CN102532289B - Protein relevant to rice grain weight and encoding gene and application thereof - Google Patents
Protein relevant to rice grain weight and encoding gene and application thereof Download PDFInfo
- Publication number
- CN102532289B CN102532289B CN201010616323.5A CN201010616323A CN102532289B CN 102532289 B CN102532289 B CN 102532289B CN 201010616323 A CN201010616323 A CN 201010616323A CN 102532289 B CN102532289 B CN 102532289B
- Authority
- CN
- China
- Prior art keywords
- rice
- gene
- grain
- sequence
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a protein for increasing rice grain weight and an encoding gene and an application thereof. The protein is a protein shown as (1) or (2), wherein (1) is constituted by an amino acid residue sequence shown as SEQ ID No.1 in a sequence table, or (2) is obtained by performing substitution and/or deletion and/or addition of one or more amino acid residues on an amino acid residue sequence shown as SEQ ID No.1 in the sequence table and has the same activity as the amino acid residue sequence shown as SEQ ID No.1. The gene disclosed by the invention can be used for cultivating a novel rice variety with increased grain weight, and has important meaning.
Description
Technical field
The present invention relates to a kind of albumen and encoding gene and their application that improves rice grain weight.
Background technology
Paddy rice is important food crop, approaches in the world 50% population taking paddy rice as food, and improving constantly rice yield is the targets that the mankind constantly pursue.Research shows that the integrant that affects rice yield mainly contains three: tiller number, grain number per spike and grain are heavy.Grain recast is to affect one of important factor of rice yield gradually to attract widespread attention.Paddy rice is in natural evolvement and domestication's process, when constantly having met mankind's grain demand, allelic number is also in continuous minimizing, in recent years, along with rice molecular designs the perfect of breeding technique, in the urgent need to according to the situation of current paddy rice resource, effectively therefrom select and increase in addition genetic improvement of the kind of the heavy potentiality of grain, or the heavy gene of its control grain is separated and cloned, having very important theory significance and more practical value, is also an effective approach that solves a current rice breeding difficult problem.
China's rice genetic aboundresources; the new gene excavate from these richs in natural resources, rice grain weight being improved in location; not only provide theoretical support for cultivating high-yield rice new variety, and to strengthening the protection of China's paddy gene resource, resources advantage is become to economic advantages significant.
Innovation and creation content
The object of this invention is to provide a kind of albumen and encoding gene and their application that improves rice grain weight.
The albumen of raising rice grain weight provided by the invention, name is called GS6-t, derives from the mutant of Oryza common cultivated rice (O.sativa.) indica rice 93-11, is following 1) or 2) described protein:
1) the SEQ ID № in sequence table: 1 amino acid residue sequence;
2) by the SEQ ID № in sequence table: 1 amino acid residue sequence passes through replacement and/or disappearance and/or the interpolation of one or several amino-acid residue and has SEQ ID №: the protein of 1 the identical activity of amino acid residue sequence.
Sequence SEQ ID № in sequence table: the protein that 1 amino acid residue sequence is made up of 115 amino-acid residues.
The encoding gene (gs6-t) of the albumen of raising rice grain weight provided by the invention, its nucleotide sequence is one of following nucleotide sequences:
1) SEQ ID № in sequence table: 2 DNA sequence dna;
2) SEQ ID № in code sequence list: the polynucleotide of 1 protein sequence;
3) can be with 1 under the rigorous condition of height) nucleotide sequence of the DNA sequence dna hybridization that limits.
4) with 1) DNA sequence dna that limits has 90% above homology, and the identical function protein DNA sequence of encoding.
The rigorous condition of described height is in the solution of 0.1 × SSPE (or 0.1 × SSC), 0.1%SDS, hybridizes and wash film under 65 DEG C of conditions.Sequence SEQ ID № in sequence table: 2 DNA sequence dna is made up of 348 Nucleotide, for the reading frame of this gene or translation finish to TGA terminator codon from ATG is initial, amino acid product is sequence SEQID № in sequence table: 1.
The expression vector, clone and the engineering bacteria that contain gene of the present invention all belong to protection scope of the present invention.In amplification gs6-t, the primer pair of arbitrary fragment is also within protection scope of the present invention.
The application that above-mentioned gs6-t gene is brought up again in high transgenic paddy rice at cultivation particle is also protection content of the present invention.
The present invention also provides a kind of method that improves rice grain weight, the method, using paddy rice (Oryza sativa) gs6CGMCC № .4458 as donor parents, to wait improving grain heavy water rice varieties as receptor parent, isozygoty by hybridizing or backcrossing, screen recessive homozygous plants, obtain grain heavy higher than the described rice plant of waiting to improve grain heavy water rice varieties.Paddy rice (Oryza sativa) gs6 is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center on December 17th, 2010 and (is called for short CGMCC, address is: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica), preservation registration number is respectively CGMCC № .4458.
While using gs6-t to build plant expression vector, before its transcription initiation Nucleotide, can add any enhancement type, composing type, organizing specific type or inducible promoter, as cauliflower mosaic virus (CAMV) 35S promoter, general raw plain gene Ubiquitin promotor (pUbi) etc., they can be used alone or are combined with other plant promoter; In addition, while using gene constructed plant expression vector of the present invention, also can use enhanser, comprise translational enhancer or transcriptional enhancer, these enhanser regions can be ATG initiator codon or neighboring region initiator codon etc., but must be identical with the reading frame of encoding sequence, to ensure the correct translation of whole sequence.The source of described translation control signal and initiator codon is widely, can be natural, also can synthesize.Translation initiation region can be from transcription initiation region or structure gene.
For the ease of transgenic plant cells or plant are identified and are screened, can process plant expression vector used, as there is antibiotic marker thing (gentamicin marker, kantlex marker etc.) or the anti-chemical reagent marker gene (as anti-weedkiller gene) etc. of resistance.From the security consideration of transgenic plant, can not add any selected marker, directly with adverse circumstance screening transformed plant.
Carry the present invention encode the gene gs6-t that improves rice grain width plant expression vector can by using, Ti-plasmids, Ri plasmid, plant viral vector, directly delivered DNA, microinjection, electricity be led, the conventional biological method rice transformation cell or tissue such as agriculture bacillus mediated, and the rice cell of conversion or tissue cultivating are become to plant.
The present inventor finds in the time utilizing ethylmethane sulfonate (EMS) mutagenesis indica rice 93-11 to select mutant breeding material, when an original paddy gene (LOC_Os06g03710) coding region+348, site bases G sports (G348A) after base A, cause the premature termination of original gene translation and the forfeiture of function, and cause the remarkable increase that grain is heavy, thereby produce the gene gs6-t that can improve rice grain weight of the present invention.Experiment showed, the rice mutant gs6 of the encoder block that contains this mutator gene gs6-t is proceeded to after paddy rice by the mode that backcrosses, can significantly improve rice grain wide heavy with grain.This gene is for the research of rice grain width molecular mechanism, and the seed selection of new high-yielding rice varieties has important theory and practical significance, and provides an economy, approach fast and effectively for the thousand seed weight of Crop Improvement.The present invention has wide application space and market outlook at agriculture field.
Below in conjunction with the drawings and specific embodiments, the invention will be further described.
Brief description of the drawings
The comparison of Fig. 1 to be indica rice 93-11 and mutant gs6 seed shell after (b) and maturation at heading stage (a), after ripe seed (c);
Fig. 2 is the comparison of the thick and thousand seed weight of wide, the grain length of grain after indica rice 93-11 and mutant gs6 Grain Ripening, grain;
Fig. 3 obtains mutant gs6 and indica rice 93-11, the special green grass or young crops of long-grained nonglutinous rice a heavy comparison of recessive homozygous plants by the method for the selfing that backcrosses.
Fig. 4 is the hybridization of mutant gs6 and indica rice 93-11.
Fig. 5 is special blue or green the backcrossing of mutant gs6 and long-grained nonglutinous rice.
Embodiment
Embodiment 1, the acquisition and the functional verification thereof that improve the gene gs6-t of rice grain weight
One, improve the acquisition of the gene gs6-t of rice grain weight
1, acquisition and the phenotypic evaluation thereof of paddy rice (Oryza sativa) mutant gs6
First we utilize chemical mutagen EMS to carry out mutagenic treatment to the seed of indica rice 93-11 (purchased from national germplasm resource bank), to seed (M
o) carry out nothing and poison after processing, then farming method sowing routinely, fertilising and prevention and elimination of disease and pests, ripe after point individual plant results, mutant gs6 (M
1) phenotype obtain preliminary evaluation: grain is heavy significantly increases approximately 19% compared with wild-type contrast (being indica rice 93-11).Through M
2and M
3for repetitive identified, mutant gs6 grain type shows as genetic stability, as Fig. 1 shown indica rice 93-11 and mutant gs6 bloom before and ripe after seed phenotypic characteristic.The seed of simultaneously choosing indica rice 93-11 after 20 strain maturations and mutant gs6 carries out phenotypic evaluation (grain is wide, grain length, the thick and thousand seed weight of grain), as shown in Figure 2.
Paddy rice (Oryza sativa) gs6 is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center on December 17th, 2010 and (is called for short CGMCC, address is: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica), preservation registration number is respectively CGMCC № .4458.
2, improve the acquisition of the new gene gs6-t of rice grain weight
Build the F of paddy rice (Oryza sativa) mutant gs6 and long-grained nonglutinous rice special blue or green (purchased from national germplasm resource bank)
2segregating population, utilize the method for map based cloning to carry out the assignment of genes gene mapping, through the order-checking of 15.7kb candidate region being learnt to the acquisition of this phenotype of mutant gs6 is because an original paddy gene (LOC Os06g03710) coding region+348 site bases G in indica rice 93-11 sports (G348A) after base A (the 348th Nucleotide of 5 of sequence 2 ' end in sequence table), cause the premature termination of original gene translation and the forfeiture (completely losing of GRAS gene family conserved domain) of function, and cause the remarkable increase that grain is heavy.Therefore, show by above-mentioned experiment, one new of encoder block coding of above-mentioned of forming by sudden change improves the new albumen of rice grain weight.
Utilize primer sequence for GS6TF and GS6TR (GS6TF:5 ' ATGTTGGCGGGTTGCTCGTT 3 ', GS6TR:5 ' CCATACCTCATCGCCGTCG 3 ') the new gene gs6-t encoding sequence that obtains after the said mutation that can increase, concrete grammar is as described below:
Taking mutant gs6 genomic dna as template, taking GS6TF and GS6TR as primer, carry out pcr amplification, amplification obtains the gene fragment of 348bp, and order-checking shows, and this fragment has the nucleotide sequence of sequence 2 in sequence table.Albumen shown in sequence 1 in this fragment coding sequence table, i.e. the present invention improves the albumen of rice grain weight, and name is called GS6-t.
Two, improve the functional verification of the gene gs6-t of rice grain weight
1, the checking that backcrosses of mutant gs6 and mutagenesis parent indica rice 93-11
We hybridize (F taking paddy rice (Oryza sativa) mutant gs6 as male parent (donor) taking mutagenesis parent indica rice 93-11 as maternal (acceptor)
1), at 110 strain F
2in segregating population, obtain 28 recessive individual plant (F that isozygoty
2, other economical characters such as grain type are all identical with mutant gs6), wild-type is 3: 1 (x with the ratio that separates of saltant type
2=0.0121), illustrate and cause the heavy phenotypic variation increasing compared with mutagenesis parent indica rice 93-11 of the wide grain of rice mutant gs6 grain by single recessive gene control, i.e. mutator gene gs6-t.Heading stage is by (F after after 28 recessive individual plant bagging selfings of isozygotying points of individual plant results
3) carry out F
3generation plantation, each F
3family grain type is without separation, and detailed process as shown in Figure 4.
After plant maturation to each recessiveness F that isozygotys
3family is mixed results, chooses 100 seeds, utilizes electronic balance to claim its weight, and repeats 3 times, is converted into thousand seed weight after getting 3 mean values.Result as shown in the figure 3, each family and mutant gs6 are heavy without significant difference at grain, but a galassing of comparing with 93-11 all increases by 19%.
2, the special blue or green checking that backcrosses of mutant gs6 and long-grained nonglutinous rice
We hybridize (F taking paddy rice (Oryza sativa) mutant gs6 as male parent (donor) taking long-grained nonglutinous rice special blue or green (acceptor) as female parent
1), in 600 strain segregating populations, choose identical 10 strains of a type and the mutant gs6 recessive individual plant (BC that isozygotys
1f
1), then with the special green grass or young crops of the long-grained nonglutinous rice (BC that backcrosses
2f
1), at each F
2in segregating population (each F2 population size is between 100 strain-120), then choose all grain types common approximately 150 isozygoty recessive individual plant (BCs identical with mutant gs6
2f
2), after the selfing of blooming stage bagging, after point individual plant results, carry out BC
2f
3generation plantation, each BC is found in field observation
2f
3family grain type is all without separating, and detailed process as shown in Figure 5.
After plant maturation to each recessiveness BC that isozygotys
2f
3family is mixed results, chooses 100 seeds, utilizes electronic balance to claim its weight, and repeats 3 times, is converted into thousand seed weight after getting 3 mean values.As shown in Figure 3, it is special blue or green that result shows that the thousand seed weight of recessive homozygous plants is not only significantly higher than backcross parent long-grained nonglutinous rice to result, and be significantly higher than mutagenesis parent indica rice 93-11, and increase can reach 11.6%.
Claims (7)
1. an albumen, the SEQ ID № by sequence table: the protein that 1 amino acid residue sequence forms.
2. the encoding gene of albumen described in claim 1.
3. encoding gene according to claim 2, its nucleotide sequence is from SEQ ID №: 2 DNA sequence dna.
4. contain the recombinant expression vector of gene described in claim 2 or 3.
5. contain the recombinant bacterial strain of gene described in claim 2 or 3.
6. described in claim 2 or 3, gene is brought up again the application in high plant at cultivation grain; Described plant is paddy rice.
7. one kind is improved the method for rice grain weight, using paddy rice (Oryza sativa) gs6 CGMCC № .4458 as donor parents, to wait improving grain heavy water rice varieties as receptor parent, isozygoty by hybridizing or backcrossing, screen recessive homozygous plants, obtain grain heavy higher than the described rice plant of waiting to improve grain heavy water rice varieties.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010616323.5A CN102532289B (en) | 2010-12-31 | 2010-12-31 | Protein relevant to rice grain weight and encoding gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010616323.5A CN102532289B (en) | 2010-12-31 | 2010-12-31 | Protein relevant to rice grain weight and encoding gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102532289A CN102532289A (en) | 2012-07-04 |
| CN102532289B true CN102532289B (en) | 2014-06-18 |
Family
ID=46340441
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201010616323.5A Active CN102532289B (en) | 2010-12-31 | 2010-12-31 | Protein relevant to rice grain weight and encoding gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102532289B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1995347A (en) * | 2006-01-05 | 2007-07-11 | 华中农业大学 | Main effect gene GS3 for controlling rice grain length and weight |
| CN101161675A (en) * | 2006-10-13 | 2008-04-16 | 中国科学院上海生命科学研究院 | Rice big grain gene and uses thereof |
| WO2010041190A1 (en) * | 2008-10-06 | 2010-04-15 | Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. | Induced heterosis related mutations |
-
2010
- 2010-12-31 CN CN201010616323.5A patent/CN102532289B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1995347A (en) * | 2006-01-05 | 2007-07-11 | 华中农业大学 | Main effect gene GS3 for controlling rice grain length and weight |
| CN101161675A (en) * | 2006-10-13 | 2008-04-16 | 中国科学院上海生命科学研究院 | Rice big grain gene and uses thereof |
| WO2010041190A1 (en) * | 2008-10-06 | 2010-04-15 | Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. | Induced heterosis related mutations |
Non-Patent Citations (2)
| Title |
|---|
| 姚国新、卢磊.水稻粒重基因定位克隆研究.《安橄农业科学》.2007,第35卷(第27期),8468-8478. |
| 水稻粒重基因定位克隆研究;姚国新、卢磊;《安橄农业科学》;20071231;第35卷(第27期);8468-8478 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102532289A (en) | 2012-07-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106011167B (en) | The method of the application and rice fertility restorer of male sterility gene OsDPW2 | |
| CN103882033B (en) | Rice Panicle Traits regulatory gene PT2 and application thereof | |
| CN104313034B (en) | The application of male sterility gene OsLAP5 and the method for recovering male sterility of rice | |
| CN102640701B (en) | Selecting and breeding method for long-grained hybrid japonica rice | |
| CN1265151A (en) | Method for enhancement of naturally occurring cytoplasmic male sterility and for restoration of male fertility and uses thereof in hybrid crop prodn. | |
| CN104450744A (en) | Rice SBP-box transcription factor genes and application thereof | |
| Kaneko et al. | Radish | |
| CN112390865A (en) | Application of Zm5008 gene in regulating and controlling plant height and internode distance of corn | |
| CN107988252A (en) | Application of the bHLH73 albumen in regulation and control plant strain senior middle school | |
| JP2024520302A (en) | Mutation site, regulatory gene IBC, and its application in the rice ideal brittle stem mutant ibc | |
| CN108368518A (en) | The method for preparing monoploid and subsequent doubled haploid plant | |
| CN110305980B (en) | Breeding method and application of anti-clubroot high-oleic-acid rape | |
| CN108503700A (en) | Rice grain shape albumen and its encoding gene and application | |
| CN108823236A (en) | A kind of method that gene editing technology target practice OsELF3 gene extends Rice Heading | |
| US11603537B2 (en) | Method for improving rice yield by jointly knocking out ABA receptor PYL family genes and use thereof | |
| CN103288943B (en) | Protein bHLH13 (Basic Helix Loop Helix 13) as well as coding gene and application thereof | |
| CN110679471B (en) | Innovative breeding method for cymbidium germplasm | |
| CN102477091B (en) | Rice male sterile protein and coding gene and application thereof | |
| KR101201436B1 (en) | A black waxy giant embryo rice plant 'Milyang 263' harboring giant embryonic gene and breeding method thereof | |
| CN102532289B (en) | Protein relevant to rice grain weight and encoding gene and application thereof | |
| CN102532290B (en) | Protein for controlling rice grain weight as well as coding gene and application thereof | |
| CN102559698A (en) | Rice recessive bacterial leaf blight-resistant major gene xa 25 and application thereof in rice disease-resistant improvement | |
| CN110679476B (en) | Innovative breeding method of Huangrui group germplasm | |
| CN115369120A (en) | Rice temperature-sensitive dual-purpose sterile line fertility transformation starting point temperature regulation gene and application thereof | |
| CN109022481B (en) | Creation method of low-methane-emission rice variety |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |