CN102516365B - Anti-HIV (human immunodeficiency virus) polypeptide of Tibetan dolphin scorpion - Google Patents
Anti-HIV (human immunodeficiency virus) polypeptide of Tibetan dolphin scorpion Download PDFInfo
- Publication number
- CN102516365B CN102516365B CN 201110457978 CN201110457978A CN102516365B CN 102516365 B CN102516365 B CN 102516365B CN 201110457978 CN201110457978 CN 201110457978 CN 201110457978 A CN201110457978 A CN 201110457978A CN 102516365 B CN102516365 B CN 102516365B
- Authority
- CN
- China
- Prior art keywords
- polypeptide
- hiv
- ahivp
- scorpion
- virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
Abstract
The invention discloses anti-HIV (human immunodeficiency virus) polypeptide (AHIVP) of a Tibetan dolphin scorpion. The AHIVP of the Tibetan dolphin scorpion is obtained according to a molecular biological and chemical synthesis method, and the anti-HIV activity of the AHIVP of the Tibetan dolphin scorpion is tested by adopting an antibody neutralization method, so as to inhibit HIV viral infection in a low concentration. The AHIVP of the Tibetan dolphin scorpion has a wide prospect in curing and preventing diseases caused by HIV. The anti-HIV polypeptide has favorable activity to HIV, is simple and convenient to obtain, and can be used for further preparing, developing and utilizing anti-HIV medicines.
Description
Technical field
The invention belongs to biological technical field, relate to a kind of polypeptide of highly efficient anti-virus function.Specifically, the present invention relates to a kind of Tibet globefish scorpion antiviral polypeptide AHIVP and to the antivirus action of human immunodeficiency virus (HIV).
Background technology
Virus is widely distributed, can cause various human diseasess, is difficult to treatment, and harm humans is healthy.Such as the acquired human para-immunity Defect (AIDS) that HIV virus causes, this patient's immunologic function is partially or completely lost, and the CD4+ cell number reduces, generator opportunistic infections, tumour etc. then, and clinical manifestation is varied.This disease velocity of propagation is fast, case fatality rate is high, and can't cure at present.Influenza does not have medicine to cure at present, and influenza medicine on the market is merely able to alleviate flu-like symptom, by the immunological competence antagonism virus of human body self.Relatively effective means is the prevention of injected current influenza vaccine now, and efficient is 70% to 90%.Morph because influenza virus is as easy as rolling off a log, annual popular influenza virus type is different, therefore must the effect of annual vaccinate competence exertion.Hepatitis B has no idea to cure, and does not show effect but can control, in case infect, carries throughout one's life.Virus is difficult to kill, and is to have used host's active mechanism due to virus.Existing antiviral is generally the inhibitor that viral genetic copies, and the genetic material that these inhibitor also can suppress human body copies, and is also that tool is virose to human body, so method or the vaccination of now the most positive pre-anti-virus.But some virus is as influenza, HIV, and himself genetic material is unstable, easily undergos mutation, thereby makes before this vaccine to prophylactic effect reduction or the complete failure of this new mutated viruses.And the discovery of positively charged ion defense peptides makes people see the novel method for the treatment of virus disease.
The positively charged ion defense peptides is that a class is generated by the host, and a little peptide of class of the defensive effect of specificity performance in the natural immunity.This small molecule polypeptide is usually by 10-50 Amino acid profile, and static charge from+2 to+9 does not wait, and plays an important role in organism is resisted the invasion of microorganism.According to the difference of structure, the positively charged ion defense peptides can be divided into following a few class: contain amphipathic molecule, amphiphilicα-helix, the coiled structure of 2-4 β lamella and the molecule that contains higher structure.The positively charged ion defense peptides all has to bacterium, fungi, parasite and infecting of virus the effect of effectively resisting in vivo.Studies show that, melittin Melitiin and cecropin Cecropins express to suppress the propagation of HIV-1 virus by repressor gene under inferior toxicity concentration, magainin Magainin-2 has certain inhibition to simplexvirus HIV-1 and HIV-2, and these polypeptide are all α Corkscrews positively charged ion defense peptides.Present studies show that, α Corkscrews positively charged ion defense peptides specific effect is in tunicary RNA viruses and DNA virus, and its mode of action normally acts on the process of cell entry, or directly acts on the coating of virus.For example, Dermaseptin causes the inactivation of HIV by the coating that acts on HIV, thereby reaches antiviral effect.So the positively charged ion defense peptides is no longer traditional vaccine control, but reach antiviral purpose by direct inhibition virus.
In scorpion, the research of positively charged ion defense peptides has also had history for many years.Except the defense peptides of finding from lymphsystem, be wherein more the defense peptides that is separated to from the scorpion venom gland, hadrurin for example, Scorpine, opistoporin, parabutoporin, ISCT, pandinin.The function of these peptides is all effectively identified.This chamber is engaged in the research of scorpion toxin for a long time, screens at present and differentiate serial cationic polypeptide from the library.
AHIVP is a kind of anti-virus ability positively charged ion defense peptides that has, and our present result of study shows that the AHIVP anti-virus ability is strong, and toxicity is low; Add that AHIVP only has 13 amino acid, the industrial production cost is low, has broad prospects so positively charged ion antiviral peptide AHIVP is applied to antiviral.
Summary of the invention
Technical problem to be solved by this invention is to provide a kind of scorpion venom antiviral polypeptide, and antiviral activity is high, and this antiviral peptide contains 13 amino acid, and production cost is low, good water solubility.
The application of scorpion venom antiviral polypeptide in the medicine of preparation prevention and treatment HIV infection that provides is provided.The scorpion venom antiviral polypeptide AHIVP that provides has the function that suppresses virus infection, and inhibition is good, has no side effect.
To achieve these goals, adopt the method for chemosynthesis, obtained scorpion venom antiviral polypeptide AHIVP and structure homeopeptide thereof, the antivirus test result shows, antiviral polypeptide AHIVP and structure homeopeptide thereof have obvious restraining effect to HIV.When the concentration of AHIVP and structure homeopeptide thereof reached 10 μ g/mL, AHIVP and structure homeopeptide thereof just can 100% inhibition to the inhibiting rate of HIV.
The invention provides the anti-HIV polypeptide of a kind of Tibet globefish scorpion.
At first build high quality Tibet globefish scorpion venom glandular tissue cDNA library, the separation and the mRNA purifying that specifically comprise the total RNA of scorpion venom gland, the first chain of cDNA and the second chain are synthetic, double-stranded cDNA is connected and conversion with pSPORT1 carrier (available from American I nvitrogen), obtains scorpion venom glandular tissue cDNA library.On the basis that builds the library, carry out scale library order-checking, a new Tibet globefish scorpion antibiotic peptide gene, called after AHIVP have been found in sequential analysis.A kind of polypeptide gene of separation, its sequence is the nucleotide sequence shown in SEQ ID NO:1: aaagttccaatctgttgttccgatgcactctgaaacttaattaatgaaattttctc ttcagaccttcctttttaattacgttttaaaactagcaatttcacaatcagaagct ttcattcacaaaatttcacaccttctccacagaatttttggaaaaagaagtatgag agatatggatactatgaaatacttatcagaagctagtttgagtgcagctgacttga gaaccttacaaagactaatggaaaattactgattattataattgaatatctctata atgtttttagaaatatttttatacttttgaaaaaaaaaaa.70 amino-acid residues of the prosoma organization form coding of AHIVP are comprised of three parts, i.e. signal peptide (23 residues), mature peptide (13 residues) and precursor peptide (34 residues).Based on the processing rule of scorpion toxin precursor C-terminal residue, the last residue Phe of AHIVP end is excised by specificity carboxypeptidase (Carboxypeptidase), and by amidated (Fig. 1).Therefore, the invention provides Tibet globefish scorpion scorpion venom antibacterial peptide a: FIHKISHLLHRIF (SEQ ID NO:2).
Another purpose of the present invention is the homologous structure polypeptide that discloses one group of Tibet globefish scorpion AHIVP polypeptide.
Its sequence is the aminoacid sequence shown in SEQ ID NO:3～22.Mature peptide sequence (FIHKISHLLHRIF) according to AHIVP, use online NPS@server[DSC method (Discrimination of protein Secondary structure Class)] it is carried out secondary structure prediction, and utilize software AHTHEPROT2000 to show its secondary structure image.Result shows, AHIVP contains 100% α-Helix structure, has typically amphipathic (amphiphilic) α-Helix structure, contains the alkaline residue (His, Arg and Lys) of the clean positive charge of a large amount of bands.According to the spiral image, then AHIVP peptide sequence FIHKISHLLHRIF is carried out a large amount of point mutation or disappearance (table 1), find that FIX1X2IX3X4LLX5X6IF (X1, X2, X4, X5, X6 are any basic aminoacids, and X3 is arbitrary amino acid) sequence does not affect its amphiphatic feature.Therefore, the invention provides the homologous structure polypeptide (SEQ ID NO:3～22) of one group of Tibet globefish scorpion AHIVP polypeptide.
AHIVP polypeptide provided by the invention and structure homeopeptide thereof can the Effective Anti human immunodeficiency viruses.
By the way that solid state chemistry synthesizes, obtained purity and reached synthetic polypeptide A HIVP (Fig. 2 and Fig. 3) and structure homeopeptide thereof more than 98%.Antiviral result shows the efficient restraining effect that synthetic polypeptide A HIVP and structure homeopeptide thereof are bred HIV, and when 10 μ g/mL, AHIVP and structure homeopeptide thereof can reach 100% inhibition (table 2, Fig. 4, Fig. 5) to the inhibiting rate of HIV.
Table 1: Tibet plucked string instrument with a fretted fingerboard scorpion anti HIV-1 virus polypeptide A HIVP and structure homeopeptide thereof
Table 2: the IC of Tibet plucked string instrument with a fretted fingerboard scorpion polypeptide A HIVP and the anti-HIV of structure homeopeptide thereof
50
The AHIVP polypeptide that the present invention relates to and structure homeopeptide thereof, amino acid number is little, and production cost is low, good water solubility.AHIVP polypeptide and structure homeopeptide thereof have good restraining effect for HIV, and are free from side effects.Can be by the medicine of AHIVP polypeptide and structure homeopeptide preparation prevention and treatment HIV infection.Compare with existing antiviral, AHIVP polypeptide and structure homeopeptide thereof have more directly and effectively effect.
Description of drawings
Fig. 1 Tibet globefish scorpion anti-HIV polypeptide A HIVP gene and amino acid thereof.The corresponding amino sequence of cDNA sequence below for inferring; Signal peptide amino acid is with single underscore mark; Mature peptide amino acid is with the black matrix mark; The square frame partial amino-acid is the carboxypeptidase recognition site; Dash area amino acid is C end precursor peptide.
The HPLC purity figure of the anti-HIV polypeptide A of Fig. 2 Tibet globefish scorpion HIVP.
The anti-HIV polypeptide A of Fig. 3 Tibet globefish scorpion HIVP Mass Spectrometric Identification molecule spirogram.
The retarding effect of the anti-HIV polypeptide A of Fig. 4 Tibet globefish scorpion HIVP to HIV virus.
1. polypeptide was processed the TZM-b1 cell after 1 hour, virus infection TZM-b1 cell; 2. virus infection TZM-b1 cell is after 1 hour, and polypeptide is processed the TZM-b1 cell; 3. polypeptide and virus infect the TZM-b1 cell together; 4. after polypeptide and virus are mixed together 1 hour, then infect the TZM-b1 cell.
X-coordinate is polypeptide different treatment TZM-b1 groups of cells, and ordinate zou is the fluorescent value of TZM-b1 cell after polypeptide is processed.* (p＜0.05), * * (p＜0.01), and * * * (p＜0.001).
The broad spectrum of Fig. 5 Tibet globefish scorpion polypeptide A HIVP anti HIV-1 virus (13 strain Type B HIV-1 virus).
Embodiment
The following examples can make the present invention of those skilled in the art comprehend, but do not limit the present invention in any way.
Embodiment 1: the preparation of a kind of Tibet globefish scorpion anti human immune deficiency virus polypeptide.Step is as follows:
A: the extraction of the total RNA of scorpion venom gland (Trizol LS single stage method: Trizol LS is available from beautiful Invitrogen)
1. get that in the Tibet spy of 500mg, globefish scorpion tail gland is ground into fine powder in liquid nitrogen, add 10ml TRIZOLreagent mixing, room temperature (20-25 ℃, below identical) was placed 5 minutes; 2. then add the 2ml chloroform to mix 15 seconds, room temperature was placed 2-3 minute, centrifugal 15 minutes of 4 ℃ of lower 12000g; 3. the 1 times of volume Virahol of addition of fetching water, room temperature was placed 10 minutes, centrifugal 10 minutes of 4 ℃ of lower 12000g the RNA precipitation; 4. precipitate and use 5ml75% washing with alcohol, centrifugal 5 minutes of 7500g; 5. be dissolved in DEPC-treated water after RNA precipitation drying, 55-60 ℃ is incubated 10 minutes with thorough dissolving RNA.Whole process is carried out with reference to TRlZOL (Total RNAIsolation) Reagent Kit recommend method.The total RNA of the scorpion venom gland of preparation adopts its quality of denaturing formaldehyde detected through gel electrophoresis.Obtained the total RNA of high-quality scorpion venom gland.
The separation and purification of B:mRNA
Adopt PolyA Tract mRNA separation system (Promega, USA) separation and purified mRNA, its principle of work is based on the complementary pairing characteristic of Oligo (dT) and mRNA 3 ' end poly (A) tail, with biotin labeling Oligo (dT), hold the annealing of poly (A) to form crossbred by it and mRNA 3 ', then catch and wash vitamin H Oligo (dT)/mRNA crossbred with the magnetic bead and the magnetic separation rack that indicate the affinity element, use at last the ddH without the RNA enzyme
2O elutes it, reaches the purpose of separating mRNA from total RNA.1. the preparation of sample: RNA is joined in the GTC of the 800 μ l that contain 32 μ l beta-mercaptoethanols.2. the annealing of probe: get 250pM concentration Oligo (dT) 5 μ l, adding distil water to 50 μ l; The dilution buffer (dilution buffer has added 32 μ l beta-mercaptoethanols) that adds the 1.6ml preheating, with the RNA mixing, 70 ℃ of incubations 5 minutes.3. the activation of magnetic bead: get the magnetic bead SA-PMPS (available from beautiful Promega) of 1.2ml in the centrifuge tube of 1.5ml; With the resuspended SA-PMPS of 0.5 * SSC, with magnet stand absorption magnetic bead, original volume 0.5 * SSC washing SA-PMPS3 time.4. obtaining of mRNA: the RNA of 70 ℃ of incubations is mixed with SA-PMPS, and room temperature is placed to put in 5 minutes and is adsorbed magnetic bead on magnet stand, abandons supernatant liquor; The 0.5XSSC suspension magnetic bead of 2ml, washing repeats 2 times, removes for the last time SSC as far as possible; Add the ddH without the RNA enzyme
2O to magnetic bead, mixing gently, then centrifugal (12000g * 3 minute) or magnet stand absorption magnetic bead; Get supernatant, obtain mRNA.Concentration and purity by electrophoresis and ultraviolet determination mRNA.5. the precipitation of mRNA: add the dehydrated alcohol of glycogen and 2.5 times of volumes in the mRNA that will 4. obtain, precipitation is spent the night, and what mRNA will be for cDNA is synthetic.
C: the first chain cDNA is synthetic
1. add 2 μ l Not I Primer-adapter and 6 μ l mRNA (containing 3 μ gmRNA) in 1.5ml Ep pipe, 70 ℃ of incubation 10min are put in rapidly on ice, centrifugal after, add following ingredients: 4 μ l 5X first strand buffer; 2 μ l 0.1M DTT; 1 μ l 10mM dNTPs; 1 μ l H
2O。Centrifugal after mixing gently, put to 2min for 37 ℃; 2. add 5 μ l reversed transcriptive enzymes, get 2 μ l after mixing, add 1 μ l[α-
32P] dCTP (4 μ Ci) (spike pipe).With above-mentioned reactive component (sample hose) while 37 ℃ of incubation 1h, then put into termination reaction on ice; 3. for the spike pipe, add successively 43 μ l 20mM EDTA and 5 μ l yeast tRNA, after mixing, get respectively two part 10 μ l o'clock on two filter membranes, wash 3 times each 5min for 1 part with 10%TCA, 98% ethanol is washed 1 time, and after dry air, putting into the 1.5ml scintillation solution (is 1
#Sample); After another 1 part of dry air, putting into the 1.5ml scintillation solution (is 2
#Sample).Another 30 μ l traced fluids add 1.5 μ l 7.5M Ammonium Acetate (NH
4Oac) and 90 μ l dehydrated alcohols (20 ℃), after mixing immediately 14, the centrifugal 20min of 000rpm abandons supernatant, add 0.5ml70% dehydrated alcohol (20 ℃), the centrifugal 2min of 14,000rpm abandons supernatant, 37 ℃ of dry 10min allow ethanol volatilize, be dissolved in 10 μ l TEN solution, add 10 μ l 2X sample loading buffers, get 10 μ l and be used for alkaline gel electrophoresis.With [α-
32P] dCTP mark λ DNA HindIII fragment makes molecular weight marker; 4. place 15min under room temperature after mixing, add 2 μ l 0.2M EDTA termination reactions.Get 6 μ l reaction solutions and 6ml 2X alkalescence electrophoretic buffer mixing, after electrophoresis 5h, soak 20min with 7%TCA, until the bromjophenol blue flavescence.Then blot (8h left and right) with toilet paper, carry out radioautograph; 5. for sample hose, be used for the synthetic of the second chain.
D: the second chain cDNA is synthetic
1. add successively following ingredients on ice in sample hose; 2. gently after mixing, 16 ℃ of incubation 2h; 3. add 2 μ l (10units) T4DNA polysaccharases, continue 16 ℃ of reaction 5min; 4. change on ice, add 10 μ l0.5M EDTA; 5. add equal-volume (150 μ l) phenol/chloroform/primary isoamyl alcohol (25/24/1), thoroughly after vortex, under room temperature 14, the centrifugal 5min of 000rpm.Change water (140 μ l) over to another 1.5ml Ep pipe; 6. the 7.5M NH that adds 70 μ l
4OAc and 0.5ML dehydrated alcohol (20 ℃), after vortex, under room temperature 14, the centrifugal 20min of 000rpm; 7. abandon supernatant, add 0.5ml 70% ethanol (20 ℃), the same centrifugal 2min.Abandon supernatant, 37 ℃ of dry 10min.
E: double-stranded cDNA is connected with Sal I adapter
1. with the cDNA sample of the 25 real D of μ l aqua sterilisa dissolving, then according to the form below adds successively; 2. mixing gently, 16 ℃ of reactions spend the night (approximately 20h).3. use (25/24/1) extracting of phenol/chloroform/primary isoamyl alcohol and NH
4After Oac/ ethanol precipitation, 37 ℃ of dry 10min.
F:NotI digests double-stranded cDNA
1. the sample with E is dissolved in 41 μ l, and then according to the form below adds successively; 2. after mixing, 37 ℃ of incubation 2h; 3. use phenol/chloroform/primary isoamyl alcohol (25/24/1) extracting once, then use 7.5M NH
4Oac/ ethanol precipitation, 37 ℃ of dry 10min.4. be dissolved in 70 μ l TEN, get 1 μ l and be used for quantitatively, all the other-20 ℃ save backup.
G: excessive Sal I adapter and the enzyme removed in double-stranded cDNA molecule are cut small segment
Cut small segment with nucleon extraction and purification kit (Amersham, USA) the excessive Sal I adapter of removal and enzyme.1. room temperature low suspension resin, then get 600 μ l and be added in centrifugal column, and the centrifugal 10s of 2000rpm removes liquid.Central authorities add the 40 above-mentioned cDNA solution of μ l at resin.The same centrifugal; 2. collect elutriant and be used for ligation.
H: double-stranded cDNA is connected and conversion with the pSPORT1 carrier
1. add successively following ingredients in 1.5ml Ep pipe; 2. react 16h under room temperature; 3. add successively following ingredients in 2. reaction solution: 5.0 μ l yeast tRNA, 12.5 μ l 7.5M NH4Oac, 70 μ l dehydrated alcohols (20 ℃).14000 centrifugal 20min immediately after the vortex mixing; 4. precipitation with 70% ethanol (20 ℃) washing, is dissolved in 4 μ l after 37 ℃ of dryings; 5. get 2 μ l electric shocks and transform 50 μ l E.coli K12MC1061.Identify the quality in library with PCR method, forward primer: 5 ' TCGACCCACGCGTCCG 3 ' (pressing SalI adapter sequences Design); Reverse primer: 5 ' GAGCGGCCGCCCT15 3 ' (pressing the sequences Design of NotI primer-adapter).
I: random sequencing Policy Filtering cDNA library
Selected clone from the Tibet globefish scorpion venom gland cDNA library that builds is served the rich company size order-checking in sea three.Sequence typing software is BioEdit v4.5.8 (Tom Hall, 1999), homology comparison and signal peptide cutting site forecasting software are respectively CLUSTAL X 1.8 (Thompson et al., 1997) and PC/GENE (Intelligenetics Inc., Switzerland).A brand-new antiviral polypeptide gene, called after AHIVP have been found in sequential analysis.Its sequence is the nucleotide sequence shown in SEQ ID NO:1: aaagttccaatctgttgttccgatgcactctgaaacttaattaatgaaattttctc ttcagaccttcctttttaattacgttttaaaactagcaatttcacaatcagaagct ttcattcacaaaatttcacaccttctccacagaatttttggaaaaagaagtatgag agatatggatactatgaaatacttatcagaagctagtttgagtgcagctgacttga gaaccttacaaagactaatggaaaattactgattattataattgaatatctctata atgtttttagaaatatttttatacttttgaaaaaaaaaaa (Fig. 1).70 amino-acid residues of the prosoma organization form coding of AHIVP are comprised of three parts, i.e. signal peptide (23 residues), mature peptide (13 residues) and precursor peptide (34 residues).Based on the processing rule of scorpion toxin precursor C-terminal residue, the last residue Phe of AHIVP end is excised by specificity carboxypeptidase (Carboxypeptidase).The aminoacid sequence of antiviral polypeptide AHIVP is: FIHKISHLLHRIF (SEQ ID NO:2).
The structural analysis of embodiment 2:AHIVP polypeptide and homologous structure polypeptide thereof
Mature peptide sequence (FIHKISHLLHRIF) according to AHIVP, use online NPS@server[DSC method (Discrimination of protein Secondary structure Class)] it is carried out secondary structure prediction, and utilize software AHTHEPROT 2000 to show its secondary structure image.Result shows, AHIVP contains 100% α-Helix structure, has typically amphipathic (amphiphilic) α-Helix structure, contains the alkaline residue (His, Arg and Lys) of the clean positive charge of a large amount of bands.According to the spiral image, then AHIVP peptide sequence FIHKISHLLHRIF is carried out a large amount of point mutation or disappearance (table 1), find that FIX1X2IX3X4LLX5X6IF (X1, X2, X4, X5, X6 are any basic aminoacids, and X3 is arbitrary amino acid) (SEQ ID NO:3) sequence does not affect its amphiphatic feature.
Embodiment 3: chemosynthesis AHIVP polypeptide and homologous structure polypeptide thereof
Carry out synthetic according to the aminoacid sequence (FIHKISHLLHRIF and FIX1X2IX3X4LLX5X6IF) of AHIVP and homologous structure polypeptide thereof.The synthetic way of solid state chemistry has obtained highly purified AHIVP polypeptide (Fig. 2 and Fig. 3) and homologous structure polypeptide (table 1) thereof.
The cytotoxicity of embodiment 4:AHIVP polypeptide and homologous structure polypeptide thereof and hemolytic detect
1) mtt assay detects the cytotoxicity of AHIVP polypeptide and homologous structure polypeptide thereof: 1. Vero cell and TZM-b1 cell dissociation counting, be seeded to 96 orifice plates by the 7000-10000/ hole, and 37 ℃, 5%CO
2Cultivate 24h.AHIVP polypeptide or its homologous structure polypeptide are carried out gradient dilution, join in cell culture medium, make it final concentration and be respectively 25,50,75,100,150,200,250,500 μ g/ml, each concentration is established 3-5 multiple hole, 37 ℃, 5%CO
2Cultivate 48h; 2. take out culture plate, every hole adds the MTT solution 20 μ l of 5mg/ml (PBS preparation, i.e. 0.5%MTT), jog mixing, 37 ℃, 5%CO
2Hatch 4h; 3. suck substratum, every hole adds 100 μ l DMSO, and room temperature jolts 20min, makes the dissolving fully of Viola crystallina precipitation; Detect each hole light absorption value with microplate reader under the 570nm wavelength, calculate cell survival rate.The hole (substratum, MTT, dimethyl sulfoxide (DMSO)) of returning to zero is set simultaneously, control wells (the medicine dissolution medium of cell, same concentrations, nutrient solution, MTT, dimethyl sulfoxide (DMSO)).Result is as demonstration, the Cytotoxic CC of AHIVP and the amphiphilic polypeptide of homologous structure thereof
50All greater than 250 μ g/ml.
2) hemolytic detects: the Healthy People anticoagulation is provided by Hospital of Wuhan University.Centrifugal collection hemocyte is washed 2-3 time with 1 * Hepes (pH7.2), 1200g, and 10min is centrifugal, and hemocyte is with the resuspended counting of physiological saline, with 10
7-10
8/ hole adds to 96 orifice plates; AHIVP polypeptide or its homologous structure polypeptide are carried out gradient dilution, join in cell culture medium, make it final concentration and be respectively 25,50,75,100,150,200,250,500 μ g/ml, as feminine gender and positive control, each concentration is established 3-5 multiple hole with physiological saline and Triton X-100, hatch 30-60min for 37 ℃, 1000g, 5min centrifuging and taking supernatant 100 μ l, detect light absorption value with microplate reader under the 570nm wavelength, calculate hemolysis rate.Result is as showing, the hemolytic HC50 of AHIVP and homologous structure polypeptide thereof is all greater than 500 μ g/ml.
Embodiment 5: Tibet globefish scorpion active A HIVP polypeptide and homologous structure polypeptide thereof the retarding effect to HIV
1) Vero cell, the HeLa (cultivation of the cell of CD4-LTR/ β-Gal) and TZM-b1 cell.(CD4-LTR/ β-Gal), TZM-b1 cell are available from Chinese Typical Representative culture collection center for Vero cell, HeLa.Cell culture medium is: 10% (substratum goes down to posterity) or 2% (maintain base) calf serum (FCS, GIBCO-BRL), 56 ℃, 30 minutes heat sterilizations; 2mM/mL D-glutamicacid salt; 100U/mL penicillin and 100 μ g/mL Streptomycin sulphates.Culture condition is: 37 ℃, the 5%CO2 incubator is cultivated.
2) virus strain and copying.The HIV strain that this research is used derives from Wuhan virus institute (6535, QH0692, SC422661, PVO, TRO, AC10, PHPA4259 etc.) of the Chinese Academy of Sciences.Concrete operation method: cell cultures is to degree of converging 70-80%, and the sucking-off substratum adds HIV virus or defective HIV viral dilution liquid, and 37 ℃ adsorb approximately 2h, replenishes the 2%FBS-MEM substratum to normal volume of culture, puts 37 ℃, 5%CO
2Cultivate.Approximately after 48-72h, treat that the 80-90% pathology appears in cell monolayer, multigelation 3-5 time, collecting cell and supernatant are to centrifuge tube, and 4 ℃ of centrifugal 10min of 3000-4000rpm remove cell debris, the supernatant packing, and-80 ℃ save backup.
Measure AHIVP polypeptide and homologous structure polypeptide thereof to the retarding effect of HIV.The AHIVP polypeptide of 50 μ L and homologous structure polypeptide thereof mix with the virus that 50 μ L collect respectively with the series concentration of 0.6,1.2,2.5,5.0,10,20 μ g/mL, both all make solvent with the maintain base; Negative control is that 50 μ L maintain bases mix with 50 μ L viruses, and the negative control polypeptide is mucroporin-S1.Hatched 1 hour in 37 ℃ after mixing.10 times of proportional diluted of virus after hatching.The virus of processing in second step adds the cell of monolayer adherence, every hole 50 μ L.The AHIVP polypeptide of each concentration and homologous structure polypeptide thereof arrange 3 repeating holes.Virus was 37 ℃ of adherent cells 2 hours.Then 1000g is centrifugal 10 minutes, removes supernatant liquor.Again add the fresh maintain base of 100 μ L, at 37 ℃, 5%CO
2Incubator was cultivated 48 hours.After 48 hours, observe the titre (TCID of virus in 96 orifice plates
50Perhaps fluorescence intensity).(CD4-LTR/ β-Gal) cell can present blueness, can calculate according to the number of blue cell titre and the inhibiting rate of virus to be subject to the HeLa of HIV virus infection.Be subject to HIV virus infection TZM-b1 cell and fluorescence can occur, fluorescence intensity has been reacted the titre of HIV virus.Suppress experimental result and show, Tibet globefish scorpion AHIVP polypeptide and homologous structure polypeptide thereof have significant retarding effect to the human immunodeficiency virus, and HIV virus is had broad spectrum (table 2, Fig. 4, Fig. 5).
SEQUENCE LISTING
＜110〉Wuhan University
＜120〉a kind of Tibet globefish scorpion anti human immune deficiency virus polypeptide
＜130〉a kind of Tibet globefish scorpion anti human immune deficiency virus polypeptide
<160> 22
<170> PatentIn version 3.3
<210> 1
<211> 320
<212> DNA
＜213〉Tibet globefish scorpion
<400> 1
aaagttccaa tctgttgttc cgatgcactc tgaaacttaa ttaatgaaat tttctcttca 60
gaccttcctt tttaattacg ttttaaaact agcaatttca caatcagaag ctttcattca 120
caaaatttca caccttctcc acagaatttt tggaaaaaga agtatgagag atatggatac 180
tatgaaatac ttatcagaag ctagtttgag tgcagctgac ttgagaacct tacaaagact 240
aatggaaaat tactgattat tataattgaa tatctctata atgtttttag aaatattttt 300
atacttttga aaaaaaaaaa 320
<210> 2
<211> 13
<212> PRT
＜213〉Tibet globefish scorpion
<400> 2
Phe Ile His Lys Ile Ser His Leu Leu His Arg Ile Phe
1 5 10
<210> 3
<211> 13
<212> PRT
＜213〉artificial sequence
<400> 3
Phe Ile His Lys Ile Ser Arg Leu Leu Lys Arg Ile Phe
1 5 10
<210> 4
<211> 13
<212> PRT
＜213〉artificial sequence
<400> 4
Phe Ile His Lys Ile Ala Arg Leu Leu His Arg Ile Phe
1 5 10
<210> 5
<211> 13
<212> PRT
＜213〉artificial sequence
<400> 5
Phe Ile Arg Lys Ile His Arg Leu Leu Lys Arg Ile Phe
1 5 10
<210> 6
<211> 13
<212> PRT
＜213〉artificial sequence
<400> 6
Phe Ile Arg Lys Ile Ile Arg Leu Leu Lys Arg Ile Phe
1 5 10
<210> 7
<211> 13
<212> PRT
＜213〉artificial sequence
<400> 7
Phe Ile Arg Arg Ile Ala Arg Leu Leu Lys Arg Ile Phe
1 5 10
<210> 8
<211> 13
<212> PRT
＜213〉artificial sequence
<400> 8
Phe Ile Arg Arg Ile Arg Arg Leu Leu Lys Arg Ile Phe
1 5 10
<210> 9
<211> 13
<212> PRT
＜213〉artificial sequence
<400> 9
Phe Ile Arg Lys Ile Ala Lys Leu Leu Lys Arg Ile Phe
1 5 10
<210> 10
<211> 13
<212> PRT
＜213〉artificial sequence
<400> 10
Phe Ile Arg Lys Ile Ala His Leu Leu Lys Arg Ile Phe
1 5 10
<210> 11
<211> 13
<212> PRT
＜213〉artificial sequence
<400> 11
Phe Ile Arg Lys Ile Asp Arg Leu Leu His Arg Ile Phe
1 5 10
<210> 12
<211> 13
<212> PRT
＜213〉artificial sequence
<400> 12
Phe Ile Arg Lys Ile Asp Arg Leu Leu Lys Arg Ile Phe
1 5 10
<210> 13
<211> 13
<212> PRT
＜213〉artificial sequence
<400> 13
Phe Ile Arg Lys Ile Leu Arg Leu Leu Arg Arg Ile Phe
1 5 10
<210> 14
<211> 13
<212> PRT
＜213〉artificial sequence
<400> 14
Phe Ile Arg Lys Ile Ser His Leu Leu Arg Arg Ile Phe
1 5 10
<210> 15
<211> 13
<212> PRT
＜213〉artificial sequence
<400> 15
Phe Ile Arg Arg Ile Ser His Leu Leu Lys Lys Ile Phe
1 5 10
<210> 16
<211> 13
<212> PRT
＜213〉artificial sequence
<400> 16
Phe Ile Arg Lys Ile Ala Arg Leu Leu Lys Arg Ile Phe
1 5 10
<210> 17
<211> 12
<212> PRT
＜213〉artificial sequence
<400> 17
Phe Ile His Lys Ile His Leu Leu His Arg Ile Phe
1 5 10
<210> 18
<211> 12
<212> PRT
＜213〉artificial sequence
<400> 18
Phe Ile His Lys Ile Ser His Leu His Arg Ile Phe
1 5 10
<210> 19
<211> 12
<212> PRT
＜213〉artificial sequence
<400> 19
Phe Ile His Lys Ile Ser His Leu Leu His Arg Phe
1 5 10
<210> 20
<211> 12
<212> PRT
＜213〉artificial sequence
<400> 20
Phe His Lys Ile Ser His Leu Leu His Arg Ile Phe
1 5 10
<210> 21
<211> 11
<212> PRT
＜213〉artificial sequence
<400> 21
Phe Ile His Lys Ile His Leu His Arg Ile Phe
1 5 10
<210> 22
<211> 11
<212> PRT
＜213〉artificial sequence
<400> 22
Phe His Lys Ile His Leu Leu His Arg Ile Phe
1 5 10
Claims (3)
1. the Tibet globefish scorpion antiviral polypeptide AHIVP of a separation, its aminoacid sequence is shown in SEQ ID NO:2.
2. the application of AHIVP polypeptide claimed in claim 1 on the medicine of preparation prevention or treatment HIV infection.
3. the medicine of prevention or treatment HIV infection, wherein contain AHIVP polypeptide claimed in claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110457978 CN102516365B (en) | 2011-12-31 | 2011-12-31 | Anti-HIV (human immunodeficiency virus) polypeptide of Tibetan dolphin scorpion |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110457978 CN102516365B (en) | 2011-12-31 | 2011-12-31 | Anti-HIV (human immunodeficiency virus) polypeptide of Tibetan dolphin scorpion |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102516365A CN102516365A (en) | 2012-06-27 |
| CN102516365B true CN102516365B (en) | 2013-06-19 |
Family
ID=46287480
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110457978 Expired - Fee Related CN102516365B (en) | 2011-12-31 | 2011-12-31 | Anti-HIV (human immunodeficiency virus) polypeptide of Tibetan dolphin scorpion |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102516365B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103360464A (en) * | 2013-07-17 | 2013-10-23 | 武汉摩尔生物科技有限公司 | Polypeptide, DNA molecule encoding polypeptide, vector, preparation method and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101284870A (en) * | 2008-06-03 | 2008-10-15 | 武汉大学 | Polypeptides of anti-measles virus and human immunodeficiency virus and use |
| CN101284869A (en) * | 2008-06-03 | 2008-10-15 | 武汉大学 | Antiviral polypeptides and use |
-
2011
- 2011-12-31 CN CN 201110457978 patent/CN102516365B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101284870A (en) * | 2008-06-03 | 2008-10-15 | 武汉大学 | Polypeptides of anti-measles virus and human immunodeficiency virus and use |
| CN101284869A (en) * | 2008-06-03 | 2008-10-15 | 武汉大学 | Antiviral polypeptides and use |
Non-Patent Citations (4)
| Title |
|---|
| Antibacterial and antifungal properties of alpha-helical,cationic peptides in the venom of scorpions from southern Africa;Moerman L et al.;《EUROPEAN JOURNAL OF BIOCHEMISTRY》;20021031;第269卷(第19期);4799-4810 * |
| Cysteine-free peptides in scorpion venom: geographicaldistribution, structure-function relationship and mode of action;Elgar D et al.;《AFRICAN JOURNAL OF BIOTECHNOLOGY》;20061231;第5卷(第25期);2495-2502 * |
| ElgarDetal..Cysteine-freepeptidesinscorpionvenom:geographicaldistribution structure-function relationship and mode of action.《AFRICAN JOURNAL OF BIOTECHNOLOGY》.2006 |
| MoermanLetal..Antibacterialandantifungalpropertiesofalpha-helical cationic peptides in the venom of scorpions from southern Africa.《EUROPEAN JOURNAL OF BIOCHEMISTRY》.2002 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102516365A (en) | 2012-06-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Falco et al. | Expression and antiviral activity of a β-defensin-like peptide identified in the rainbow trout (Oncorhynchus mykiss) EST sequences | |
| Gong et al. | Genome-wide characterization of Toll-like receptor gene family in common carp (Cyprinus carpio) and their involvement in host immune response to Aeromonas hydrophila infection | |
| Wang et al. | Tissue expressions of nine genes important to immune defence of the Pacific white shrimp Litopenaeus vannamei | |
| Lei et al. | Difference between hemocyanin subunits from shrimp Penaeus japonicus in anti-WSSV defense | |
| Hultcrantz et al. | Interferons induce an antiviral state in human pancreatic islet cells | |
| Balla et al. | Linking virus discovery to immune responses visualized during zebrafish infections | |
| Zhuang et al. | Three new piscidins from orange-spotted grouper (Epinephelus coioides): Phylogeny, expression and functional characterization | |
| Swain et al. | Molecular characterization, inductive expression and mechanism of interleukin‐10 gene induction in the Indian major carp, catla (Catla catla) | |
| Cao et al. | Identification and characterization of the related immune-enhancing proteins in crab Scylla paramamosain stimulated with rhubarb polysaccharides | |
| Vaseeharan | cDNA cloning, characterization and expression of lipopolysaccharide and β-1, 3-glucan binding protein (LGBP) gene from the Indian white shrimp Fenneropenaeus indicus | |
| Chen et al. | Mj-DWD, a double WAP domain-containing protein with antiviral relevance in Marsupenaeus japonicus | |
| Shen et al. | Molecular characterization and expression analyses of two homologues of interferon-stimulated gene ISG15 in Larimichthys crocea (Family: Sciaenidae) | |
| CN113754750B (en) | Antibacterial peptide and application thereof in aquaculture | |
| Chu et al. | Characterisation and function of TRIM23 in grass carp (Ctenopharyngodon idella) | |
| Charoensapsri et al. | Laminin receptor protein is implicated in hemocyte homeostasis for the whiteleg shrimp Penaeus (Litopenaeus) vannamei | |
| Yao et al. | Zebrafish ubiquitin-specific peptidase 5 (USP5) activates interferon resistance to the virus by increase the expression of RIG-I | |
| Meng et al. | Development and characterization of a skin cell line from Chinese perch (Siniperca chuatsi) and its application in aquatic animal viruses | |
| Zhang et al. | First identification and genetic characterization of a novel duck astrovirus in ducklings in China | |
| CN102516365B (en) | Anti-HIV (human immunodeficiency virus) polypeptide of Tibetan dolphin scorpion | |
| Berthet et al. | Complete genome characterization of the Arumowot virus (unclassified Phlebovirus) isolated from Turdus libonyanus birds in the Central African Republic | |
| Zhao et al. | Molecular cloning and expression analysis of common carp Cyprinus carpio tumor necrosis factor-α | |
| Nchioua et al. | The Delta variant of SARS-CoV-2 maintains high sensitivity to interferons in human lung cells | |
| CN102250217A (en) | Hyla simplex skin injury repair promotion polypeptides and genes as well as application thereof | |
| Buonocore et al. | A CD83-like molecule in sea bass (Dicentrarchus labrax): Molecular characterization and modulation by viral and bacterial infection | |
| CN109438559B (en) | Polypeptide for resisting multiple drug-resistant acinetobacter baumannii |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130619 Termination date: 20211231 |