CN102533829A - Method for constructing prfA gene deleted strain of Listeria monocytogenes - Google Patents
Method for constructing prfA gene deleted strain of Listeria monocytogenes Download PDFInfo
- Publication number
- CN102533829A CN102533829A CN2011104585133A CN201110458513A CN102533829A CN 102533829 A CN102533829 A CN 102533829A CN 2011104585133 A CN2011104585133 A CN 2011104585133A CN 201110458513 A CN201110458513 A CN 201110458513A CN 102533829 A CN102533829 A CN 102533829A
- Authority
- CN
- China
- Prior art keywords
- prfa
- gfp
- gene
- bacterium
- listeria monocytogenes
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for constructing a prfA gene deleted strain of Listeria monocytogenes. The method mainly comprises the following steps of: respectively designing primers according to target sequences of the selected prfA gene and gfp gene; constructing a pMD-T-delta prfA-gfp as a cloning vector; constructing a pKSV7-delta prfA-gfp as a recombinant shuttle vector; electrically transforming the pKSV7-delta prfA-gfp as the recombined shuttle vector to enter an LM competent cell; constructing an LM-delta prfA-gfp as a recombinant strain; and carrying out serial passage under a certain condition to obtain a stable genetic recombinant strain. According to the method disclosed by the invention, a gene at the deleted part of an LM-virulence gene expressed regulatory gene prfA is regulated and then is inserted into the gfp-established recombinant strain for expressing a GFP-delta prfA gene; and the prfA gene deleted strain has the advantages of high safety, strong stability and favorable immune effect.
Description
Technical field
The present invention relates to a kind of ability expressing green fluorescent protein (Green Fluorescent Protein; GFP) prfA genetically deficient reorganization listeria monocytogenes (LM); Particularly provide and to have prevented listeriosis; And the live vector that can express the eqpidemic disease that pathogenic micro-organism that exogenous antigen prevents to infect in the born of the same parents causes, belong to zoonosis molecule marker technical field of vaccines.
Background technology
(Listeria monocytogenes LM) is a kind of former bacterium of Amphixenosis that can cause the humans and animals listeriosis to listeria monocytogenes.On the Domestic Animal, LM can cause meningoencephalitis, miscarriage and acute septicemia; On poultry, LM can cause the generation of septicemia and myocardial necrosis, and should disease all cause bigger financial loss to China's livestock and poultry breeding industry every year.Simultaneously; As a kind of important food borne bacteria; This bacterium can pollute animal foods such as meat, milk, egg and cause foodborne illness; And can cause the grownup of pregnant woman, newborn infant and hypoimmunity to fall ill, and human beings'health is also constituted great threat, being classified as is one of four big foodborne bacterial pathogenses.In the end of the year 1999, the U.S. has taken place to have the most serious food poisoning that listerial food causes because of eating in history.Show 14 people are arranged because of edible dead according to U.S.'s the Centers for Disease Control and Prevention data, suffer from this disease other 22 state 97 people, 6 women's miscarriages by " hot dog " of this fungi pollution and cold cuts at Michigan, USA.Find LM in cheese that 1992-1995 France produces and the pork.In recent years, China's quality testing department repeatedly detects listeria monocytogenes from the food of home and overseas animal food process plants.Therefore, healthy in order to ensure people should be actively developed the development work of listeria monocytogenes attenuated live carrier bacterin.
Participate in that LM infects and the multiple virulence factor of diffusion all concentrate on one 9 Kb of its genome pathogenicity island (Listeria pathogenicity island 1, LIPI-1) in.This regional DNA encode respectively positive regulating factor (prfA), Phospholipase C a (plcA), hemolysin (LLO), rely on metalloprotease (mlp), actin polymerization albumen (actA) and 6 virulence factors of PI specificity lecithinase (plcB) of zinc.
Because LM has stronger virulence, before will being developed as the living vaccine carrier, need carry out molecular modification to its virulence gene, make it virulence attenuation of.In recent years, deepen continuously along with what the LM virulence gene was studied, the foreign scholar has carried out the Research for reconstruction of LIPI-1 pathogenicity island virulence gene.Angelakopoulos etc. (2002) have carried out dual deletion to actA and plcB virulence gene; The bacterial strain that obtains makes an experiment the volunteer on one's body; The most of volunteer of result does not find untoward reaction; Only minority has minor response, through 14 days immunologic surveillance, has produced strong humoral immunization and cellular immunization in volunteer's body.When LM LIPI-1 pathogenicity island virulence gene is transformed; Some scholars also insert allogenic gene in the LIPI-1 pathogenicity island encoding sox; The reorganization LM that obtains is virulence attenuation of not only, and the foreign protein of expressing can stimulate body to produce cellullar immunologic response effectively.
At present; It is domestic that to carry out the research work that LIPI-1 pathogenicity island virulence gene transforms at the early-stage; In animal experiment, obtained expected result, demonstrated good prospects for application, but the LM vaccine of up to the present also not recombinating both at home and abroad gets into the report of people's clinical trial; The report of also not succeeding in developing about animal Listeria monocytogenes commercialization less toxic vaccine, this virulence with LM reorganization bacterium itself is still relevant.
Therefore, want LM is developed to the living vaccine carrier and the less toxic vaccine of expression alien gene, must further cause weak transformation the virulence gene of LM.Along with further investigation to LM virulence factor expression regulation molecular mechanism; The proteins encoded of discovery prfA gene can be regulated and control most of virulence factors and the plain expression of internalization in the LM LIPI-1 pathogenicity island as a kind of transcriptional activators, and these molecules play an important role in LM invasion, diffusion and virulence.Therefore; If this gene is transformed; Just get a good chance of obtaining the reorganization LM that virulence further reduces; Thereby develop the Listeria monocytogenes living vaccine carrier that has use value, not only can effectively prevent listeriosis, and can express the eqpidemic disease that exogenous antigen prevents the pathogenic micro-organism of infection in the born of the same parents to cause.Given this; This project is a research object with the key molecule prfA gene in the highly pathogenic LM LIPI-1 pathogenicity island; A little less than intend adopting molecular biology method that it is carried out genetic modification and causes; Structure can be expressed the LM prfA gene recombination bacterium of GFP, and carries out reorganization bacteria growing characteristic, virulence, infection kinetics, genetic stability and immunogenicity research, and being intended to provides a kind of safe, reliable, efficient vaccine for listeriosis gets effectively to prevent and treat.
Summary of the invention
The object of the present invention is to provide a kind of utilization is research object with the key molecule prfA gene in the highly pathogenic LM LIPI-1 pathogenicity island; A little less than adopting molecular biology method that it is carried out genetic modification and causes; Structure can be expressed the safe of GFP; Stability is strong, and the LM prfA genetically deficient bacterium of good immune effect lays the foundation for further carrying out disappearance bacteria growing characteristic, virulence, infection kinetics, genetic stability and immunogenicity research.
The invention discloses the construction process of a kind of listeria monocytogenes prfA genetically deficient bacterium, it is characterized in that mainly may further comprise the steps:
(1), selects listeria monocytogenes prfA and homology arm gene, gfp gene order; Carry out primer design respectively according to the prfA gene of selecting and the target sequence of gfp gene; Wherein P1 and P2 primer amplification prfA and homology arm gene fragment, amplification length is 1519 bp; P3 and P4 primer amplification gfp gene fragment, amplification length is 720bp, primer sequence is:
P1: < 210>3, its restriction enzyme site is the Kpn I;
P2: < 210>4, its restriction enzyme site is the Xba I;
P3: < 210>5, its restriction enzyme site is the EcoR I;
P4: < 210>6, its restriction enzyme site is the BamH I;
(2), the structure of cloning vector pMD-T-△ prfA-gfp:
(1) extracts the listeria monocytogenes genomic dna;
(2) amplification contains prfA gene and homology arm fragment, gfp gene, extracts listeria monocytogenes genomic dna 2 L and pGFP-N1 plasmid 0.5 L as template;
(3) structure of cloning vector pMD19-T-prfA, pMD19-T-gfp: above-mentioned PCR product is connected with the pMD19-T carrier;
(4) structure of pMD19-T-△ prfA-gfp carrier: respectively pMD19-T-prfA and pMD19-T-gfp are carried out behind the synchronous double digestion gfp being connected among the pMD19-T-△ prfA with EcoR I, BamH I;
(3), the structure of recombinant shuttle vector pKSV7-△ prfA-gfp:
With Kpn I and Xba I shuttle vectors pKSV7 and pMD19-T-△ prfA-gfp are carried out behind the synchronous double digestion △ prfA-gfp being connected among the pKSV7;
(4), shuttle vectors pKSV7-△ prfA-gfp electricity is transformed entering LM competent cell:
(1) preparation of LM competent cell;
(a) the inoculation activation LM incubated overnight in 5～10ml BHI substratum of transferring;
(b) went in the fresh BHI substratum by 1:50～1:100 dilution switching on 1st, 37 ℃ of shaking culture 2.5h-3h, to OD600 be 0.4-0.5;
(c) adding concentration is the Penicillin G of 4～5 μ g/ml, continues to shake to OD6000.8～1.0;
(d) 3.5～4.5 ℃, 4500～5500rpm, centrifugal 10～12min collects bacterium;
(e) resuspended with 10～12ml sucrose glycerine buffered soln piping and druming of precooling, 8000～10000rpm, 3.5～4.5 ℃, 10～12min;
(f) deposition is dissolved with volume ratio 1/50～1/100 ultrapure water;
(g) the per 100 μ L of competence～200 μ L packing, one pipe is done existing usefulness at present;
(2) electricity transforms:
Change under the parameter at 2.45～2.55kv, 180～220 Ω and 23～27 μ F electricity; With the gene knockout plasmid pKSV7-△ prfA-gfp electricity transformed competence colibacillus bacterium that builds; Electricity is coated the BHI flat board that contains 40～60 μ g/ml penicillium mould with bacterium after changeing end; 36.9 cultivate 46～50h for～37.1 ℃, single bacterium colony that picking is all carries out single bacterium colony PCR with primer P1/P2 and identifies;
(5), the structure of reorganization bacterium LM-△ prfA-gfp:
The positive colony that will contain the gene knockout plasmid in the BHI liquid nutrient medium 36.9～37.1 ℃ be cultured to logarithmic phase; Coat after the dilution on 9～11 μ g/ml paraxin solid mediums; 41.9 cultured continuously 48-72h under～42.1 ℃ of conditions; Plasmid vector and DNA of bacteria are integrated, and realize homologous recombination through temperature and chlorampenicol resistant pressure; Picking list bacterium colony from the minimum flat board of bacteria colony count; The cultivation 36.9～37.1 ℃ of liquid go down to posterity; Use antibiotic-free BHI substratum when going down to posterity, every biography is once protected bacterium one time, confirms to begin to extract genomic dna after plasmid is lost fully to 30 generations of going down to posterity; With peripheral primer to P5: < 210>7/P6: < 210>8 carry out PCR identifies, in genome occurring, inserts the reorganization bacterium of gfp;
(6), pass through continuous passage under the certain condition, the reorganization bacterium of acquisition genetic stability: above-mentioned PCR product is carried out electrophoresis,, contain gfp in the interpret sample genome and insert gene if behind the electrophoresis, the PCR product clip size occurs and is about 2800 bp; If the nucleic acid fragment of 2200 bp size only occurs, then show and do not insert gfp in the sample in the genomic dna, homologous recombination does not promptly take place.
Amplification contains prfA gene and homology arm fragment, gfp gene in the above-mentioned steps (two); The confirming of its PCR reaction conditions preferably adopts 50 identical L PCR reaction systems; Consisting of of PCR reaction system: 10 * PCR damping fluid, 5 L, 25mmol/L MgCl2 4 L, 2.5mmol/L dNTP 4 L; P1, P2 or P3, each 1 L of P4 (25 pmol/ L); Extract listeria monocytogenes genomic dna 2 L and pGFP-N1 plasmid 0.5 L as template, Taq archaeal dna polymerase (1.5U/ L) 1 L adds deionized water to 50 L; PrfA and homology arm gene optimum cycle parameter are 95 ℃, 150 s; 94 ℃, 40 s; 59 ℃, 40 s; 72 ℃, 120s, last 72 ℃ are extended 10min; Gfp gene optimum cycle parameter is 95 ℃, 150 s; 94 ℃, 30 s; 55 ℃, 40 s; 72 ℃, 60s, last 72 ℃ are extended 10min.
The concrete requirement of design of primers is preferably in the above-mentioned steps (): G+C content is 45～65%, primer length 18～22nt, and it does not contain protectiveness base and restriction enzyme site, 55～70 ℃ of Tm values, amplified production length 1500～2000 bp.
The clone of listeria monocytogenes prfA gene and upstream and downstream homology arm, gfp gene: download has been announced from GenBank (DQ309883.2, AF303131.1) listeria monocytogenes gene and gfp gene order.Wherein in prfA gene and the upstream and downstream homology arm sequence the 260th the-the 973rd be the prfA gene; After the 879th the-the 949th disappearance, insert the gfp gene.
Explain: the sequence of (the 260th the-the 973rd base) was complete prfA gene between two sections thick surplus accorded with, and the thick surplus symbol of underscore is the gene fragment (the 879th the-the 949th bit base) of disappearance; Insert complete gfp gene at this position then.
The target sequence of prfA gene and the amplification of upstream and downstream homology arm is:
1 AAAGTTTACG?CATGTTGTTC?GCACCCAGTT?CTTTCAGGTC?CTGCTATGAA?ACGTATTGAA
61 GAATCGCCAA?TCGAAAAATT?AGTTGTTACA?AACTCCATCG?CTCTTCCAGA?AGAAAAATGG
121 ATTGACAAAA?TGGAACAATT?ATCTGTTGCA?GCTCTTCTTG?GCGAAGCAAT?CGTTCGCGTT
181 CATGAAAATG?CTTCTGTAAG?TTCTTTATTC?GAATAAAATA?TAAAACAGGA?TGCCTCATTG
241 AGACATCCTG?TTTTTTGAT
T?TAATTTAATT?TTCCCCAAGT?AGCAGGACAT?GCTAAATAAA
301 ACCATTCATC?TAATTTAGGA?GCATATCTTT?TGAGATAATC?AAGATTTTGT?ACATAAAAGC
361 ATGAATTTTT?ATACACGATA?ACTTTCTCTT?GCTTTAATTT?AGAAATAATT?CTGCTAACAG
421 CTGAGCTATG?TGCGATACCG?CTTGAATAGC?CTAACTCCTG?CATTGTTAAA?TTATCCAGTG
481 TAATCTTGAT?GCCATCAGGA?GTTTCTTTAC?CATACACATA?GGTCAGGATT?AAAAGTTGAC
541 CGCAAATAGA?GCCGAGCTTC?CCGTTAATCG?AAAAATCATT?AAATTTGGCT?AGGCTGTATG
601 AAACTTGTTT?TTGTAGGGTT?TGGAAAACAT?AGAAAAAGTG?CGTAAGATTC?TTGCTCAGTA
661 GTTCTTTTAG?TTCGTTTATT?TTGATAACGT?ATGCGGTAGC?CTGTTCGCTA?ATGACTTCTA
721 AATTATAATA?GCCAACCGAT?GTTTCTGTAT?CGATAAAGCC?AGACATTATA?ACGAAAGCAC
781 CTTTATAGTA?TTGTAAATTC?ATGATGGTCC?CGTTCTCGCT?AATACTTGTA?AGCTTTGTAA
841 TACCATCATA?TAGGAAAATA?CAATATTCTT?GTGGATCC
CA?TTGGTTAAAA?ATAAGTTCTT
901
TTTTATGAAA?TTGTTTTGGT?TTTATCCCGT?TAGTTTCTAA?ATATTTTTTG?AATTCTTCTG
961
?CTTGAGCGTT?CATGTCTCAT?CCCCCAATCG?TTTTTTATCG?CCCTTTTTTA?AAATACCCTA
1021 AAAACATTAG?GCAGTAACAA?CAATTGTTAG?CTGTTGAAAG?AAAGTCACGC?TAAATAATAT
1081 TTTTTACATA?TAGGATTTTA?TTATACAAAT?TTTGATTTCG?CAAAAGAAAT?GCATACATAT
1141 TTAAAAACGG?ATTTATTTAG?ATGTTAAAAT?TGAAATAGGG?TTAGTATATG?GTTCCGATGG
1201 TTGCTCGGAG?ATATACTAAC?CCTTTTTTTG?TAGGAATAAT?ATATGTTAGT?TGAATTTATT
1261 GTTTTTTATG?ATGTTTTTGA?TAGTTTGTTT?TTCGGGGAAG?TCCATGATTA?GAATGCCTAA
1321 TCCTCGAACT?TTTTCCGATG?TTAAGTTGAG?TACGAACTGC?TCTACTTTGT?TGTTTAATGC
1381 TGCAGCATAC?TGACGAGGTG?TGAATGTTAA?TGAAGTGGCA?CTAATATGGT?TAAGAAACAG
1441 TTTGTTGTCC?GCTTTAGAAG?CTTGATAAGC?AGTCTGGACA?ATCTCTTTGA?ATTTTGTTTT
1501 CACACTCGGA?CCATTGTAG
The present invention compares with the detection technique of routine has following advantage:
1, the expression GFP-Δ prfA gene recombination bacterium of the present invention's foundation is safe, and stability is strong, good immune effect.
2, additional benefit of the present invention is to insert gfp behind the regulatory gene prfA disappearance portion gene with regulation and control LM virulence gene expression, thereby the expression of each virulence gene is received when to a certain degree inhibition reaches remarkable reduction virulence immunogenicity is changed; Can be used to prevent and treat listeriosis, also can further be transformed into live vector vaccine and reach the anti-many sick effects of a seedling.
Description of drawings
Fig. 1 recombinates M:D, L-5000, S:Sample for listeria monocytogenes in the sample.
Fig. 2 is reorganization bacterium LM-△ prfA-gfp, M:D, L-5000, S:Sample for sample.
Fig. 3 does not contain listeria monocytogenes, M:D, L-5000, S:Sample in the sample.
Fig. 4 transforms the bacterium colony PCR qualification result that carries out behind the shuttle vectors pKSV7-△ prfA-gfp, M:D, L-5000 (5000,3000,2000,1500,1000,750,500,250,100) for electricity; 1,2,3,4 is that electricity changes positive bacterium colony (2168bp); 7,8,9 are the not electric bacterium colony (1448bp) that changes plasmid over to.
Fig. 5 extracts the PCR detected result that DNA of bacteria carries out for confirming after shuttle plasmid is lost, and identifies whether recombinate M:D, L-5000 (5000,3000,2000,1500,1000,750,500,250,100); 1 is the LM type strain; 2,3,4,6,7,9,10 is LM-△ prfA-gfp reorganization bacterium.
Fig. 6 is the structure PCR identification reaction condition data form of reorganization bacterium LM-△ prfA-gfp.
Embodiment
With reference to Fig. 1-Fig. 6, present embodiment divides the following steps operation:
1 selection listeria monocytogenes prfA and homology arm gene, gfp gene order are with primer premier 6.0 softwares difference design specific primers amplification purpose fragment;
1.1 the selection of listeria monocytogenes prfA and homology arm gene, gfp gene order
Listeria monocytogenes prfA that download has been announced from GenBank and homology arm gene, gfp gene order (GenBank accession number: DQ309883.2 and AF303131.1).
1.2 the design of Auele Specific Primer and synthetic
The target sequence of the prfA that selects and homology arm gene, gfp gene is imported respectively in primer premier 6.0 software programs, designed the Auele Specific Primer of two kinds of genes respectively.The concrete requirement of prfA gene primer design is: G+C content is 45～65%, primer length 18～22nt (not containing protectiveness base and restriction enzyme site), 55～70 ℃ of Tm values, amplified production length 1500～2000 bp.The gfp gene primer requires with the prfA gene roughly the same.Serve sea living worker's biotechnology Services Co., Ltd and carry out the synthetic of primer.
The structure of 2 cloning vector pMD-△ prfA-gfp;
2.1 the extraction of listeria monocytogenes genomic dna
With liquid nutrient medium the listeria monocytogenes of standard is carried out microbial culture; Get the centrifugal 2min of 1.5mL culture 12000rpm then; TE (pH8.0) damping fluid that in deposition, adds 200 L, piping and druming makes it to suspend again repeatedly, adds the Proteinase K (20mg/mL) of 100 L 10%SDS and 15 L; Mixing is in 37 ℃ of incubation 30min.And then add 100 L 5mol/L NaCl, fully mixing adds 80 L CTAB/NaCl solution again, 65 ℃ of incubation 10min again behind the mixing.Add isopyknic phenol/chloroform/primary isoamyl alcohol mixing again, the centrifugal 5min of 12000r/min changes in the new pipe, adds the Virahol of 2 volumes, mixes up to DNA precipitating gently, and deposition can be centrifugal a little.After 70% washing with alcohol of deposition with 1mL, the centrifugal ethanol of abandoning. in the exsiccant deposition, add an amount of TE solution dissolving genomic dna.
2.2 confirming of amplification prfA and homology arm gene, gfp gene PCR reaction conditions
Adopt 50 identical L PCR reaction systems.Consisting of of PCR reaction system: 10 * PCR damping fluid, 5 L; 25mmol/L MgCl2 4 L; 2.5mmol/L dNTP 4 L, P1, P2 or P3, each 1 L of P4 (25 pmol/ L) extract listeria monocytogenes genomic dna 2 L and pGFP-N1 plasmid 0.5 L as template; Taq archaeal dna polymerase (1.5U/ L) 1 L adds deionized water to 50 L.PrfA and homology arm gene optimum cycle parameter are 95 ℃, 150 s; 94 ℃, 40 s; 59 ℃, 40 s; 72 ℃, 120s, last 72 ℃ are extended 10min; Gfp gene optimum cycle parameter is 95 ℃, 150 s; 94 ℃, 30 s; 55 ℃, 40 s; 72 ℃, 60s, last 72 ℃ are extended 10min
2.3 the structure of cloning vector pMD19-T-prfA, pMD19-T-gfp;
The PCR product is connected with the pMD19-T carrier, and its reaction system is following:
10 μ L linked system: prfA and homology arm PCR thereof reclaim product: 3, and pMD19-T:0.5, the Sollution I: 5, ddH2O:1.5.
10 μ L linked systems are following: gfp PCR reclaims product: 4, and pMD19-T:0.5, the Sollution I: 5, ddH2O:0.5.
2.4 the structure of pMD19-T-△ prfA-gfp carrier
Respectively pMD19-T-prfA and pMD19-T-gfp are carried out behind the synchronous double digestion gfp being connected among the pMD19-T-△ prfA with EcoR I, BamH I.Its enzyme is cut with ligation following:
10 μ L enzymes are cut system: pMD19-T-prfA/pMD19-T-gfp: 5,10 * K buffer:1, EcoR I and BamH I: each 0.5, dd H2O:3.
10 μ L linked systems: pMD19-T-△ prfA:3, the gfp enzyme is cut product: 4,10 * T4 ligase enzyme: 1, dd H2O:2.
The structure of 3 recombinant shuttle vector pKSV7-△ prfA-gfp;
With Kpn I and Xba I shuttle vectors pKSV7 and pMD19-T-△ prfA-gfp are carried out behind the synchronous double digestion △ prfA-gfp being connected among the pKSV7.Its enzyme is cut with ligation following:
10 μ L enzymes are cut system: pMD19-T-△ prfA-gfp/pKSV7:4, Kpn I and Xba I: each 0.5,10 * M buffer:1, dd H2O:4.
10 μ L linked systems: pMD19-T-△ prfA-gfp enzyme is cut product: 3.5, and the pKSV7 enzyme is cut product: 1,10 * T4 ligase enzyme: 1, dd H2O: 4.5.
4 with shuttle vectors pKSV7-△ prfA-gfp electricity conversion entering LM competent cell
4.1 the preparation of LM competent cell
(1) the inoculation activation LM incubated overnight in the 5ml BHI substratum of transferring;
(2) went in the fresh BHI substratum 37 ℃ of shaking culture 2.5h to OD600 about 0.4 on 1st by 1:50 dilution switching;
(3) add Penicillin G (to final concentration be 5 μ g/ml) continue to shake to OD600 be 0.8;
(4) 4 ℃ of 5000rpm, centrifugal 10min collects bacterium;
(5) resuspended with the 10ml sucrose glycerine buffered soln piping and druming of precooling, 8000rpm, 4 ℃, 10min;
(6) deposition is dissolved with 1/100 ultrapure water;
(7) the per 100 μ L packing of competence one pipe is done existing usefulness at present.
4.2 electricity transforms
Change under the parameter at 2.5kv, 200 Ω and 25 μ F electricity; With the gene knockout plasmid pKSV7-△ prfA-gfp electricity transformed competence colibacillus bacterium that builds; Electricity is coated BHI flat board (containing 50 μ g/ml penicillium mould) with bacterium after changeing end; Cultivate 48h for 37 ℃, single bacterium colony that picking is all carries out single bacterium colony PCR with primer P1/P2 and identifies.
The structure of 5 reorganization bacterium LM-△ prfA-gfp:
The positive colony that will contain the gene knockout plasmid is that the positive bacteria of above-mentioned acquisition drops in the BHI liquid nutrient medium 37 ℃ and is cultured to logarithmic phase; Coat after the dilution on the 10 μ g/ml paraxin solid mediums; Cultured continuously 48h under 42 ℃ of conditions; Plasmid vector and DNA of bacteria are integrated, and realize homologous recombination through temperature and chlorampenicol resistant pressure; Antibiotic-free BHI substratum is used in the cultivation of going down to posterity of picking list bacterium colony from the minimum flat board of bacteria colony count, 37 ℃ of liquid when going down to posterity, every biography is once protected bacterium one time.Confirm to begin to extract genomic dna after plasmid is lost fully to 30 generations of going down to posterity, with peripheral primer P5/P6 is carried out PCR and identify said P5: < 210>7; P6: < 210>8, PCR reaction conditionss: 95 ℃ of 4min; 30 * (94 ℃ of 45s, 60 ℃ of 40s, 72 ℃ of 2min30s), 72 ℃ of 10min.With reference to Fig. 6, in genome occurring, insert the reorganization bacterium of gfp.
6, the molecular biology identification of reorganization bacterium LM-△ prfA-gfp:
Get 10 L PCR products on 1% sepharose, 120V electrophoresis 30 minutes is used ethidium bromide staining, under the UV-light transilluminator, observe then and take pictures, with standard DNA marker (D, L-5000) for referencial use.If behind the electrophoresis, occur clip size in the sepharose and be about 2800 bp, contain gfp in the interpret sample genome and insert gene (Fig. 1); If the nucleic acid fragment (Fig. 2) of 2200 bp size only occurs, then show and do not insert gfp in the sample in the genomic dna, homologous recombination does not promptly take place.
Embodiment 2:
With reference to Fig. 1-Fig. 6, present embodiment is with embodiment 1 different places: shuttle vectors pKSV7-△ prfA-gfp electricity is transformed get into the LM competent cell.
In the preparation of said LM competent cell:
(1) the inoculation activation LM incubated overnight in the 8ml BHI substratum of transferring;
(2) went in the fresh BHI substratum 37 ℃ of shaking culture 2.8h to OD600 about 0.5 on 1st by 1:80 dilution switching;
(3) add Penicillin G (to final concentration be 4 μ g/ml) continue to shake to OD600 be 0.9;
(4) 3.5 ℃ of 4500rpm, centrifugal 11min collects bacterium;
(5) resuspended with the 11ml sucrose glycerine buffered soln piping and druming of precooling, 9000rpm, 3.5 ℃, 11min;
(6) deposition is dissolved with 1/50 ultrapure water;
(7) the per 200 μ L packing of competence one pipe is done existing usefulness at present.
During said electricity transforms:
Change under the parameter at 2.45kv, 180 Ω and 23 μ F electricity; With the gene knockout plasmid pKSV7-△ prfA-gfp electricity transformed competence colibacillus bacterium that builds; Electricity is coated BHI flat board (containing 40 μ g/ml penicillium mould) with bacterium after changeing end; Cultivate 50h for 37 ℃, single bacterium colony that picking is all carries out single bacterium colony PCR with primer P1/P2 and identifies.
The structure of said reorganization bacterium LM-△ prfA-gfp:
The positive colony that will contain the gene knockout plasmid is that the positive bacteria of above-mentioned acquisition drops in the BHI liquid nutrient medium 37.1 ℃ and is cultured to logarithmic phase; Coat after the dilution on the 9 μ g/ml paraxin solid mediums; Cultured continuously 55h under 42 ℃ of conditions; Plasmid vector and DNA of bacteria are integrated, and realize homologous recombination through temperature and chlorampenicol resistant pressure; Antibiotic-free BHI substratum is used in the cultivation of going down to posterity of picking list bacterium colony from the minimum flat board of bacteria colony count, 36.9 ℃ of liquid when going down to posterity, every biography is once protected bacterium one time.Confirm to begin to extract genomic dna after plasmid is lost fully to 30 generations of going down to posterity, with peripheral primer P5/P6 is carried out PCR and identify said P5: < 210>7; P6: < 210>8, PCR reaction conditionss: 95 ℃ of 4min; 30 * (94 ℃ of 45s, 60 ℃ of 40s, 72 ℃ of 2min30s), 72 ℃ of 10min.With reference to Fig. 6, in genome occurring, insert the reorganization bacterium of gfp.
Embodiment 3:
With reference to Fig. 1-Fig. 6, present embodiment is with embodiment 1 different places: shuttle vectors pKSV7-△ prfA-gfp electricity is transformed get into the LM competent cell.
In the preparation of said LM competent cell:
(1) the inoculation activation LM incubated overnight in the 10ml BHI substratum of transferring;
(2) went in the fresh BHI substratum 37 ℃ of shaking culture 2.9h to OD600 about 0.5 on 1st by 1:100 dilution switching;
(3) add Penicillin G (to final concentration be 4 μ g/ml) continue to shake to OD600 be 1.0;
(4) 4.5 ℃ of 5500rpm, centrifugal 12min collects bacterium;
(5) resuspended with the 12ml sucrose glycerine buffered soln piping and druming of precooling, 10000rpm, 4.5 ℃, 12min;
(6) deposition is dissolved with 1/80 ultrapure water;
(7) the per 200 μ L packing of competence one pipe is done existing usefulness at present.
During said electricity transforms:
Change under the parameter at 2.55kv, 220 Ω and 27 μ F electricity; With the gene knockout plasmid pKSV7-△ prfA-gfp electricity transformed competence colibacillus bacterium that builds; Electricity is coated BHI flat board (containing 60 μ g/ml penicillium mould) with bacterium after changeing end; 37.1 ℃ cultivation 46h, single bacterium colony that picking is all carries out single bacterium colony PCR with primer P1/P2 and identifies.
The structure of said reorganization bacterium LM-△ prfA-gfp:
The positive colony that will contain the gene knockout plasmid is that the positive bacteria of above-mentioned acquisition drops in the BHI liquid nutrient medium 36.9 ℃ and is cultured to logarithmic phase; Coat after the dilution on the 11 μ g/ml paraxin solid mediums; 42.1 cultured continuously 65h under ℃ condition; Plasmid vector and DNA of bacteria are integrated, and realize homologous recombination through temperature and chlorampenicol resistant pressure; Antibiotic-free BHI substratum is used in the cultivation of going down to posterity of picking list bacterium colony from the minimum flat board of bacteria colony count, 37.1 ℃ of liquid when going down to posterity, every biography is once protected bacterium one time.Confirm to begin to extract genomic dna after plasmid is lost fully to 30 generations of going down to posterity, with peripheral primer P5/P6 is carried out PCR and identify said P5: < 210>7; P6: < 210>8, PCR reaction conditionss: 95 ℃ of 4min; 30 * (94 ℃ of 45s, 60 ℃ of 40s, 72 ℃ of 2min30s), 72 ℃ of 10min.With reference to Fig. 6, in genome occurring, insert the reorganization bacterium of gfp.
Embodiment 4:
With reference to Fig. 1-Fig. 6, present embodiment is with embodiment 1 different places: shuttle vectors pKSV7-△ prfA-gfp electricity is transformed get into the LM competent cell.
In the preparation of said LM competent cell:
(1) the inoculation activation LM incubated overnight in the 5ml BHI substratum of transferring;
(2) went in the fresh BHI substratum 37 ℃ of shaking culture 3h to OD600 about 0.5 on 1st by 1:50 dilution switching;
(3) add Penicillin G (to final concentration be 5 μ g/ml) continue to shake to OD600 be 0.8;
(4) 4 ℃ of 5000rpm, centrifugal 10min collects bacterium;
(5) resuspended with the 10ml sucrose glycerine buffered soln piping and druming of precooling, 10000rpm, 4.5 ℃, 12min;
(6) deposition is dissolved with 1/100 ultrapure water;
(7) the per 100 μ L packing of competence one pipe is done existing usefulness at present.
During said electricity transforms:
Change under the parameter at 2.5kv, 220 Ω and 25 μ F electricity; With the gene knockout plasmid pKSV7-△ prfA-gfp electricity transformed competence colibacillus bacterium that builds; Electricity is coated BHI flat board (containing 65 μ g/ml penicillium mould) with bacterium after changeing end; Cultivate 48h for 37 ℃, single bacterium colony that picking is all carries out single bacterium colony PCR with primer P1/P2 and identifies.
The structure of said reorganization bacterium LM-△ prfA-gfp:
The positive colony that will contain the gene knockout plasmid is that the positive bacteria of above-mentioned acquisition drops in the BHI liquid nutrient medium 37 ℃ and is cultured to logarithmic phase; Coat after the dilution on the 10 μ g/ml paraxin solid mediums; Cultured continuously 72h under 42 ℃ of conditions; Plasmid vector and DNA of bacteria are integrated, and realize homologous recombination through temperature and chlorampenicol resistant pressure; Antibiotic-free BHI substratum is used in the cultivation of going down to posterity of picking list bacterium colony from the minimum flat board of bacteria colony count, 37 ℃ of liquid when going down to posterity, every biography is once protected bacterium one time.Confirm to begin to extract genomic dna after plasmid is lost fully to 30 generations of going down to posterity, with peripheral primer P5/P6 is carried out PCR and identify said P5: < 210>7; P6: < 210>8, PCR reaction conditionss: 95 ℃ of 4min; 30 * (94 ℃ of 45s, 60 ℃ of 40s, 72 ℃ of 2min30s), 72 ℃ of 10min.With reference to Fig. 6, in genome occurring, insert the reorganization bacterium of gfp.
< 110>Shihezi Univ
< 120>construction process of a kind of listeria monocytogenes prfA genetically deficient bacterium
<141>
<160>?6
<210>?1
<211>?20
<212>?DNA
<213>Listeria monocytogenes (
Listeria monocytogenes, LM)
<220>
<221>?misc_feature
< 223>amplified target sequence prfA gene
<400>?1
1 AAAGTTTACG?CATGTTGTTC?GCACCCAGTT?CTTTCAGGTC?CTGCTATGAA?ACGTATTGAA
61 GAATCGCCAA?TCGAAAAATT?AGTTGTTACA?AACTCCATCG?CTCTTCCAGA?AGAAAAATGG
121 ATTGACAAAA?TGGAACAATT?ATCTGTTGCA?GCTCTTCTTG?GCGAAGCAAT?CGTTCGCGTT
181 CATGAAAATG?CTTCTGTAAG?TTCTTTATTC?GAATAAAATA?TAAAACAGGA?TGCCTCATTG
241 AGACATCCTG?TTTTTTGATT?TAATTTAATT?TTCCCCAAGT?AGCAGGACAT?GCTAAATAAA
301 ACCATTCATC?TAATTTAGGA?GCATATCTTT?TGAGATAATC?AAGATTTTGT?ACATAAAAGC
361 ATGAATTTTT?ATACACGATA?ACTTTCTCTT?GCTTTAATTT?AGAAATAATT?CTGCTAACAG
421 CTGAGCTATG?TGCGATACCG?CTTGAATAGC?CTAACTCCTG?CATTGTTAAA?TTATCCAGTG
481 TAATCTTGAT?GCCATCAGGA?GTTTCTTTAC?CATACACATA?GGTCAGGATT?AAAAGTTGAC
541 CGCAAATAGA?GCCGAGCTTC?CCGTTAATCG?AAAAATCATT?AAATTTGGCT?AGGCTGTATG
601 AAACTTGTTT?TTGTAGGGTT?TGGAAAACAT?AGAAAAAGTG?CGTAAGATTC?TTGCTCAGTA
661 GTTCTTTTAG?TTCGTTTATT?TTGATAACGT?ATGCGGTAGC?CTGTTCGCTA?ATGACTTCTA
721 AATTATAATA?GCCAACCGAT?GTTTCTGTAT?CGATAAAGCC?AGACATTATA?ACGAAAGCAC
781 CTTTATAGTA?TTGTAAATTC?ATGATGGTCC?CGTTCTCGCT?AATACTTGTA?AGCTTTGTAA
841 TACCATCATA?TAGGAAAATA?CAATATTCTT?GTGGATCCCA?TTGGTTAAAA?ATAAGTTCTT
901 TTTTATGAAA?TTGTTTTGGT?TTTATCCCGT?TAGTTTCTAA?ATATTTTTTG?AATTCTTCTG
961 CTTGAGCGTT?CATGTCTCAT?CCCCCAATCG?TTTTTTATCG?CCCTTTTTTA?AAATACCCTA
1021 AAAACATTAG?GCAGTAACAA?CAATTGTTAG?CTGTTGAAAG?AAAGTCACGC?TAAATAATAT
1081 TTTTTACATA?TAGGATTTTA?TTATACAAAT?TTTGATTTCG?CAAAAGAAAT?GCATACATAT
1141 TTAAAAACGG?ATTTATTTAG?ATGTTAAAAT?TGAAATAGGG?TTAGTATATG?GTTCCGATGG
1201 TTGCTCGGAG?ATATACTAAC?CCTTTTTTTG?TAGGAATAAT?ATATGTTAGT?TGAATTTATT
1261 GTTTTTTATG?ATGTTTTTGA?TAGTTTGTTT?TTCGGGGAAG?TCCATGATTA?GAATGCCTAA
1321 TCCTCGAACT?TTTTCCGATG?TTAAGTTGAG?TACGAACTGC?TCTACTTTGT?TGTTTAATGC
1381 TGCAGCATAC?TGACGAGGTG?TGAATGTTAA?TGAAGTGGCA?CTAATATGGT?TAAGAAACAG
1441 TTTGTTGTCC?GCTTTAGAAG?CTTGATAAGC?AGTCTGGACA?ATCTCTTTGA?ATTTTGTTTT
1501 CACACTCGGA?CCATTGTAG
<210>?2
<211>?20
<212>?DNA
<213>Jellyfish (
Jellyfish)
<220>
<221>?misc_feature
< 223>amplified target sequence gfp gene
<400>?1
1?gcgagatcta?tgagtaaagg?agaagaactt?ttcactggag?ttgtcccaat?tcttgttgaa
61?ttagatggtg?atgttaatgg?gcacaaattt?tctgtcagtg?gagagggtga?aggtgatgca
121?acatacggaa?aacttaccct?taaatttatt?tgcactactg?gaaaactacc?tgttccatgg
181?ccaacacttg?tcactacttt?ctcttatggt?gttcaatgct?tttcaagata?cccagatcat
241?atgaaacggc?atgacttttt?caagagtgcc?atgcccgaag?gttatgtaca?ggaaagaact
301?atatttttca?aagatgacgg?gaactacaag?acacgtgctg?aagtcaagtt?tgaaggtgat
361?acccttgtta?atagaatcga?gttaaaaggt?acagatttta?aagaagatgg?aaacattctt
421?ggacacaaat?tggaatacaa?ctataactca?cacaatgtat?acatcatggc?agacaaacaa
481?aagaatggaa?tcaaagttaa?cttcaaaatt?agacacaaca?ttgaagatgg?aagcgttcaa
541?ctagcagacc?attatcaaca?aaatactcca?attggcgatg?gccctgtcct?tttaccagac
601?aaccattacc?tgtccacaca?atctgccctt?tcgaaagatc?ccaacgaaaa?gagagaccac
661?atggtccttc?ttgagtttgt?aacagctgct?gggattacac?atggcatgga?tgaactatac
721?aaataa 726
<210>?3
<211>?21
<212>?DNA
<213>Listeria monocytogenes (
Listeria monocytogenes, LM)
<220>
<221>?misc_feature
< 223>primer P1
<400>?1
CGGGGTACCCTACAATGGTCCGAGTGTGAAA 31
<210>?4
<211>?20
<212>?DNA
<213>Listeria monocytogenes (
Listeria monocytogenes, LM)
<220>
<221>?misc_feature
< 223>primer P2
<400>?1
TGCTCTAGA?AAGTTTACGCATGTTGTTCGC 30
<210>?5
<211>?320
<212>?DNA
<213>Jellyfish (
Jellyfish)
<220>
<221>?misc_feature
< 223>primer P3
<400>?1
CCGGAATTCATGGTGAGCAAGGGCGAGGA 29
<210>?6
<211>?737
<212>?DNA
<213>Jellyfish (
Jellyfish)
<220>
<221>?misc_feature
< 223>primer P4
<400>?1
CGCGGATCCTTACTTGTACAGCTCGTCCATG 31
<210>?7
<211>?737
<212>?DNA
<213>Listeria monocytogenes (
Listeria monocytogenes, LM)
<220>
<221>?misc_feature
< 223>primer P5
<400>?1
ACCAAACCACTGGCTCAAACAC 22
<210>?8
<211>?737
<212>?DNA
<213>Listeria monocytogenes (
Listeria monocytogenes, LM)
<220>
<221>?misc_feature
< 223>primer P6
<400>?1
Claims (3)
1. the construction process of a listeria monocytogenes prfA genetically deficient bacterium is characterized in that mainly may further comprise the steps:
(1), selects listeria monocytogenes prfA and homology arm gene, gfp gene order, according to what select
PrfAGene with
GfpThe target sequence of gene carries out primer design respectively, wherein P1 and P2 primer amplification
PrfAAnd the homology arm gene fragment, amplification length is 1519 bp; P3 and P4 primer amplification
GfpGene fragment, amplification length are 720bp, and primer sequence is:
P1:<210>3, its restriction enzyme site does
KpnI;
P2:<210>4, its restriction enzyme site does
XbaI;
P3:<210>5, its restriction enzyme site does
EcoRI;
P4:<210>6, its restriction enzyme site does
BamHI;
(2), the structure of cloning vector pMD-T-△ prfA-gfp:
(1) extracts the listeria monocytogenes genomic dna;
(2) amplification contains prfA gene and homology arm fragment, gfp gene, extracts listeria monocytogenes genomic dna 2 μ L and pGFP-N1 plasmid 0.5 μ L as template;
(3) structure of cloning vector pMD19-T-prfA, pMD19-T-gfp: above-mentioned PCR product is connected with the pMD19-T carrier;
(4) structure of pMD19-T-△ prfA-gfp carrier: respectively pMD19-T-prfA and pMD19-T-gfp are carried out behind the synchronous double digestion gfp being connected among the pMD19-T-△ prfA with EcoR I, BamH I;
(3), the structure of recombinant shuttle vector pKSV7-△ prfA-gfp:
Use
KpnI with
XbaI carries out shuttle vectors pKSV7 and pMD19-T-△ prfA-gfp behind the synchronous double digestion △ prfA-gfp to be connected among the pKSV7;
(4), shuttle vectors pKSV7-△ prfA-gfp electricity is transformed entering LM competent cell:
(1) preparation of LM competent cell;
(a) the inoculation activation LM incubated overnight in 5～10ml BHI substratum of transferring;
(b) went in the fresh BHI substratum by 1:50～1:100 dilution switching on 1st, 37 ℃ of shaking culture 2.5h-3h are to OD
600Be 0.4-0.5;
(c) adding concentration is the Penicillin G of 4～5 μ g/ml, continues to shake to OD
6000.8～1.0;
(d) 3.5～4.5 ℃, 4500～5500rpm, centrifugal 10～12min collects bacterium;
(e) resuspended with 10～12ml sucrose glycerine buffered soln piping and druming of precooling, 8000～10000rpm, 3.5～4.5 ℃, 10～12min;
(f) deposition is dissolved with volume ratio 1/50～1/100 ultrapure water;
(g) the per 100 μ L of competence～200 μ L packing, one pipe is done existing usefulness at present;
(2) electricity transforms:
Change under the parameter at 2.45～2.55kv, 180～220 Ω and 23～27 μ F electricity; With the gene knockout plasmid pKSV7-△ prfA-gfp electricity transformed competence colibacillus bacterium that builds; Electricity is coated the BHI flat board that contains 40～60 μ g/ml penicillium mould with bacterium after changeing end; 36.9 cultivate 46～50h for～37.1 ℃, single bacterium colony that picking is all carries out single bacterium colony PCR with primer P1/P2 and identifies;
(5), the structure of reorganization bacterium LM-△ prfA-gfp:
The positive colony that will contain the gene knockout plasmid in the BHI liquid nutrient medium 36.9～37.1 ℃ be cultured to logarithmic phase; Coat after the dilution on 9～11 μ g/ml paraxin solid mediums; 41.9 cultured continuously 48-72h under～42.1 ℃ of conditions; Plasmid vector and DNA of bacteria are integrated, and realize homologous recombination through temperature and chlorampenicol resistant pressure; Picking list bacterium colony from the minimum flat board of bacteria colony count; The cultivation 36.9～37.1 ℃ of liquid go down to posterity; Use antibiotic-free BHI substratum when going down to posterity, every biography is once protected bacterium one time, confirms to begin to extract genomic dna after plasmid is lost fully to 30 generations of going down to posterity; With peripheral primer to P5: < 210>7/P6: < 210>8 carry out PCR identifies, in genome occurring, inserts the reorganization bacterium of gfp;
(6), pass through continuous passage under the certain condition, the reorganization bacterium of acquisition genetic stability: above-mentioned PCR product is carried out electrophoresis,, contain gfp in the interpret sample genome and insert gene if behind the electrophoresis, the PCR product clip size occurs and is about 2800 bp; If the nucleic acid fragment of 2200 bp size only occurs, then show and do not insert gfp in the sample in the genomic dna, homologous recombination does not promptly take place.
2. the construction process of listeria monocytogenes prfA genetically deficient bacterium as claimed in claim 1; It is characterized in that in the step (two) that amplification contains prfA gene and homology arm fragment, gfp gene; Its PCR reaction conditions adopts 50 identical μ L PCR reaction systems; Consisting of of PCR reaction system: 10 * PCR damping fluid, 5 μ L, 25mmol/L MgCl
24 μ L; 2.5mmol/L dNTP 4 μ L; P1, P2 or P3, each 1 μ L of P4 (25 pmol/ μ L); Extract listeria monocytogenes genomic dna 2 μ L and pGFP-N1 plasmid 0.5 μ L as template, Taq archaeal dna polymerase (1.5U/ μ L) 1 μ L adds deionized water to 50 μ L; PrfA and homology arm gene optimum cycle parameter are 95 ℃, 150 s; 94 ℃, 40 s; 59 ℃, 40 s; 72 ℃, 120s, last 72 ℃ are extended 10min; Gfp gene optimum cycle parameter is 95 ℃, 150 s; 94 ℃, 30 s; 55 ℃, 40 s; 72 ℃, 60s, last 72 ℃ are extended 10min.
3. according to claim 1 or claim 2 the construction process of listeria monocytogenes prfA genetically deficient bacterium; It is characterized in that the concrete requirement of design of primers is in the step (): G+C content is 45～65%; Primer length 18～22nt; It does not contain protectiveness base and restriction enzyme site, 55～70 ℃ of Tm values, amplified production length 1500～2000 bp.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011104585133A CN102533829A (en) | 2011-12-31 | 2011-12-31 | Method for constructing prfA gene deleted strain of Listeria monocytogenes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011104585133A CN102533829A (en) | 2011-12-31 | 2011-12-31 | Method for constructing prfA gene deleted strain of Listeria monocytogenes |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102533829A true CN102533829A (en) | 2012-07-04 |
Family
ID=46341860
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2011104585133A Pending CN102533829A (en) | 2011-12-31 | 2011-12-31 | Method for constructing prfA gene deleted strain of Listeria monocytogenes |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102533829A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103820374A (en) * | 2013-11-25 | 2014-05-28 | 南京新赛尔思生物科技有限公司 | Transformed and attenuated Listeria monocytogenes introducing human CD24 (cluster of differentiation 24) nucleotide sequence, and vaccine thereof |
| CN106978381A (en) * | 2017-03-23 | 2017-07-25 | 上海理工大学 | PrfA gene delections Listeria Monocytogenes and preparation method |
| CN107058203A (en) * | 2017-03-23 | 2017-08-18 | 上海理工大学 | The Listeria Monocytogenes and construction method of sigB gene delections |
-
2011
- 2011-12-31 CN CN2011104585133A patent/CN102533829A/en active Pending
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103820374A (en) * | 2013-11-25 | 2014-05-28 | 南京新赛尔思生物科技有限公司 | Transformed and attenuated Listeria monocytogenes introducing human CD24 (cluster of differentiation 24) nucleotide sequence, and vaccine thereof |
| CN103820374B (en) * | 2013-11-25 | 2016-04-27 | 南京新赛尔思生物科技有限公司 | Introduce conversion attenuation listeria bacteria and the vaccine thereof of people source CD24 nucleotide sequence |
| CN106978381A (en) * | 2017-03-23 | 2017-07-25 | 上海理工大学 | PrfA gene delections Listeria Monocytogenes and preparation method |
| CN107058203A (en) * | 2017-03-23 | 2017-08-18 | 上海理工大学 | The Listeria Monocytogenes and construction method of sigB gene delections |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102409003B (en) | Pichia pastoris for multi-copy high expression of recombined plectasin | |
| CN105801707B (en) | A kind of hemorrhagic disease of grass carp oral vaccine and its preparation and application | |
| CN101481695B (en) | Improved Rhizomucor miehei lipase gene and use thereof in yeast display | |
| CN102199581A (en) | Zearalenone toxin degradation enzyme and coding gene and application thereof | |
| CN104388368B (en) | Low-endotoxin escherichia coli prokaryotic expression engineering bacterial mutant strain and construction method | |
| CN103436478A (en) | Salmonella enteritidis double knockout attenuated mutant and preparation as well as application thereof | |
| CN104498418B (en) | A kind of gene regulation delay attenuation and the construction method for improving expression exogenous antigen Salmonella choleraesuls carrier | |
| CN102533829A (en) | Method for constructing prfA gene deleted strain of Listeria monocytogenes | |
| CN102399784A (en) | CpG oligonucleotide possessing immune enhancement activity to aquatic livestock, its preparation method and its application | |
| CN101402959A (en) | Promotor replacement method for improving volume of production of bacillus subtilis surfactin | |
| CN103013897A (en) | Lactobacillus casei ghost, preparation method and application thereof | |
| CN103981112A (en) | Double-promoter multi-copy recombinant pichia pastoris strain for highly producing endo-inulinase | |
| CN102277374A (en) | Preparation and application of genetic engineering subunit vaccine for infectious bursal disease | |
| CN102580076A (en) | Synthetic peptide vaccine for O-type foot and mouth disease of swine and preparation method thereof | |
| CN108640983B (en) | FvCPC2 protein and application of encoding gene thereof in regulating growth of various edible fungus hyphae and fruiting body development | |
| CN101654681A (en) | Lactobacillus food grade expression vector pMG36N and preparation method thereof | |
| CN102093998A (en) | Preparation method of antibacterial peptide cecropin feed additive | |
| CN102533775A (en) | Full-length complementary deoxyribonucleic acid (cDNA) sequence of Paralichthys olivaceus pattern recognition Toll-like receptor TLR21 and applications thereof | |
| CN109468256A (en) | Probiotics clone strain, the construction method of four copy F18 pili operon gene of integration and double copy F4 pili operon genes | |
| CN105624078B (en) | One plant of attenuation Salmonella choleraesuls and its preparation method and application | |
| CN106754592B (en) | Streptococcus suis 2-type Rex gene knockout mutant strain SS2-1 Δ Rex and its construction method and application | |
| CN102628083A (en) | Method for detecting insertion flanking sequence and copying quantity of Tgf2 transposon in goldfish genome | |
| CN108410900B (en) | Non-resistant lactobacillus plantarum anchoring expression vector p L PSa and preparation method thereof | |
| CN101525580B (en) | Amphiploid histidine auxotroph saccharomyces cerevisiae and constructing method thereof | |
| CN109735477A (en) | The preparation of the gene-deletion attenuated mutant strain of Listeria monocytogenes three and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C05 | Deemed withdrawal (patent law before 1993) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20120704 |