CN102516365A - Anti-HIV (human immunodeficiency virus) polypeptide of Tibetan dolphin scorpion - Google Patents
Anti-HIV (human immunodeficiency virus) polypeptide of Tibetan dolphin scorpion Download PDFInfo
- Publication number
- CN102516365A CN102516365A CN2011104579787A CN201110457978A CN102516365A CN 102516365 A CN102516365 A CN 102516365A CN 2011104579787 A CN2011104579787 A CN 2011104579787A CN 201110457978 A CN201110457978 A CN 201110457978A CN 102516365 A CN102516365 A CN 102516365A
- Authority
- CN
- China
- Prior art keywords
- polypeptide
- hiv
- ahivp
- scorpion
- ile
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
Abstract
The invention discloses anti-HIV (human immunodeficiency virus) polypeptide (AHIVP) of a Tibetan dolphin scorpion. The AHIVP of the Tibetan dolphin scorpion is obtained according to a molecular biological and chemical synthesis method, and the anti-HIV activity of the AHIVP of the Tibetan dolphin scorpion is tested by adopting an antibody neutralization method, so as to inhibit HIV viral infection in a low concentration. The AHIVP of the Tibetan dolphin scorpion has a wide prospect in curing and preventing diseases caused by HIV. The anti-HIV polypeptide has favorable activity to HIV, is simple and convenient to obtain, and can be used for further preparing, developing and utilizing anti-HIV medicines.
Description
Technical field
The invention belongs to biological technical field, relate to a kind of polypeptide of highly efficient anti-virus function.Specifically, the present invention relates to a kind of Tibet globefish scorpion antiviral polypeptide AHIVP and to the antivirus action of human immunodeficiency virus (HIV).
Background technology
Virus distributes extensively, can cause various human diseasess, is difficult to treatment, and harm humans is healthy.Such as the acquired human immune deficiency disease (AIDS) that HIV virus causes, this patient's immunologic function is partially or completely lost, and the CD4+ cell number reduces, generator opportunistic infections, tumour etc. then, and clinical manifestation is varied.This disease velocity of propagation is fast, case fatality rate is high, and can't cure at present.Influenza does not have medicine to cure at present, and influenza medicine on the market is merely able to alleviate flu-like symptom, through the immunological competence antagonism virus of human body self.Relatively effective means is the prevention of injected current influenza vaccine now, and efficient is 70% to 90%.Because influenza virus is as easy as rolling off a log to morph, annual popular influenza virus type is different, therefore must the effect of annual vaccinate competence exertion.Hepatitis B has no idea to cure, and does not show effect but can control, in case infect, carries throughout one's life.Virus is difficult to kill, and is because virus has been used host's active mechanism.Existing antiviral is generally the suppressor factor that viral genetic is duplicated, and the genetic material that these suppressor factor also can suppress human body duplicates, to human body also be have toxic, so the method or the vaccination of now the most positive prevention virus.But some virus is like influenza, HIV, and himself genetic material is unstable, undergos mutation easily, thereby makes vaccine before this reduce perhaps complete failure to the prophylactic effect of this new mutated viruses.And the discovery of positively charged ion defense peptides makes people see the novel method of treatment virus disease.
The positively charged ion defense peptides is one type and is generated by the host, and one type of little peptide of the defensive effect of specificity performance in the natural immunity.This small molecule polypeptide is made up of 10-50 amino acid usually, and static charge from+2 to+9 does not wait, and in organism is resisted the invasion of mikrobe, plays an important role.According to the difference of structure, the positively charged ion defense peptides can be divided into following several types: contain amphipathic molecule, amphiphilic, the coiled structure of 2-4 β lamella and the molecule that contains higher structure.The positively charged ion defense peptides all has the effect of effectively resisting to bacterium, fungi, parasite and infecting of virus in vivo.Research shows; Melittin Melitiin and cecropin Cecropins express the propagation that suppresses HIV-1 virus through repressor gene under inferior toxicity concentration; MSI-344 Magainin-2 has certain inhibition effect to simplexvirus HIV-1 and HIV-2, and these polypeptide all are α Corkscrews positively charged ion defense peptides.Present research shows that α Corkscrews positively charged ion defense peptides specific effect is in tunicary RNA viruses and dna virus, and its mode of action normally acts on the process that virus gets into, or directly acts on the coating of virus.For example, Dermaseptin causes the inactivation of HIV through the coating that acts on HIV, thereby reaches antiviral effect.So the positively charged ion defense peptides no longer is the traditional vaccine control, but reaches antiviral purpose through direct inhibition virus.
The research of positively charged ion defense peptides has also had history for many years in the scorpion.Except the defense peptides of from lymphsystem, finding, more be the defense peptides that from the scorpion venom gland, is separated to wherein, hadrurin for example, Scorpine, opistoporin, parabutoporin, ISCT, pandinin.The function of these peptides is all effectively identified.This chamber is engaged in the research of scorpion toxin for a long time, from the library, screens and differentiate serial cationic polypeptide at present.
AHIVP is a kind of anti-virus ability positively charged ion defense peptides that has, and our present result of study shows that the AHIVP anti-virus ability is strong, and toxicity is low; Add that AHIVP has only 13 amino acid, the industrial production cost is low, has broad prospects so positively charged ion antiviral peptide AHIVP is applied to antiviral.
Summary of the invention
Technical problem to be solved by this invention is to provide a kind of scorpion venom antiviral polypeptide, and antiviral activity is high, and this antiviral peptide contains 13 amino acid, and production cost is low, good water solubility.
The invention still further relates to the application of scorpion venom antiviral polypeptide in the medicine of preparation prevention and treatment HIV infection that is provided.The scorpion venom antiviral polypeptide AHIVP that is provided has the function that suppresses virus infection, suppresses effective, has no side effect.
To achieve these goals, adopt the method for chemosynthesis, obtained scorpion venom antiviral polypeptide AHIVP and structure homeopeptide thereof, antivirus test is the result show, antiviral polypeptide AHIVP and structure homeopeptide thereof have the obvious suppression effect to HIV.When the concentration of AHIVP and structure homeopeptide thereof reached 10 μ g/mL, AHIVP and structure homeopeptide thereof just can 100% inhibition to the inhibiting rate of HIV.
The invention provides the anti-HIV polypeptide of a kind of Tibet globefish scorpion.
At first make up globefish scorpion venom glandular tissue cDNA library, high quality Tibet; The separation and the mRNA purifying that specifically comprise the total RNA of scorpion venom gland; First chain of cDNA and second chain are synthetic, and double-stranded cDNA is connected and conversion with pSPORT1 carrier (available from American I nvitrogen), obtain scorpion venom glandular tissue cDNA library.On the basis that makes up the library, carry out the order-checking of scale library, a new Tibet globefish scorpion antibiotic peptide gene, called after AHIVP have been found in sequential analysis.A kind of isolated polypeptide gene, its sequence are the nucleotide sequence shown in the SEQ ID NO:1: aaagttccaatctgttgttccgatgcactctgaaacttaattaatgaaattttctc ttcagaccttcctttttaattacgttttaaaactagcaatttcacaatcagaagct ttcattcacaaaatttcacaccttctccacagaatttttggaaaaagaagtatgag agatatggatactatgaaatacttatcagaagctagtttgagtgcagctgacttga gaaccttacaaagactaatggaaaattactgattattataattgaatatctctata atgtttttagaaatatttttatacttttgaaaaaaaaaaa.70 amino-acid residues of the prosoma organization form coding of AHIVP are made up of three parts, i.e. signal peptide (23 residues), mature peptide (13 residues) and precursor peptide (34 residues).Based on the processing rule of scorpion toxin precursor C-terminal residue, the terminal last residue Phe of AHIVP is excised by specificity carboxypeptidase (Carboxypeptidase), and by amidated (Fig. 1).Therefore, the present invention provides Tibet globefish scorpion scorpion venom antibacterial peptide a: FIHKISHLLHRIF (SEQ ID NO:2).
Another purpose of the present invention is the homologous structure polypeptide that discloses one group of Tibet globefish scorpion AHIVP polypeptide.
Its sequence is the aminoacid sequence shown in SEQ ID NO:3～22.Mature peptide sequence (FIHKISHLLHRIF) according to AHIVP; Use online NPSserver [DSC method (Discrimination of protein Secondary structure Class)] that it is carried out secondary structure prediction, and utilize software AHTHEPROT2000 to show its secondary structure image.The result shows that AHIVP contains α-Helix structure of 100%, has typically amphipathic (amphiphilic) α-Helix structure, contains the alkaline residue (His, Arg and Lys) of the clean positive charge of a large amount of bands.According to the spiral image; Then AHIVP peptide sequence FIHKISHLLHRIF is carried out a large amount of point mutation or disappearance (table 1); Find that FIX1X2IX3X4LLX5X6IF (X1, X2, X4, X5, X6 are any basic aminoacids, and X3 is an arbitrary amino acid) sequence does not influence its amphiphatic characteristic.Therefore, the invention provides the homologous structure polypeptide (SEQ ID NO:3～22) of one group of Tibet globefish scorpion AHIVP polypeptide.
AHIVP polypeptide provided by the invention and structure homeopeptide thereof be anti human immune deficiency virus efficiently.
Through solid state chemistry synthetic way, obtained purity and reached synthetic polypeptide A HIVP (Fig. 2 and Fig. 3) and structure homeopeptide thereof more than 98%.Antiviral result shows the efficient restraining effect that synthetic polypeptide A HIVP and structure homeopeptide thereof are bred HIV, and when 10 μ g/mL, AHIVP and structure homeopeptide thereof can reach 100% inhibition (table 2, Fig. 4, Fig. 5) to the inhibiting rate of HIV.
Table 1: Tibet plucked string instrument with a fretted fingerboard scorpion anti HIV-1 virus polypeptide A HIVP and structure homeopeptide thereof
Table 2: the IC of Tibet plucked string instrument with a fretted fingerboard scorpion polypeptide A HIVP and the anti-HIV of structure homeopeptide thereof
50
AHIVP polypeptide that the present invention relates to and structure homeopeptide thereof, amino acid number is little, and production cost is low, good water solubility.AHIVP polypeptide and structure homeopeptide thereof have good inhibition effect for HIV, and are free from side effects.Can be through the medicine of AHIVP polypeptide and structure homeopeptide preparation prevention and treatment HIV infection.Compare with existing antiviral, AHIVP polypeptide and structure homeopeptide thereof have more directly and effective function.
Description of drawings
Fig. 1 Tibet globefish scorpion anti-HIV polypeptide A HIVP gene and amino acid thereof.The corresponding amino sequence of cDNA sequence below for inferring; Signal peptide amino acid is with single underscore mark; Mature peptide amino acid is with the black matrix mark; The square frame partial amino-acid is the carboxypeptidase recognition site; Dash area amino acid is C end precursor peptide.
The HPLC purity figure of the anti-HIV polypeptide A of Fig. 2 Tibet globefish scorpion HIVP.
The anti-HIV polypeptide A of Fig. 3 Tibet globefish scorpion HIVP mass spectrum is identified the molecule spirogram.
The anti-HIV polypeptide A of Fig. 4 Tibet globefish scorpion HIVP is to the retarding effect of HIV virus.
1. polypeptide was handled the TZM-b1 cell after 1 hour, virus infection TZM-b1 cell; 2. virus infection TZM-b1 cell is after 1 hour, and polypeptide is handled the TZM-b1 cell; 3. polypeptide and virus infect the TZM-b1 cell together; 4. after polypeptide and virus are mixed together 1 hour, infect the TZM-b1 cell then.
X-coordinate is a polypeptide different treatment TZM-b1 groups of cells, and ordinate zou is the fluorescent value that polypeptide is handled back TZM-b1 cell.* (p＜0.05), * * (p＜0.01) and * * * (p＜0.001).
The broad spectrum of Fig. 5 Tibet globefish scorpion polypeptide A HIVP anti HIV-1 virus (13 strain Type B HIV-1 virus).
Embodiment
Following embodiment can make those skilled in the art more fully understand the present invention, but does not limit the present invention in any way.
Embodiment 1: the preparation of a kind of Tibet globefish scorpion anti human immune deficiency virus polypeptide.Step is following:
A: the extraction of the total RNA of scorpion venom gland (Trizol LS single stage method: Trizol LS is available from beautiful Invitrogen)
1. get that globefish scorpion tail gland is ground into fine powder in the Tibet spy of 500mg in liquid nitrogen, add 10ml TRIZOLreagent mixing, room temperature (20-25 ℃, below identical) was placed 5 minutes; 2. add the 2ml chloroform then and mixed 15 seconds, room temperature was placed 2-3 minute, centrifugal 15 minutes of 4 ℃ of following 12000g; 3. the 1 times of volume Virahol of addition of fetching water, room temperature was placed 10 minutes, centrifugal 10 minutes of 4 ℃ of following 12000g the RNA deposition; 4. deposition is used 5ml75% washing with alcohol, centrifugal 5 minutes of 7500g; 5. be dissolved in DEPC-treated water after the RNA deposition drying, 55-60 ℃ is incubated 10 minutes with thorough dissolving RNA.Whole process is carried out with reference to TRlZOL (Total RNAIsolation) Reagent Kit recommend method.The total RNA of the scorpion venom gland of preparation adopts its quality of denaturing formaldehyde detected through gel electrophoresis.Obtained the total RNA of high-quality scorpion venom gland.
The separation and purification of B:mRNA
Adopt PolyA Tract mRNA separation system (Promega; USA) separation and purified mRNA; Its principle of work is based on Oligo (dT) and the complementary pairing characteristic that mRNA 3 ' holds poly (A) tail, with biotin labeling Oligo (dT), holds the annealing of poly (A) to form crossbred through it and mRNA 3 '; Catch and wash vitamin H Oligo (dT)/mRNA crossbred with indicating affinity plain magnetic bead and magnetic separation rack then, use the ddH of no RNA enzyme at last
2O elutes it, reaches the purpose of separating mRNA from total RNA.1. the preparation of sample: RNA is joined among the GTC of the 800 μ l that contain 32 μ l beta-mercaptoethanols.2. the annealing of probe: get 250pM concentration Oligo (dT) 5 μ l, adding distil water to 50 μ l; The dilution buffer (dilution buffer has added 32 μ l beta-mercaptoethanols) that adds the 1.6ml preheating, with the RNA mixing, 70 ℃ of incubations 5 minutes.3. the activation of magnetic bead: the magnetic bead SA-PMPS (available from beautiful Promega) that gets 1.2ml is in the centrifuge tube of 1.5ml; With the resuspended SA-PMPS of 0.5 * SSC, with magnet stand absorption magnetic bead, original volume 0.5 * SSC washing SA-PMPS3 time.4. obtaining of mRNA: the RNA of 70 ℃ of incubations is mixed with SA-PMPS, and room temperature is placed to put in 5 minutes and is adsorbed magnetic bead on the magnet stand, abandons supernatant; The 0.5XSSC suspension magnetic bead of 2ml, SSC is removed in washing repetition 2 times for the last time as far as possible; The ddH that adds no RNA enzyme
2O to magnetic bead, mixing gently, centrifugal then (12000g * 3 minute) or magnet stand absorption magnetic bead; Get supernatant, obtain mRNA.Concentration and purity through electrophoresis and ultraviolet determination mRNA.5. the deposition of mRNA: add the absolute ethyl alcohol of glycogen and 2.5 times of volumes among the mRNA that will 4. obtain, deposition is spent the night, and mRNA will be used for the synthetic of cDNA.
C: the first chain cDNA is synthetic
1. in 1.5ml Ep pipe, add 2 μ l Not I Primer-adapter and 6 μ l mRNA (containing 3 μ gmRNA), 70 ℃ of incubation 10min are put in rapidly on ice, centrifugal after, add following ingredients: 4 μ l 5X first strand buffer; 2 μ l 0.1M DTT; 1 μ l 10mM dNTPs; 1 μ l H
2O.Centrifugal behind the mixing gently, put to 2min for 37 ℃; 2. add 5 μ l reversed transcriptive enzymes, get 2 μ l behind the mixing, add 1 μ l [α-
32P] dCTP (4 μ Ci) (spike pipe).With above-mentioned reactive component (sample hose) while 37 ℃ of incubation 1h, put into termination reaction on ice then; 3. for the spike pipe, add 43 μ l 20mM EDTA and 5 μ l yeast tRNA successively, behind the mixing; Get respectively two part 10 μ l o'clock on two filter membranes, wash 3 times each 5min for 1 part with 10%TCA; 98% ethanol is washed 1 time, and after the dry air, putting into the 1.5ml scintillation solution (is 1
#Sample); After other 1 part of dry air, putting into the 1.5ml scintillation solution (is 2
#Sample).30 μ l traced fluids add 1.5 μ l 7.5M Ammonium Acetate (NH in addition
4Oac) and 90 μ l absolute ethyl alcohols (20 ℃), behind the mixing immediately 14, the centrifugal 20min of 000rpm; Abandon supernatant, add 0.5ml70% absolute ethyl alcohol (20 ℃), 14; The centrifugal 2min of 000rpm abandons supernatant, and 37 ℃ of dry 10min let ethanol volatilize; Be dissolved in 10 μ l TEN solution, add 10 μ l 2X sample loading buffers, get 10 μ l and be used for alkaline gel electrophoresis.With [α-
32P] dCTP mark λ DNA HindIII fragment makes molecular weight marker; 4. room temperature held 15min behind the mixing adds 2 μ l 0.2M EDTA termination reactions.Get 6 μ l reaction solutions and 6ml 2X alkalescence electrophoretic buffer mixing, behind the electrophoresis 5h, soak 20min, until the bromjophenol blue flavescence with 7%TCA.Blot (about 8h) with toilet paper then, carry out radioautograph; 5. for sample hose, be used for the synthetic of second chain.
D: the second chain cDNA is synthetic
1. in sample hose, add following ingredients on ice successively; 2. gently behind the mixing, 16 ℃ of incubation 2h; 3. add 2 μ l (10units) T4DNA polysaccharases, continue 16 ℃ of reaction 5min; 4. change on ice, add 10 μ l0.5M EDTA; 5. add equal-volume (150 μ l) phenol/chloroform/primary isoamyl alcohol (25/24/1), thoroughly behind the vortex, under the room temperature 14, the centrifugal 5min of 000rpm.Change water (140 μ l) over to another 1.5ml Ep pipe; 6. the 7.5M NH that adds 70 μ l
4OAc and 0.5ML absolute ethyl alcohol (20 ℃), behind the vortex, under the room temperature 14, the centrifugal 20min of 000rpm; 7. abandon supernatant, add 0.5ml 70% ethanol (20 ℃), the same centrifugal 2min.Abandon supernatant, 37 ℃ of dry 10min.
E: double-stranded cDNA is connected with Sal I adapter
1. dissolve the cDNA sample of real D with 25 μ l aqua sterilisas, according to the form below adds successively then; 2. mixing gently, 16 ℃ of reactions spend the night (about 20h).3. use (25/24/1) extracting of phenol/chloroform/primary isoamyl alcohol and NH
4Behind the Oac/ ethanol sedimentation, 37 ℃ of dry 10min.
F:NotI digests double-stranded cDNA
1. the sample with E is dissolved in 41 μ l, and according to the form below adds successively then; 2. behind the mixing, 37 ℃ of incubation 2h; 3. use phenol/chloroform/primary isoamyl alcohol (25/24/1) extracting once, use 7.5M NH then
4The Oac/ ethanol sedimentation, 37 ℃ of dry 10min.4. be dissolved in 70 μ l TEN, get 1 μ l and be used for quantitatively, all the other-20 ℃ of preservations are subsequent use.
G: excessive Sal I adapter and the enzyme removed in the double-stranded cDNA molecule are cut small segment
(Amersham USA) removes excessive Sal I adapter and enzyme and cuts small segment with nucleon extraction and purification kit.1. room temperature low suspension resin is got 600 μ l then and is added in the centrifugal post, and the centrifugal 10s of 2000rpm removes liquid.Central authorities add the above-mentioned cDNA solution of 40 μ l at resin.The same centrifugal; 2. collect elutriant and be used for ligation.
H: double-stranded cDNA is connected and conversion with the pSPORT1 carrier
1. in 1.5ml Ep pipe, add following ingredients successively; 2. react 16h under the room temperature; 3. in 2. reaction solution, add following ingredients successively: 5.0 μ l yeast tRNA, 12.5 μ l 7.5M NH4Oac, 70 μ l absolute ethyl alcohols (20 ℃).14000 centrifugal 20min immediately behind the vortex mixing; 4. deposition is dissolved in 4 μ l with 70% ethanol (20 ℃) washing after 37 ℃ of dryings; 5. get 2 μ l electric shock and transform 50 μ l E.coli K12MC1061.Identify the quality in library, forward primer: 5 ' TCGACCCACGCGTCCG 3 ' (pressing SalI adapter sequences Design) with PCR method; Reverse primer: 5 ' GAGCGGCCGCCCT15 3 ' (pressing the sequences Design of NotI primer-adapter).
I: random sequencing Policy Filtering cDNA library
Selected clone from the globefish scorpion venom gland cDNA library, Tibet that builds is served sea three rich company size order-checkings.Sequence typing software is BioEdit v4.5.8 (Tom Hall; 1999); Homology comparison and signal peptide cutting site forecasting software be respectively CLUSTAL X 1.8 (Thompson et al., 1997) and PC/GENE (Intelligenetics Inc., Switzerland).A brand-new antiviral polypeptide gene, called after AHIVP have been found in sequential analysis.Having the sequence SEQ? ID? NO: 1 shows the nucleotide sequence: aaagttccaatctgttgttccgatgcactctgaaacttaattaatgaaattttctcttcagaccttcctttttaattacgttttaaaactagcaatttcacaatcagaagctttcattcacaaaatttcacaccttctccacagaatttttggaaaaagaagtatgagagatatggatactatgaaatacttatcagaagctagtttgagtgcagctgacttgagaaccttacaaagactaatggaaaattactgattattataattgaatatctctataatgtttttagaaatatttttatacttttgaaaaaaaaaaa (Figure 1).70 amino-acid residues of the prosoma organization form coding of AHIVP are made up of three parts, i.e. signal peptide (23 residues), mature peptide (13 residues) and precursor peptide (34 residues).Based on the processing rule of scorpion toxin precursor C-terminal residue, the terminal last residue Phe of AHIVP is excised by specificity carboxypeptidase (Carboxypeptidase).The aminoacid sequence of antiviral polypeptide AHIVP is: FIHKISHLLHRIF (SEQ ID NO:2).
The structural analysis of embodiment 2:AHIVP polypeptide and homologous structure polypeptide thereof
Mature peptide sequence (FIHKISHLLHRIF) according to AHIVP; Use online NPSserver [DSC method (Discrimination of protein Secondary structure Class)] that it is carried out secondary structure prediction, and utilize software AHTHEPROT 2000 to show its secondary structure image.The result shows that AHIVP contains α-Helix structure of 100%, has typically amphipathic (amphiphilic) α-Helix structure, contains the alkaline residue (His, Arg and Lys) of the clean positive charge of a large amount of bands.According to the spiral image; Then AHIVP peptide sequence FIHKISHLLHRIF is carried out a large amount of point mutation or disappearance (table 1); Find that FIX1X2IX3X4LLX5X6IF (X1, X2, X4, X5, X6 are any basic aminoacids, and X3 is an arbitrary amino acid) (SEQ ID NO:3) sequence does not influence its amphiphatic characteristic.
Embodiment 3: chemosynthesis AHIVP polypeptide and homologous structure polypeptide thereof
Carry out synthetic according to AHIVP and homologous structure amino acid sequence of polypeptide (FIHKISHLLHRIF and FIX1X2IX3X4LLX5X6IF) thereof.Solid state chemistry synthetic way has obtained highly purified AHIVP polypeptide (Fig. 2 and Fig. 3) and homologous structure polypeptide (table 1) thereof.
The cytotoxicity of embodiment 4:AHIVP polypeptide and homologous structure polypeptide thereof and hemolytic detect
1) mtt assay detects the cytotoxicity of AHIVP polypeptide and homologous structure polypeptide thereof: 1. Vero cell and TZM-b1 cell dissociation are counted, and are seeded to 96 orifice plates by the 7000-10000/ hole, and 37 ℃, 5%CO
2Cultivate 24h.AHIVP polypeptide or its homologous structure polypeptide are carried out gradient dilution, join in the cell culture medium, make it final concentration and be respectively 25,50,75,100,150,200,250,500 μ g/ml, each concentration is established 3-5 multiple hole, 37 ℃, 5%CO
2Cultivate 48h; 2. take out culture plate, every hole adds the MTT solution 20 μ l of 5mg/ml (PBS preparation, i.e. 0.5%MTT), jog mixing, 37 ℃, 5%CO
2Hatch 4h; 3. inhale and go substratum, every hole to add 100 μ l DMSO, room temperature jolts 20min, makes the dissolving fully of Viola crystallina deposition; Under the 570nm wavelength, detect each hole light absorption value with ELIASA, calculate cell survival rate.Zeroing hole (substratum, MTT, DMSO 99.8MIN.) is set simultaneously, control wells (the medicine dissolution medium of cell, same concentrations, nutrient solution, MTT, DMSO 99.8MIN.).The result is as showing the Cytotoxic CC of AHIVP and the amphiphilic polypeptide of homologous structure thereof
50All greater than 250 μ g/ml.
2) hemolytic detects: the healthy subjects anticoagulation is provided by Hospital of Wuhan University.Centrifugal collection hemocyte is washed 2-3 time with 1 * Hepes (pH7.2), 1200g, and 10min is centrifugal, and hemocyte is with the resuspended counting of saline water, with 10
7-10
8/ hole adds to 96 orifice plates; AHIVP polypeptide or its homologous structure polypeptide are carried out gradient dilution, join in the cell culture medium, make it final concentration and be respectively 25,50,75; 100,150,200,250; 500 μ g/ml, as feminine gender and positive control, each concentration is established 3-5 multiple hole, hatches 30-60min for 37 ℃ with saline water and Triton X-100; 1000g, 5min centrifuging and taking supernatant 100 μ l detect light absorption value with ELIASA under the 570nm wavelength, calculate hemolysis rate.The result is as showing that the hemolytic HC50 of AHIVP and homologous structure polypeptide thereof is all greater than 500 μ g/ml.
Embodiment 5: Tibet globefish scorpion active A HIVP polypeptide and homologous structure polypeptide thereof are to the retarding effect of HIV
1) Vero cell, the HeLa (cultivation of cell of CD4-LTR/ β-Gal) and TZM-b1 cell.(CD4-LTR/ β-Gal), TZM-b1 cell are available from China typical culture collection center for Vero cell, HeLa.Cell culture medium is: and 10% (substratum goes down to posterity) or 2% (keeping substratum) calf serum (FCS, GIBCO-BRL), 56 ℃, 30 minutes heat sterilizations; 2mM/mL D-glutamicacid salt; 100U/mL penicillium mould and 100 μ g/mL Streptomycin sulphates.Culture condition is: 37 ℃, the 5%CO2 incubator is cultivated.
2) virus strain and duplicating.The HIV strain that this research is used derives from Wuhan virus institute (6535, QH0692, SC422661, PVO, TRO, AC10, PHPA4259 etc.) of the Chinese Academy of Sciences.Concrete operation method: cell cultures to degree of converging 70-80%, the sucking-off substratum adds HIV virus or defective HIV viral dilution liquid, and 37 ℃ of about 2h of absorption replenish 2%FBS-MEM substratum to normal cultured volume, put 37 ℃, 5%CO
2Cultivate.Behind about 48-72h, treat that the 80-90% pathology appears in cell monolayer, multigelation 3-5 time, collecting cell and supernatant are to centrifuge tube, and 4 ℃ of centrifugal 10min of 3000-4000rpm remove cell debris, the supernatant packing, and-80 ℃ of preservations are subsequent use.
Measure AHIVP polypeptide and homologous structure polypeptide thereof retarding effect to HIV.The AHIVP polypeptide of 50 μ L and homologous structure polypeptide thereof mix with the virus that 50 μ L collect respectively with the series concentration of 0.6,1.2,2.5,5.0,10,20 μ g/mL, and the two all makes solvent with keeping substratum; Negative control is that 50 μ L keep substratum and 50 μ L virus and mix, and the negative control polypeptide is mucroporin-S1.Mixing the back hatched 1 hour in 37 ℃.10 times of proportional diluted of virus after hatching.The virus of handling in second step adds the cell of monolayer adherence, every hole 50 μ L.The AHIVP polypeptide of each concentration and homologous structure polypeptide thereof are provided with 3 repeating holes.Virus was 37 ℃ of adherent cells 2 hours.1000g is centrifugal 10 minutes then, removes supernatant.Again add 100 μ L fresh keep substratum, at 37 ℃, 5%CO
2Incubator was cultivated 48 hours.After 48 hours, observe the titre (TCID of virus in 96 orifice plates
50Perhaps fluorescence intensity).(CD4-LTR/ β-Gal) cell can present blueness, can calculate the titre and the inhibiting rate of virus according to the number of blue cell to receive the HeLa of HIV virus infection.Receive HIV virus infection TZM-b1 cell and fluorescence can occur, fluorescence intensity has been reacted the titre of HIV virus.Suppress experimental result and show that Tibet globefish scorpion AHIVP polypeptide and homologous structure polypeptide thereof have significant retarding effect to the human immunodeficiency virus, and HIV virus is had broad spectrum (table 2, Fig. 4, Fig. 5).
SEQUENCE?LISTING
< 110>Wuhan University
< 120>a kind of Tibet globefish scorpion anti human immune deficiency virus polypeptide
< 130>a kind of Tibet globefish scorpion anti human immune deficiency virus polypeptide
<160> 22
<170> PatentIn?version?3.3
<210> 1
<211> 320
<212> DNA
< 213>Tibet globefish scorpion
<400> 1
aaagttccaa?tctgttgttc?cgatgcactc?tgaaacttaa?ttaatgaaat?tttctcttca 60
gaccttcctt?tttaattacg?ttttaaaact?agcaatttca?caatcagaag?ctttcattca 120
caaaatttca?caccttctcc?acagaatttt?tggaaaaaga?agtatgagag?atatggatac 180
tatgaaatac?ttatcagaag?ctagtttgag?tgcagctgac?ttgagaacct?tacaaagact 240
aatggaaaat?tactgattat?tataattgaa?tatctctata?atgtttttag?aaatattttt 300
atacttttga?aaaaaaaaaa 320
<210> 2
<211> 13
<212> PRT
< 213>Tibet globefish scorpion
<400> 2
Phe?Ile?His?Lys?Ile?Ser?His?Leu?Leu?His?Arg?Ile?Phe
1 5 10
<210> 3
<211> 13
<212> PRT
< 213>artificial sequence
<400> 3
Phe?Ile?His?Lys?Ile?Ser?Arg?Leu?Leu?Lys?Arg?Ile?Phe
1 5 10
<210> 4
<211> 13
<212> PRT
< 213>artificial sequence
<400> 4
Phe?Ile?His?Lys?Ile?Ala?Arg?Leu?Leu?His?Arg?Ile?Phe
1 5 10
<210> 5
<211> 13
<212> PRT
< 213>artificial sequence
<400> 5
Phe?Ile?Arg?Lys?Ile?His?Arg?Leu?Leu?Lys?Arg?Ile?Phe
1 5 10
<210> 6
<211> 13
<212> PRT
< 213>artificial sequence
<400> 6
Phe?Ile?Arg?Lys?Ile?Ile?Arg?Leu?Leu?Lys?Arg?Ile?Phe
1 5 10
<210> 7
<211> 13
<212> PRT
< 213>artificial sequence
<400> 7
Phe?Ile?Arg?Arg?Ile?Ala?Arg?Leu?Leu?Lys?Arg?Ile?Phe
1 5 10
<210> 8
<211> 13
<212> PRT
< 213>artificial sequence
<400> 8
Phe?Ile?Arg?Arg?Ile?Arg?Arg?Leu?Leu?Lys?Arg?Ile?Phe
1 5 10
<210> 9
<211> 13
<212> PRT
< 213>artificial sequence
<400> 9
Phe?Ile?Arg?Lys?Ile?Ala?Lys?Leu?Leu?Lys?Arg?Ile?Phe
1 5 10
<210> 10
<211> 13
<212> PRT
< 213>artificial sequence
<400> 10
Phe?Ile?Arg?Lys?Ile?Ala?His?Leu?Leu?Lys?Arg?Ile?Phe
1 5 10
<210> 11
<211> 13
<212> PRT
< 213>artificial sequence
<400> 11
Phe?Ile?Arg?Lys?Ile?Asp?Arg?Leu?Leu?His?Arg?Ile?Phe
1 5 10
<210> 12
<211> 13
<212> PRT
< 213>artificial sequence
<400> 12
Phe?Ile?Arg?Lys?Ile?Asp?Arg?Leu?Leu?Lys?Arg?Ile?Phe
1 5 10
<210> 13
<211> 13
<212> PRT
< 213>artificial sequence
<400> 13
Phe?Ile?Arg?Lys?Ile?Leu?Arg?Leu?Leu?Arg?Arg?Ile?Phe
1 5 10
<210> 14
<211> 13
<212> PRT
< 213>artificial sequence
<400> 14
Phe?Ile?Arg?Lys?Ile?Ser?His?Leu?Leu?Arg?Arg?Ile?Phe
1 5 10
<210> 15
<211> 13
<212> PRT
< 213>artificial sequence
<400> 15
Phe?Ile?Arg?Arg?Ile?Ser?His?Leu?Leu?Lys?Lys?Ile?Phe
1 5 10
<210> 16
<211> 13
<212> PRT
< 213>artificial sequence
<400> 16
Phe?Ile?Arg?Lys?Ile?Ala?Arg?Leu?Leu?Lys?Arg?Ile?Phe
1 5 10
<210> 17
<211> 12
<212> PRT
< 213>artificial sequence
<400> 17
Phe?Ile?His?Lys?Ile?His?Leu?Leu?His?Arg?Ile?Phe
1 5 10
<210> 18
<211> 12
<212> PRT
< 213>artificial sequence
<400> 18
Phe?Ile?His?Lys?Ile?Ser?His?Leu?His?Arg?Ile?Phe
1 5 10
<210> 19
<211> 12
<212> PRT
< 213>artificial sequence
<400> 19
Phe?Ile?His?Lys?Ile?Ser?His?Leu?Leu?His?Arg?Phe
1 5 10
<210> 20
<211> 12
<212> PRT
< 213>artificial sequence
<400> 20
Phe?His?Lys?Ile?Ser?His?Leu?Leu?His?Arg?Ile?Phe
1 5 10
<210> 21
<211> 11
<212> PRT
< 213>artificial sequence
<400> 21
Phe?Ile?His?Lys?Ile?His?Leu?His?Arg?Ile?Phe
1 5 10
<210> 22
<211> 11
<212> PRT
< 213>artificial sequence
<400> 22
Phe?His?Lys?Ile?His?Leu?Leu?His?Arg?Ile?Phe
1 5 10
Claims (7)
1. isolating Tibet globefish scorpion antiviral polypeptide AHIVP, its aminoacid sequence is shown in the SEQ ID NO:2.
2. the gene of coding claim 1 said polypeptide, its nucleotides sequence is classified as shown in the SEQ ID NO:1.
3. one group of structure homeopeptide that is masterplate with the said polypeptide A HIVP of claim 1, its aminoacid sequence is shown in SEQ ID NO:3 ~ 22.
One or more amino-acid residues of the said polypeptide of claim 3 methylated, glycosylation, phosphorylation or the resulting aminoacid sequence of acetylation modification.
5. one or more amino-acid residues of the said polypeptide of claim 3 are lacked or are replaced resulting aminoacid sequence.
6. described AHIVP polypeptide of claim 1 and the described structure homeopeptide of claim 3 application on the medicine of preparation prevention or treatment HIV infection.
7. the medicine of prevention or treatment HIV infection wherein contains described AHIVP polypeptide of claim 1 or the described structure homeopeptide of claim 3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110457978 CN102516365B (en) | 2011-12-31 | 2011-12-31 | Anti-HIV (human immunodeficiency virus) polypeptide of Tibetan dolphin scorpion |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110457978 CN102516365B (en) | 2011-12-31 | 2011-12-31 | Anti-HIV (human immunodeficiency virus) polypeptide of Tibetan dolphin scorpion |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102516365A true CN102516365A (en) | 2012-06-27 |
| CN102516365B CN102516365B (en) | 2013-06-19 |
Family
ID=46287480
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110457978 Expired - Fee Related CN102516365B (en) | 2011-12-31 | 2011-12-31 | Anti-HIV (human immunodeficiency virus) polypeptide of Tibetan dolphin scorpion |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102516365B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103360464A (en) * | 2013-07-17 | 2013-10-23 | 武汉摩尔生物科技有限公司 | Polypeptide, DNA molecule encoding polypeptide, vector, preparation method and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101284870A (en) * | 2008-06-03 | 2008-10-15 | 武汉大学 | Polypeptides of anti-measles virus and human immunodeficiency virus and use |
| CN101284869A (en) * | 2008-06-03 | 2008-10-15 | 武汉大学 | Antiviral polypeptides and use |
-
2011
- 2011-12-31 CN CN 201110457978 patent/CN102516365B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101284870A (en) * | 2008-06-03 | 2008-10-15 | 武汉大学 | Polypeptides of anti-measles virus and human immunodeficiency virus and use |
| CN101284869A (en) * | 2008-06-03 | 2008-10-15 | 武汉大学 | Antiviral polypeptides and use |
Non-Patent Citations (2)
| Title |
|---|
| ELGAR D ET AL.: "Cysteine-free peptides in scorpion venom: geographicaldistribution, structure-function relationship and mode of action", 《AFRICAN JOURNAL OF BIOTECHNOLOGY》, vol. 5, no. 25, 31 December 2006 (2006-12-31), pages 2495 - 2502 * |
| MOERMAN L ET AL.: "Antibacterial and antifungal properties of alpha-helical,cationic peptides in the venom of scorpions from southern Africa", 《EUROPEAN JOURNAL OF BIOCHEMISTRY》, vol. 269, no. 19, 31 October 2002 (2002-10-31), pages 4799 - 4810 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103360464A (en) * | 2013-07-17 | 2013-10-23 | 武汉摩尔生物科技有限公司 | Polypeptide, DNA molecule encoding polypeptide, vector, preparation method and application thereof |
| US10654895B2 (en) | 2013-07-17 | 2020-05-19 | Wuhan More Biotechnology Co., Ltd. | Polypeptide, DNA molecule encoding the polypeptide, vector, preparation method and use |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102516365B (en) | 2013-06-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Shan et al. | Non-mammalian Toll-like receptor 18 (Tlr18) recognizes bacterial pathogens in common carp (Cyprinus carpio L.): indications for a role of participation in the NF-κB signaling pathway | |
| Falco et al. | Expression and antiviral activity of a β-defensin-like peptide identified in the rainbow trout (Oncorhynchus mykiss) EST sequences | |
| Wang et al. | Tissue expressions of nine genes important to immune defence of the Pacific white shrimp Litopenaeus vannamei | |
| Ding et al. | Identification of two subgroups of type I IFNs in perciforme fish large yellow croaker Larimichthys crocea provides novel insights into function and regulation of fish type I IFNs | |
| Langevin et al. | Fish antiviral tripartite motif (TRIM) proteins | |
| Hultcrantz et al. | Interferons induce an antiviral state in human pancreatic islet cells | |
| Sullivan et al. | Modeling virus-induced inflammation in zebrafish: A balance between infection control and excessive inflammation | |
| Zhuang et al. | Three new piscidins from orange-spotted grouper (Epinephelus coioides): Phylogeny, expression and functional characterization | |
| Swain et al. | Molecular characterization, inductive expression and mechanism of interleukin‐10 gene induction in the Indian major carp, catla (Catla catla) | |
| Ai et al. | Expression pattern analysis of IRF4 and its related genes revealed the functional differentiation of IRF4 paralogues in teleost | |
| CN101450966B (en) | Polypeptide of antimicrobial agent and use | |
| Huang et al. | Identification of four type I IFNs from Japanese eel with differential expression properties and Mx promoter inducibility | |
| Shen et al. | Molecular characterization and expression analyses of two homologues of interferon-stimulated gene ISG15 in Larimichthys crocea (Family: Sciaenidae) | |
| Charoensapsri et al. | Laminin receptor protein is implicated in hemocyte homeostasis for the whiteleg shrimp Penaeus (Litopenaeus) vannamei | |
| CN113754750B (en) | Antibacterial peptide and application thereof in aquaculture | |
| CN102516365B (en) | Anti-HIV (human immunodeficiency virus) polypeptide of Tibetan dolphin scorpion | |
| Berthet et al. | Complete genome characterization of the Arumowot virus (unclassified Phlebovirus) isolated from Turdus libonyanus birds in the Central African Republic | |
| CN101284869B (en) | Antiviral polypeptides and use | |
| CN101284870B (en) | Polypeptides of anti-measles virus and human immunodeficiency virus and use | |
| CN102250217A (en) | Hyla simplex skin injury repair promotion polypeptides and genes as well as application thereof | |
| CN113786480B (en) | Application of African swine fever virus A137R and K205R genes | |
| Weerachatyanukul et al. | Infectious hypodermal and hematopoietic necrosis virus-like particle (IHHNV-VLP) induces peroxiredoxin expression and activity in Fenneropenaeus merguiensis | |
| CN110295173B (en) | Isolated carp antiviral protein Rhbdd3 and antiviral activity thereof | |
| Abd El Hamid et al. | Anti-HIV/HCV activity of cyanobacterial phycobiliproteins by a new standardized method using bacteriophage surrogates | |
| CN102382839A (en) | Anti-herpes simplex virus (HSV) active polypeptide of Tibetan Pi scorpion and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130619 Termination date: 20211231 |