population is also obviously different with the population distribution, and this has just determined that the sample under the varying environment there are differences when carrying out microflora's component analysis.Still have nothing to do both at home and abroad at present and carry out the relevant report that pile-fermentation Leaf of Assam Tea microflora constitutes research in utilization PCR-DGGE technology.
Summary of the invention
For improving the Leaf of Assam Tea quality and improving Leaf of Assam Tea output; The present invention has studied the authentication method of predominant bacteria flora in the Leaf of Assam Tea pile-fermentation process; The present invention is through extracting the DNA in whole bacteria floras and therefrom isolating the DNA of predominant bacteria flora; Dna structure and the standard bacteria flora of measuring the predominant bacteria flora compare, and obtain the kind and the title of detailed predominant bacteria flora.
The present invention provides the authentication method of predominant bacteria flora in a kind of Leaf of Assam Tea pile-fermentation process.
Authentication method of the present invention may further comprise the steps:
1) Leaf of Assam Tea of getting different turning number of times and position in the pile-fermentation process is as testing sample;
2) extract total DNA of testing sample, and it is carried out purifying;
3) the total DNA with testing sample is a template, under the guiding of primer special, carries out pcr amplification, and amplification is reclaimed and purifying the purpose fragment after finishing;
4) the purpose fragment of purifying is carried out denaturing gradient gel electrophoresis, obtain the DGGE finger printing after the dyeing;
5) from gel, reclaim the advantage band, and as template, at upstream primer 338F:5 '-ACTCCTACGGGAGGCAGCAG-3 '; Downstream primer R518:5 '-ATTACCGCGGCTGCTGG-3 ' carries out pcr amplification under the guiding, and amplification is reclaimed purifying and order-checking after finishing to the purpose fragment;
6) sequence of the sequencing result of step 5 and standard flora is compared, and confirms the predominant bacteria flora of pile-fermentation Leaf of Assam Tea.
Wherein, step 2) DNA extraction adopts the test kit method, and concrete operation steps is: get 5g tealeaves sample, use liquid nitrogen freezing to grind 3 times, transfer in the 2ml centrifuge tube, add the 200mg granulated glass sphere.Use Omega soil DNA extraction test kit that the tealeaves sample of handling well is extracted, add 600ul SLX solution, the 10min that vibrates at a high speed mixes; 70 degree water-bath 10min, during biased sample for several times, add 200ul SP2 solution; Mix ice bath 5min, the centrifugal 5min of 13000g.Supernatant is transferred in the new centrifuge tube, adds 0.7 times of Virahol, puts upside down mixing, the centrifugal 10min of 13000g, and supernatant discarded is inverted in drying on the thieving paper, adds 200ul elution buffer in centrifuge tube, mixing, 65 degree water-bath 20min dissolving DNAs.Add 50ul HTR solution, mix, room temperature is placed 2min, and the centrifugal 2min of 13000g transfers to supernatant in the new centrifuge tube, repeats to add the HTR solution-treated if supernatant still has dark matter.Add isopyknic XP2 solution, thorough mixing is even, afterwards all solution is transferred in the HiBind DNA pillar, and the centrifugal 1min of 10000g discards effluent and reuses collection tube.Add 300ul XP2 solution, the centrifugal 1min of 10000g discards effluent and collection tube; Put into a new collection tube to pillar, add the SPW wash solution that 700ul diluted through absolute ethyl alcohol, the centrifugal 1min of 10000g; Discard effluent and reuse collection tube, wash once with 700ul SPW wash solution again, discard liquid; Insert pillar in the empty collection tube, the centrifugal 2min of 13000g puts into 50 degree baking oven 30min with pillar.Be put into pillar in the new centrifuge tube, add 50ul elution buffer, 65 degree water-bath 10min, the centrifugal 1min of 13000g to the pillar center.Centrifugal elutriant is added in the pillar again, 65 degree water-bath 10min, the centrifugal 2min of 13000g, the gained elutriant is got the 5ul electrophoresis detection.
Said step 3) is carried out the amplification of two steps; Primer special wherein does---the primer that the first step amplification is adopted is 16s1:5 '-AGAGTTTGATCCTGGCTCAG-3 ' and 16s2:5 '-TACGGYTACCTTGTTACGACTT-3 '; The primer that the amplification of second step is adopted is: 338fGC:5 '-CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGACTCCTACGGGAGGCA GCAG-3 ' and R518:5 '-ATTACCGCGGCTGCTGG-3 '
Pcr amplification condition in the said step 3) is the nest-type PRC amplification: the primer and the reaction system that add amplification 16S rDNA total length are earlier carried out the first step amplification; The PCR reaction conditions is: 94 ℃ of preparatory sex change 4min; Then at 94 ℃ of sex change 45s, 50 ℃ of-55 ℃ of primer renaturation 45s, 72 ℃ of primer extension 1.5min; Circulate 30 times, 72 ℃ are extended 10min eventually; Getting its product and carry out after 100 times of dilutions as template, is that target increases with 16S rDNA V3 variable region, and the PCR reaction conditions is: 94 ℃ of preparatory sex change 4min; Then at 94 ℃ of sex change 45s, 50-55 ℃ of primer renaturation 45s, 72 ℃ of primer extension 1min; Circulation 30-35 time, 72 ℃ are extended 10min eventually.
Staining fluid in the said step 4) is sybrgreen, and concentration is 1: 10000 dilution stoste, and 1 * TAE damping fluid, dyeing time are 20-40min, get the DGGE collection of illustrative plates.
DGGE electrophoretic separation in the said step 4); Suitable deposition condition is: the Dcode detection in Gene Mutation system that uses Bio-Rad company is at 80-120V; 60 ℃ of following electrophoresis 8-14h, sex change glue is polyacrylamide gel, contains denaturing agents such as urea and methane amide; The denaturing agent concentration range is from 35% to 60%, and gum concentration is 8-10%.
Said step 5) is carefully cut off the advantage band with the aseptic operation cutter under uv lamp, and dyes mark corresponding position in the collection of illustrative plates at silver, behind aseptic water washing 3 times, puts into the 1.5mLEP pipe, smashs adding 30ul ddH to pieces with sterilization rifle head
2O soaked 5 hours.EP is managed the centrifugal 5min of 12000rpm; Get supernatant as pcr template; Under guiding not with special primer 338f:5 '-ACTCCTACGGGAGGCAGCAG-3 ' the R518:5 '-ATTACCGCGGCTGCTGG-3 ' that designs to 16S rDNA v3 district fragment of GC clip; Carry out pcr amplification, 50ul PCR reaction system is: the dna profiling of 10ng (generally using 1 μ l), every kind of primer of 50pmol, 1 μ l dNTPs, 10 * PCR buffer of 5 μ l, the MgCl of 2.5mmol/L
2, 3U the Taq archaeal dna polymerase, an amount of distilled water is supplied 50 μ l.Adopt the nest-type PRC response procedures: 94 ℃ of preparatory sex change 4min, then at 94 ℃ of sex change 45s, 50 ℃ of primer renaturation 45s, 72 ℃ of primer extension 1.5min circulate 30 times, and 72 ℃ are extended 10min eventually; Get the 3pl reaction product after reaction finishes and carry out the detection of 2% agarose gel electrophoresis, with CyC le-Pure DNA test kit the purpose fragment is reclaimed and purifying, and check order.Order-checking is undertaken by Shanghai Ying Jun biotech company.
Can adopt Blast program online (http://www.ncbi.nlm.nih.gov/blast/) that sequencing result is carried out the sequence alignment analysis in the step 6), confirm pile-fermentation Leaf of Assam Tea dominant microflora structure.
Primer described in step 3 of the present invention and the step 5 is a prior art, can buy, also can be synthetic through prior art.
Authentication method of the present invention has the following advantages:
1, exempts to cultivate the high efficiency extraction microorganism total DNA;
2, combine Bio-ID++ software that dominant microflora is carried out semi-quantitative analysis, and compare the flora qualitative analysis of accomplishing through order-checking, the result is accurate, and is reliable, progressively overcome the deficiency that conventional artificial culture method is analyzed Leaf of Assam Tea flora structure;
3, from the DGGE spectrogram, can see predominant bacteria flora band intuitively, concrete representative.
Based on above-mentioned advantage, the present invention will play a great role in the analysis of Leaf of Assam Tea dominant microflora structure
Description of drawings
The PCR-DGGE spectrogram of bacterium in Fig. 1, the Leaf of Assam Tea pile-fermentation process
Embodiment
Through following specific embodiment the present invention is described further, but not as limitation of the present invention.
Embodiment 1, authentication method
One, prepares sample
Right fermentation of pu'er tea is taken a sample, according to the sampling of different turning number of times and the different positions point in heap, this experiment usefulness be to take a sample.
Two, extraction and the purifying of total DNA
Get 5g tealeaves sample, use liquid nitrogen freezing to grind 3 times, transfer in the 2ml centrifuge tube, add the 200mg granulated glass sphere.Use Omega soil DNA extraction test kit that the tealeaves sample of handling well is extracted, add 600ul SLX solution, the 10min that vibrates at a high speed mixes; 70 degree water-bath 10min, during biased sample for several times, add 200ul SP2 solution; Mix ice bath 5min, the centrifugal 5min of 13000g.Supernatant is transferred in the new centrifuge tube, adds 0.7 times of Virahol, puts upside down mixing, the centrifugal 10min of 13000g, and supernatant discarded is inverted in drying on the thieving paper, adds 200ul elution buffer in centrifuge tube, mixing, 65 degree water-bath 20min dissolving DNAs.Add 50ul HTR solution, mix, room temperature is placed 2min, and the centrifugal 2min of 13000g transfers to supernatant in the new centrifuge tube, repeats to add the HTR solution-treated if supernatant still has dark matter.Add isopyknic XP2 solution, thorough mixing is even, afterwards all solution is transferred in the HiBind DNA pillar, and the centrifugal 1min of 10000g discards effluent and reuses collection tube.Add 300ul XP2 solution, the centrifugal 1min of 10000g discards effluent and collection tube; Put into a new collection tube to pillar, add the SPW wash solution that 700ul diluted through absolute ethyl alcohol, the centrifugal 1min of 10000g; Discard effluent and reuse collection tube, wash once with 700ul SPW wash solution again, discard liquid; Insert pillar in the empty collection tube, the centrifugal 2min of 13000g puts into 50 degree baking oven 30min with pillar.Be put into pillar in the new centrifuge tube, add 50ul elution buffer, 65 degree water-bath 10min, the centrifugal 1min of 13000g to the pillar center.Centrifugal elutriant is added in the pillar again, 65 degree water-bath 10min, the centrifugal 2min of 13000g, the gained elutriant is got the 5ul electrophoresis detection
Three, pcr amplification and product recovery, purifying
DNA behind the purifying is carried out pcr amplification, and the primer that the first step amplification is adopted is 16s1:5 '-AGAGTTTGATCCTGGCTCAG-3 ' and 16s2:5 '-TACGGYTACCTTGTTACGACTT-3 '.The primer that the amplification of second step is adopted is: 338fGC:5 '-CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGACTCCTACGGGAGGCA GCAG-3 ' and R518:5 '-ATTACCGCGGCTGCTGG-3 ', above primer are all synthetic by Shanghai Ying Jun biotech company.The primer and the reaction system that add amplification 16S rDNA total length are earlier carried out the first step amplification, and the PCR reaction system of 50 μ l is formed as follows: the dna profiling of 10ng (generally using 1 μ l), every kind of primer of 50pmol, 1 μ l dNTPs, 10 * PCR buffer of 5 μ l, the MgCl of 2.5mmol/L
2, 5U the TaqDNA polysaccharase, an amount of distilled water is supplied 50 μ l.The PCR reaction conditions is: 94 ℃ of preparatory sex change 4min, and then at 94 ℃ of sex change 45s, 50 ℃ of primer renaturation 45s, 72 ℃ of primer extension 1.5min circulate 30 times, and 72 ℃ are extended 10min eventually; Getting its product and carry out after 100 times of dilutions as template, is that target increases with 16S rDNA V3 variable region, and the PCR reaction conditions is: 94 ℃ of preparatory sex change 4min; Then at 94 ℃ of sex change 45s; 55 ℃ of primer renaturation 45s, 72 ℃ of primer extension 1min circulate 35 times; 72 ℃ are extended 10min eventually, and the purpose product detects with 1% agarose gel electrophoresis.Electrophoretic buffer is 1 * TAE damping fluid.
Four, scanning of denaturing gradient gel electrophoresis (DGGE) and gel imaging and analysis
Adopt DCODE
TMSystem (BIO-RAD) makes up the DGGE finger printing, and concrete grammar is:, each sample 16S rDNAv3 district amplification purification product is separated (propylene phthalein amine concentration 35%-60% in 10% Vestolen PP 7052 sex change glue; Electrophoretic buffer 0.5-1x TAE); 100V, 12h, sample point sample amount 1000ng DNA.
Five, the recovery of advantage band, order-checking and sequence alignment analysis
Under uv lamp, the advantage band is carefully cut off with the aseptic operation cutter, and dyed mark corresponding position in the collection of illustrative plates, behind aseptic water washing 3 times, put into the 1.5mLEP pipe, smash to pieces, adding 30ul dd H with sterilization rifle head at silver
2O soaked 5 hours.EP is managed the centrifugal 5min of 12000rpm; Get supernatant as pcr template; Under guiding not with special primer 338f:5 '-ACTCCTACGGGAGGCAGCAG-3 ' the R518:5 '-ATTACCGCGGCTGCTGG-3 ' that designs to 16S rDNA v3 district fragment of GC clip; Carry out pcr amplification, 50ul PCR reaction system is: the dna profiling of 10ng (generally using 1 μ l), every kind of primer of 50pmol, 1 μ l dNTPs, 10 * PCR buffer of 5 μ l, the MgCl of 2.5mmol/L
2, 3U the Taq archaeal dna polymerase, an amount of distilled water is supplied 50 μ l.Adopt the nest-type PRC response procedures: 94 ℃ of preparatory sex change 4min, then at 94 ℃ of sex change 45s, 50 ℃ of primer renaturation 45s, 72 ℃ of primer extension 1.5min circulate 30 times, and 72 ℃ are extended 10min eventually; Get the 3pl reaction product after reaction finishes and carry out the detection of 2% agarose gel electrophoresis, with CyC le-Pure DNA test kit the purpose fragment is reclaimed and purifying, and check order.Order-checking is undertaken by Shanghai Ying Jun biotech company.
Adopt Blast program online (http//www.ncbi.nlm.nih.gov/blast/) to carry out the sequence alignment analysis, analytical results is seen table 1
The sequence alignment analysis of the corresponding single band of DGGE finger printing in the table 1 Leaf of Assam Tea pile-fermentation process
Can find out in the table 1; 6 predominant bacterias are arranged in Leaf of Assam Tea pile-fermentation process; Be respectively Lactobacillus acidipiscis, Staphylococcus gallinarum, Streptomyces sp.Brevibacterium casei; Bacillus coagulans, Chryseobacterium taiwanense
The predominant bacteria of the different steps in the production process is different.
Claims (10)
1. the molecular assay method of predominant bacteria flora structure in the Leaf of Assam Tea pile-fermentation process may further comprise the steps:
1) Leaf of Assam Tea of getting different turning number of times and position in the pile-fermentation process is as testing sample;
2) extract total DNA of testing sample, and it is carried out purifying;
3) the total DNA with testing sample is a template; At primer special---the primer that the first step amplification is adopted is 16s1:5 ' AGAGTTTGATCCTGGCTCAG-3 ' and 16s2:5 '-TACGGYTACCTTGTTACGACTT-3 '; The primer that the amplification of second step is adopted is: 338fGC:5 '-CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGACTCCTACGGGAGGCA GCAG-3 ' and R518:5 '-ATTACCGCGGCTGCTGG-3 '; Guiding under carry out pcr amplification; Amplification is reclaimed and purifying the purpose fragment after finishing;
4) the purpose fragment of purifying is carried out denaturing gradient gel electrophoresis, obtain the DGGE finger printing after the dyeing;
5) from gel, reclaim the advantage band, and as template, at upstream primer 338F:5 '-ACTCCTACGGGAGGCAGCAG-3 '; Downstream primer R518:5 ' ATTACCGCGGCTGCTGG-3 ' carries out pcr amplification under the guiding, and amplification is reclaimed purifying and order-checking after finishing to the purpose fragment;
6) sequence of the sequencing result of step 5 and standard flora is compared, and confirms the predominant bacteria flora of pile-fermentation Leaf of Assam Tea.
2. authentication method according to claim 1 is characterized in that, said step 2) DNA extraction adopt the test kit method, concrete operation steps is: get 5g tealeaves sample, use liquid nitrogen freezing to grind 3 times; Transfer in the 2ml centrifuge tube, add the 200mg granulated glass sphere, use Omega soil DNA extraction test kit that the tealeaves sample of handling well is extracted, add 600ul SLX solution, the 10min that vibrates at a high speed mixes; 70 degree water-bath 10min, during biased sample for several times, add 200ul SP2 solution, mix ice bath 5min; The centrifugal 5min of 13000g, supernatant transfer in the new centrifuge tube, add 0.7 times of Virahol, put upside down mixing, the centrifugal 10min of 13000g; Supernatant discarded is inverted in drying on the thieving paper, adds 200ul elution buffer in centrifuge tube, mixing; 65 degree water-bath 20min dissolving DNAs add 50ul HTR solution, mix, and room temperature is placed 2min; The centrifugal 2min of 13000g transfers to supernatant in the new centrifuge tube, repeats to add the HTR solution-treated if supernatant still has dark matter, adds isopyknic XP2 solution; Thorough mixing is even, afterwards all solution is transferred in the HiBind DNA pillar, and the centrifugal 1min of 10000g discards effluent and reuses collection tube; Add 300ul XP2 solution, the centrifugal 1min of 10000g discards effluent and collection tube, puts into a new collection tube to pillar; Add the SPW wash solution that 700ul diluted through absolute ethyl alcohol, the centrifugal 1min of 10000g discards effluent and reuses collection tube, washes once with 700ul SPW wash solution again; Discard liquid, insert pillar in the empty collection tube, the centrifugal 2min of 13000g puts into 50 degree baking oven 30min with pillar; Be put into pillar in the new centrifuge tube, add 50ul elution buffer, 65 degree water-bath 10min, the centrifugal 1min of 13000g to the pillar center; Centrifugal elutriant is added in the pillar again, 65 degree water-bath 10min, the centrifugal 2min of 13000g, the gained elutriant is got the 5ul electrophoresis detection.
3. authentication method according to claim 1 is characterized in that, the pcr amplification condition nest-type PRC amplification in the said step 3): the primer and the reaction system that add amplification 16S rDNA total length are earlier carried out the first step amplification; The PCR reaction conditions is: 94 ℃ of preparatory sex change 4min; Then at 94 ℃ of sex change 45s, 50 ℃ of primer renaturation 45s, 72 ℃ of primer extension 1.5min; Circulate 30 times, 72 ℃ are extended 10min eventually; Getting its product and carry out after 100 times of dilutions as template, is that target increases with 16S rDNA V3 variable region, and the PCR reaction conditions is: 94 ℃ of preparatory sex change 4min; Then at 94 ℃ of sex change 45s, 55 ℃ of primer renaturation 45s, 72 ℃ of primer extension 1min; Circulate 35 times, 72 ℃ are extended 10min eventually.
4. authentication method according to claim 1 is characterized in that, the staining fluid in the said step 4) is sybrgreen, and concentration is 1: 10000 dilution stoste, and 1 * TAE damping fluid, dyeing time are 20-40min, get the DGGE collection of illustrative plates.
5. authentication method according to claim 3 is characterized in that, the DGGE electrophoretic separation in the said step 4); Suitable deposition condition is: the Dcode detection in Gene Mutation system that uses Bio-Rad company is at 80-120V; 60 ℃ of following electrophoresis 8-14h, sex change glue is polyacrylamide gel, contains denaturing agents such as urea and methane amide; The denaturing agent concentration range is from 35% to 60%, and gum concentration is 8-10%.
6. authentication method according to claim 1 is characterized in that, employing Blast program is online in the said step 6) carries out the sequence alignment analysis to sequencing result, confirms pile-fermentation Leaf of Assam Tea dominant microflora structure.
7. authentication method according to claim 1 may further comprise the steps:
1) fermentation of pu'er tea is taken a sample, according to different turning number of times and the sampling of the different positions point in heap;
2) get 5g tealeaves sample, use liquid nitrogen freezing to grind 3 times, transfer in the 2ml centrifuge tube, add the 200mg granulated glass sphere, use Omega soil DNA extraction test kit that the tealeaves sample of handling well is extracted; Add 600ul SLX solution, the 10min that vibrates at a high speed mixes, 70 degree water-bath 10min, during biased sample for several times, add 200ul SP2 solution; Mix, ice bath 5min, the centrifugal 5min of 13000g, supernatant transfer in the new centrifuge tube, add 0.7 times of Virahol; Put upside down mixing, the centrifugal 10min of 13000g, supernatant discarded is inverted in drying on the thieving paper, adds 200ul elution buffer in centrifuge tube; Mixing, 65 degree water-bath 20min dissolving DNAs add 50ul HTR solution, mix, and room temperature is placed 2min; The centrifugal 2min of 13000g transfers to supernatant in the new centrifuge tube, repeats to add the HTR solution-treated if supernatant still has dark matter, adds isopyknic XP2 solution; Thorough mixing is even, afterwards all solution is transferred in the HiBind DNA pillar, and the centrifugal 1min of 10000g discards effluent and reuses collection tube; Add 300ul XP2 solution, the centrifugal 1min of 10000g discards effluent and collection tube, puts into a new collection tube to pillar; Add the SPW wash solution that 700ul diluted through absolute ethyl alcohol, the centrifugal 1min of 10000g discards effluent and reuses collection tube, washes once with 700ul SPW wash solution again; Discard liquid, insert pillar in the empty collection tube, the centrifugal 2min of 13000g puts into 50 degree baking oven 30min with pillar; Be put into pillar in the new centrifuge tube, add 50ul elution buffer, 65 degree water-bath 10min, the centrifugal 1min of 13000g to the pillar center; Centrifugal elutriant is added in the pillar again, 65 degree water-bath 10min, the centrifugal 2min of 13000g, the gained elutriant is got the 5ul electrophoresis detection;
3) DNA behind the purifying is carried out pcr amplification; The primer that the first step amplification is adopted is 16s1:5 '-AGAGTTTGATCCTGGCTCAG-3 ' and 16s2:5 '-TACGGYTACCTTGTTACGACTT-3 '; The primer that the amplification of second step is adopted is: 338fGC:5 '-CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGACTCCTACGGGAGGCA GCAG-3 ' and R518:5 '-ATTACCGCGGCTGCTGG-3 '; Above primer is all synthetic by Shanghai Ying Jun biotech company; The primer and the reaction system that add amplification 16S rDNA total length are earlier carried out the first step amplification, and the PCR reaction system of 50 μ l is formed as follows: the dna profiling of 10ng (generally using 1 μ l), every kind of primer of 50pmol, 1 μ l dNTPs, 10 * PCR buffer of 5 μ l, the MgCl of 2.5mmol/L
2, 5U the Taq archaeal dna polymerase, an amount of distilled water is supplied 50 μ l, the PCR reaction conditions is: 94 ℃ of preparatory sex change 4min, then at 94 ℃ of sex change 45s, 50 ℃ of primer renaturation 45s, 72 ℃ of primer extension 1.5min circulate 30 times, 72 ℃ are extended eventually 10min; Getting its product and carry out after 100 times of dilutions as template, is that target increases with 16S rDNA V3 variable region, and the PCR reaction conditions is: 94 ℃ of preparatory sex change 4min; Then at 94 ℃ of sex change 45s, 55 ℃ of primer renaturation 45s, 72 ℃ of primer extension 1min; Circulate 35 times; 72 ℃ are extended 10min eventually, and the purpose product detects with 1% agarose gel electrophoresis, and electrophoretic buffer is 1 * TAE damping fluid;
4) adopt DCODE
TMSystem (BIO-RAD) makes up the DGGE finger printing, and concrete grammar is:, each sample 16S rDNAv3 district amplification purification product is separated (propylene phthalein amine concentration 35%-60% in 10% Vestolen PP 7052 sex change glue; Electrophoretic buffer 0.5-1x TAE); 100V, 12h, sample point sample amount 1000ng DNA;
5) under uv lamp, the advantage band is lancinated down with aseptic operation, and dye mark corresponding position in the collection of illustrative plates, behind aseptic water washing 3 times, put into the 1.5mLEP pipe, smash adding 30ul ddH with sterilization rifle head to pieces at silver
2O soaked 5 hours; EP is managed the centrifugal 5min of 12000rpm; Get supernatant as pcr template, not with special primer the 338f:5 '-ACTCCTACGGGAGGCAGCAG-3 ' that designs to 16S rDNAv3 district fragment of GC clip, under the guiding of R518:5 '-ATTACCGCGGCTGCTGG-3 '; Carry out pcr amplification, 50ul PCR reaction system is: the dna profiling of 10ng, every kind of primer of 50pmol, 1 μ l dNTPs, 10 * PCR buffer of 5 μ l, the MgCl of 2.5mmol/L
2, 3U the Taq archaeal dna polymerase, an amount of distilled water is supplied 50 μ l, adopts the nest-type PRC response procedures: 94 ℃ of preparatory sex change 4min, then at 94 ℃ of sex change 45s, 50 ℃ of primer renaturation 45s, 72 ℃ of primer extension 1.5min circulates 30 times, 72 ℃ of extension 10min eventually; Get the 3pl reaction product after reaction finishes and carry out the detection of 2% agarose gel electrophoresis, with CyC le-Pure DNA test kit the purpose fragment is reclaimed and purifying, and check order, order-checking is undertaken by Shanghai Ying Jun biotech company;
6) sequence of the sequencing result of step 5 and standard flora is compared, and confirms the predominant bacteria flora of pile-fermentation Leaf of Assam Tea, adopts that the Blast program is online carries out the sequence alignment analysis.
8. the primer special that step 3 adopts in the claim 1; It is characterized in that; The primer that the first step amplification is adopted is 16s1:5 '-AGAGTTTGATCCTGGCTCAG-3 ' and 16s2:5 '-TACGGYTACCTTGTTACGACTT-3 ', and the primer that the amplification of second step is adopted is: 338fGC:5 '-CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGACTCCTACGGGAGGCA GCAG-3 ' and R518:5 '-ATTACCGCGGCTGCTGG-3 '.
9. the primer special that step 3 adopts in the claim 1, it is characterized in that upstream primer 338F: sequence is: 5 ' ACTCCTACGGGAGGCAGCAG-3 '.
10. the primer special that step 5 adopts in the claim 1, it is characterized in that downstream primer R518: sequence is: 5 '-ATTACCGCGGCTGCTGG-3 '.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010622766.5A CN102533964B (en) | 2010-12-24 | 2010-12-24 | Predominant bacteria in Leaf of Assam Tea microorganism species and spectrogram thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010622766.5A CN102533964B (en) | 2010-12-24 | 2010-12-24 | Predominant bacteria in Leaf of Assam Tea microorganism species and spectrogram thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102533964A true CN102533964A (en) | 2012-07-04 |
| CN102533964B CN102533964B (en) | 2015-08-26 |
Family
ID=46341990
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201010622766.5A Active CN102533964B (en) | 2010-12-24 | 2010-12-24 | Predominant bacteria in Leaf of Assam Tea microorganism species and spectrogram thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102533964B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103898201A (en) * | 2012-12-28 | 2014-07-02 | 贵州国台酒业有限公司 | Making method of DGGE (Denaturing Gradient Gel Electrophoresis) marker of Daqu bacteria |
| CN105238696A (en) * | 2015-05-20 | 2016-01-13 | 梧州市农业科学研究所 | Fungus flora forming and strain obtaining method in Liubao tea pile fermentation process |
| CN111041118A (en) * | 2019-12-25 | 2020-04-21 | 山西晋城无烟煤矿业集团有限责任公司 | Method for rapidly detecting flora structure in drainage and production water of coal-bed gas well by using PCR-DGGE (polymerase chain reaction-denaturing gradient gel electrophoresis) |
| CN112921108A (en) * | 2020-12-24 | 2021-06-08 | 山西医科大学 | Kit and method for rapidly detecting food pathogenic bacteria salmonella |
| CN114778650A (en) * | 2022-03-11 | 2022-07-22 | 吉林大学 | Method for rapidly identifying pathogenic bacteria of blood infection by denaturing gradient gel electrophoresis |
-
2010
- 2010-12-24 CN CN201010622766.5A patent/CN102533964B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| MICHIHARU ABE ET AL: "Characteristic fungi observed in the fermentation process for Puer tea", 《INTERNATIONAL JOURNAL OF FOOD MICROBIOLOGY》 * |
| 李友发等: "福建省稻田土壤细菌群落的16S rDNA-PCR-DGGE分析", 《微生物学通报》 * |
| 黄进勇等: "麦田土壤细菌群落 16S rDNA V3片段PCR产物的DGGE分析", 《河南农业大学学报》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103898201A (en) * | 2012-12-28 | 2014-07-02 | 贵州国台酒业有限公司 | Making method of DGGE (Denaturing Gradient Gel Electrophoresis) marker of Daqu bacteria |
| CN103898201B (en) * | 2012-12-28 | 2018-06-05 | 贵州国台酒业有限公司 | A kind of yeast bacterium DGGE standard band production methods |
| CN105238696A (en) * | 2015-05-20 | 2016-01-13 | 梧州市农业科学研究所 | Fungus flora forming and strain obtaining method in Liubao tea pile fermentation process |
| CN111041118A (en) * | 2019-12-25 | 2020-04-21 | 山西晋城无烟煤矿业集团有限责任公司 | Method for rapidly detecting flora structure in drainage and production water of coal-bed gas well by using PCR-DGGE (polymerase chain reaction-denaturing gradient gel electrophoresis) |
| CN112921108A (en) * | 2020-12-24 | 2021-06-08 | 山西医科大学 | Kit and method for rapidly detecting food pathogenic bacteria salmonella |
| CN114778650A (en) * | 2022-03-11 | 2022-07-22 | 吉林大学 | Method for rapidly identifying pathogenic bacteria of blood infection by denaturing gradient gel electrophoresis |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102533964B (en) | 2015-08-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hong et al. | Comparison of CE-SSCP and DGGE for monitoring a complex microbial community remediating mine drainage | |
| CN102533964B (en) | Predominant bacteria in Leaf of Assam Tea microorganism species and spectrogram thereof | |
| Ciesielski et al. | Ribosomal intergenic spacer analysis as a tool for monitoring methanogenic archaea changes in an anaerobic digester | |
| CN101570786B (en) | Method for identifying structure of yeast colony of Daqu starter or fermented grain of distilled spirit by using denaturing gradient electrophoresis | |
| CN103898108B (en) | The nucleotide special to vibrio fluvialis O2, O4, O13, O15 and O18 and application thereof | |
| CN102071249A (en) | Method for identifying Maotai-flavor Daqu liquor | |
| CN102719541A (en) | Method for analyzing Bacillus community structure in white spirit fermentation system | |
| CN103103258A (en) | Method for analyzing generating trend of aflatoxin B1 in peanut meal by multiple PCR (Polymerase Chain Reaction) technology | |
| CN102329874B (en) | Real-time fluorescent quantitative PCR (polymerase chain reaction) detection method of ammonia-oxidizing bacteria in active sludge | |
| CN111057782A (en) | Method for detecting number of soil bacteria based on real-time fluorescent quantitative PCR | |
| CN108251553B (en) | Primer for detecting pathogenic bacteria of leaf spot of bighead atractylodes rhizome, method and application thereof | |
| CN102559862B (en) | Dominant fungi in Leaf of Assam Tea microorganism species and spectrogram thereof | |
| CN105039510B (en) | One kind is directed to Haliscomenobacter hydrossis der Pilz group's polymerase chain reaction methods in bulking sludge | |
| CN102559655B (en) | Method for extracting total DNA (Deoxyribonucleic Acid) of microorganisms from pile-fermentation Pu-erh tea | |
| Calli et al. | Identification of prevalent microbial communities in a municipal solid waste landfill | |
| CN101633954B (en) | Community chip for analyzing community structure and dynamic variation of activated sludge microbe | |
| CN103952468A (en) | DGGE analysis method for bacterial diversity in northeast naturally-fermented sauerkraut | |
| CN103898201B (en) | A kind of yeast bacterium DGGE standard band production methods | |
| CN103305616A (en) | Kit for verifying warehouse booklice based on specific primer | |
| CN106811538A (en) | The PCR DGGE analysis methods of specific spoilage organisms during a kind of peeled shrimp cryopreservation | |
| CN102242185A (en) | Simple and quick pretreatment method suitable for bacterial PCR (polymerase chain reaction) detection samples | |
| Di Bonito et al. | Characterization by length heterogeneity (LH)-PCR of a hydrogen-producing community obtained in dark fermentation using coastal lake sediment as an inoculum | |
| CN101792760A (en) | Method for obtaining nucleotide sequence in V3 region of 16S rRNA genes of bacteria and special primer thereof | |
| CN105200045A (en) | Nucleotides specific to vibrio fluvialis O11, O14, O16 and O17 as well as application of nucleotides | |
| CN104630356A (en) | Method for analyzing unknown microorganisms in soy source fermented grains |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |