CN102492722B - Mammary gland-specific expression buffalo prolactin (PRL) gene vector, construction method and application thereof - Google Patents

Mammary gland-specific expression buffalo prolactin (PRL) gene vector, construction method and application thereof Download PDF

Info

Publication number
CN102492722B
CN102492722B CN201110400876.1A CN201110400876A CN102492722B CN 102492722 B CN102492722 B CN 102492722B CN 201110400876 A CN201110400876 A CN 201110400876A CN 102492722 B CN102492722 B CN 102492722B
Authority
CN
China
Prior art keywords
prl
buffalo
carrier
pmd18t
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201110400876.1A
Other languages
Chinese (zh)
Other versions
CN102492722A (en
Inventor
刘庆友
石德顺
任艳萍
李湘萍
陆凤花
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangxi University
Original Assignee
Guangxi University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Guangxi University filed Critical Guangxi University
Priority to CN201110400876.1A priority Critical patent/CN102492722B/en
Publication of CN102492722A publication Critical patent/CN102492722A/en
Application granted granted Critical
Publication of CN102492722B publication Critical patent/CN102492722B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a mammary gland-specific expression buffalo prolactin (PRL) gene vector, a construction method and application thereof. A buffalo PRL gene is promoted by a beta-casein promoter; the mammary gland-specific expression buffalo PRL gene vector is constructed and is transferred into an animal genome to obtain a transgenic animal with mammary gland-specific expression buffalo PRL protein; the buffalo PRL protein is specifically expressed in milk of the transgenic animal; and the expression of the buffalo PRL gene can remarkably improve the expression levels of beta-casein and beta-1,4-galactosyltransferase in mammary glands. Therefore, by the vector, a large amount of cheap PRL protein is expected to be obtained by the preparation of trans-PRL buffaloes, and the milk yield of the buffaloes and the casein level in milk are improved so as to produce huge economic benefit and social benefit.

Description

Mammary specific expression buffalo PRL genophore, structure and application thereof
Technical field
The present invention relates to genetically engineered field, especially relate to a kind of mammary specific expression buffalo PRL genophore, structure and application thereof.
Background technology
Prolactin (prolactin, PRL) be a kind of single chain polypeptide parahormone of pituitary secretion, there is in animal body multiple important biological function, the biological function of having found is at present over 300 kinds, wherein to starting and to maintain lactation significant, the main regulating and controlling effect that synthesized to important milk-contents such as milk-protein, lactose and butterfat, thereby PRL gene is and one of closely-related gene of milk yield.The researchs such as Brym show, PRL-RsaI site has remarkably influenced to the milk yield of milk cow and milk fat content.In PRL genetic flaw mouse, the aplasia of homozygote female mice mammary gland, the demonstration of section result, its mammary gland alveolus does not obtain normal development.False pregnancy rabbit injection PRL, can cause mammary gland alveolus differentiation, and Gao Erjishi vesica expands, and occurs a large amount of Oil globule and protein micelle in alveolar lumen.Experiment in vitro shows, the effect that PRL has the undifferentiated mammary gland cell of promotion to divide.The growth of mammary gland alveolus cell needs the synergy of estradiol, progesterone and prolactin.As can be seen here, prolactin PRL gene pairs dairy cattle has important regulative.
At present, increasing to the relevant research of PRL, carrying out experiment needs a large amount of PRL albumen, and for example Elisa test kit needs standard substance; Produce in each antibody-like process, also need PRL albumen as antigen.For example, yet due to PRL great expression in pituitary tissue only, and hypophysis is that (the hypophysis size of being grown up is about 1x1.5x0.5cm to very little incretory gland 3, heavy only approximately 0.5~0.6 gram), the prolactin price of extracting purifying from hypophysis is extremely expensive, far can not meet the need of market.The PRL albumen being purified into by prokaryotic expression method, due to the exactness that cannot guarantee that its sequence space is folding, the albumen of production is difficult to guarantee to have physiologically active.PRL albumen on market mainly relies on expression of cell lines method to produce, but production cost is still expensive.Therefore, be badly in need of a kind of method that can obtain in a large number cheap RPL albumen of development.
In addition, China in 2004 per capita milk year only 18.4 kilograms of occupancy volumes, come in the world after hundred, not as good as world average level 1/5, Asia mean level (ML) 1/2.Thereby present stage is badly in need of a kind of method that improves milk produced by animals, to meet the demand of market to milk preparation.
Summary of the invention
The technical problem to be solved in the present invention is to provide a kind of mammary specific expression buffalo PRL genophore, structure and application thereof, utilize this mammary specific expression buffalo PRL genophore can produce transgenic animal, for the production of buffalo PRL albumen, also can improve the milk yield of transgenic animal, to meet the heavy demand of market to cheap RPL albumen and milk preparation.
For solving the problems of the technologies described above the present invention, adopt following technical scheme: mammary specific expression buffalo PRL genophore, this carrier is:
Carrier one pMD18T-BCN-PRL/His-BCNpolyA-cmv-EGFP-SV40polyA,
Or carrier two pMD18T-BCN-PRL/His-BCNpolyA-EF321-EGFP-IRES-NEO-SV40poly A.
The construction process of above-mentioned mammary specific expression buffalo PRL genophore, mainly comprises the following steps:
<1> extracts the total mRNA of buffalo hypophysis, after reverse transcription, adopt Auele Specific Primer to carry out the cDNA sequence that pcr amplification obtains total length buffalo PRL, after glue reclaims purified pcr product, its TA clone is inserted in pMD18T carrier, obtains pMD18T-PRL carrier;
It is template that <2> be take the carrier obtaining in step <1>, with the primer that is added with restriction enzyme site and His label, carry out pcr amplification, obtain the CDS fragment of buffalo PRL gene, and its TA is cloned in pMD18T carrier, obtain pMD18T-PRL/His carrier;
<3> be take pMD18T as carrier framework, enzyme is cut and is connected into KpnI-BCNpolyA-SacI, BamHI-PRL/His-KpnI, SalI-NotI-BCN-BamHI, SalI-cmv-EGFP-SV40polyA-NotI or tetra-fragments of SalI-EF321-EGFP-IRES-NEO-SV40polyA-NotI successively, obtains carrier one or carrier two.
Step <1> primer is: upstream primer 5 '-AGCCTAGGACGAGAGCTTC-3 ', downstream primer 5 '-GGGGTACCGATTTTGACATCGCTACAGAGT-3 ';
Step <2> primer is: upstream primer 5 '-CGGGATCCATGCACCATCATCATCATCATCTGGTGCCACGCGGTTCTACCCCCGTC TGTCCCAAT-3 ', downstream primer 5 '-GGGGTACCGATTTTGACATCGCTACAGAGT-3 '.
The application of above-mentioned mammary specific expression buffalo PRL genophore in producing transgenic animal.
Adopt procaryotic injection method, carrier one or carrier two are transferred in mouse or buffalo embryo, obtain transgenic mice or the buffalo of mammary specific expression buffalo PRL albumen.
SalI and PvuI enzyme are cut carrier one, reclaim fragment and be dissolved in TE solution, linearized vector plasmid is injected in the zygote protokaryon of mouse after dilution, then zygote transplation is entered to the uterine tube place of the female mouse of replace-conceive of estrus synchronization, treat the sub-mouse of output, through identifying, obtain transgenic mice.
The application of above-mentioned transgenic animal in producing buffalo PRL albumen.
The present invention utilizes beta-casein promotor to start buffalo PRL gene, built mammary specific expression buffalo PRL genophore, and adopt procaryotic injection method, mammary specific expression buffalo PRL genophore is proceeded in Animal genome, PRL gene is only expressed in mammary gland, set up the transgenic animal of mammary specific expression buffalo PRL albumen.By to turning the analyzing and testing of buffalo PRL DNA murine, determine and in mouse milk, express buffalo PRL albumen, and the expression of buffalo PRL gene can significantly improve the expression level of β casein in mammary gland and the sweet transferring enzyme of β-Isosorbide-5-Nitrae-semi-lactosi.The present invention had both guaranteed to express PRL gene in mammary gland, to increase the milk yield of transgenic animal, had avoided again the grievous injury of whole body expression PRL gene pairs transgenic animal; The PRL albumen of simultaneously expressing in mammary gland is discharged with milk, can in milk, obtain PRL albumen by purifying, because the PRL albumen of producing is with His label, can be later stage purification PRL albumen and facilitates, cost-saving.Therefore, application the present invention be expected by turning the preparation of PRL buffalo, obtain have a large amount of cheapnesss PRL albumen, and improve the milk yield of buffalo and the casein level in emulsion, produce huge economic benefit and social benefit.
Accompanying drawing explanation
Fig. 1 is mammary specific expression buffalo PRL genophore figure of the present invention, in figure: two cmv-EGFP-SV40polyA or EF321-EGFP-IRES-NEO-SV40polyA of being designated as, BCN is beta-casein promotor, and PRL is cow-prolactin CDS, and polyA is beta-casein 3 ' non-translational regions.
Fig. 2 is the structure route map of mammary specific expression buffalo PRL genophore of the present invention.
Fig. 3 is buffalo PRL gene C DS sequence pcr amplified fragment electrophorogram.
Fig. 4 is fluoroscopic examination figure after mammary specific expression buffalo PRL genophore one transient transfection Bcap37 clone 48h of the present invention, and in figure: A is ordinary light, B is fluorescence.
Fig. 5 is that after transient transfection Bcap37 clone, RT-PCR detects electrophorogram, in figure: 3.8kb and 5.2kb are respectively the plasmids by the BCN promotor structure of different lengths.
Fig. 6 is that F0 detects electrophorogram for turning PRL DNA murine tail point genomic dna PCR, in figure: 1 negative contrast, the 18 positive contrasts in road.
Fig. 7 turns the canonical plotting in PRL concentration Elisa detection in the female mouse milk of PRL gene.
Fig. 8 is the QRT-PCR detection figure of mammary specific expression PRL gene pairs lactation related gene expression level.
Embodiment
One, experiment material and method
Used carrier, clone and reagent source: pMD18T carrier (purchased from Takara company), pHC79-EF321-EGF P-IRES-NEO is provided by Chinese agricultural university, and pMD18T-BCNpolyA, pMD18T-BCN are prepared voluntarily for contriver.Primer synthesizes and sequencing is completed by Hua Da gene company limited, Taq enzyme, T4DNA ligase enzyme, restriction endonuclease, QPT-PCR related reagent is all purchased from Takara company, little upgrading grain and glue reclaim test kit purchased from TIANGEN company, go the little plasmid kit of carrying of endogenous toxic material purchased from OMEGA company, in cell transfecting and kytoplasm, injection foreign gene glue reclaims test kit purchased from QIAGEN company, the Bcap37 cell of cell transfecting effect is that applicant preserves, somatic cell clone agents useful for same is all from Sigma company, Western Blot antibody used is from Kang Wei company, ox PRL Elisa detection kit is purchased from Cusabio company.
The experimental implementation steps such as genome extraction used, total RNA extraction, total protein extraction, pcr amplification, reverse transcription, enzyme are cut, glue recovery, connection, conversion, plasmid extraction, liposome transfection method, microinjection, semen transformation, Western Blot, Southe rnBlot, Elisa, QRT-PCR refer to < < molecular cloning (third edition) > > (2000, Science Press) or corresponding test kit specification sheets.The production of transgenic mice is by Guangzhou match industry corporate agent.
Two, the structure of mammary specific expression buffalo PRL genophore
As depicted in figs. 1 and 2, according to the mRNA sequence (NM_173953.2) of the upper ox PRL announcing of NCBI, design synthetic Auele Specific Primer, upstream primer 5 '-AGCCTAGGACGAGAGCTTC-3 ' (seeing the base sequence of sequence table SEQ .ID.No.2), downstream primer 5 '-GGGGTACCGATTTTGACATCGCTACAGAGT-3 ' (seeing the base sequence of sequence table SEQ .ID.No.3).From slaughterhouse, get fresh buffalo pituitary tissue, be stored in and in liquid nitrogen, transport laboratory back.Adopt Trizol reagent to extract total RNA, after the total RNA quality of electrophoresis detection, carry out reverse transcription reaction.Getting 2uL reversion product is template, carries out pcr amplification, amplification condition with above-mentioned primer: 94 ℃, and 30sec; 61 ℃, 30sec; 72 ℃, 55sec; Totally 35 circulations.1.5% agarose electrophoresis detects the specific fragment (seeing the base sequence of sequence table SEQ .ID.No.1) of 901bp, this fragment is carried out to the rear TA of glue recovery and be cloned in pMD18T carrier, obtains pMD18T-PRL carrier and checks order.
Take pMD18T-PRL carrier as template, with the primer amplification that is added with restriction enzyme site and His label, obtain PRL CDS district.Upstream primer 5 '-CGGGATCCATGCACCATCATCATCATCATCTGGTGCCACGCGGTTCTACCCCCGTC TGTCCCAAT-3 ' (seeing the base sequence of sequence table SEQ .ID.No.5); Downstream primer 5 '-GGGGTACCGATTTTGACATCGCTACAGAGT-3 ' (seeing the base sequence of sequence table SEQ .ID.No.6).Amplification condition: 94 ℃, 30sec; 61 ℃, 30sec; 72 ℃, 55sec; Totally 35 circulations.1.5% agarose electrophoresis detects the specific fragment (see Fig. 3, see the base sequence of sequence table SEQ .ID.No.4) of 804bp, this fragment is carried out to the rear TA clone of glue recovery and be inserted in pMD18T carrier, obtains pMD18T-PRL/His carrier order-checking.
The p-BCNpolyA carrier of preparation in advance and the pMD18T carrier of ring-type are cut to connection with SacI and KpnI enzyme, transform DH5 α bacterium, filter out positive colony, obtain pMD18T-BCNpolyA carrier; This carrier is cut and is connected with KpnI enzyme with BamHI with above-mentioned pMD18T-PRL/His carrier, proceed in DH5 α and filter out positive colony, obtain pMD18T-PRL-BCNpolyA carrier; This carrier is cut and is connected with Sal enzyme with BamHI with the p-BCN carrier of preparation in advance, proceed in DH5 α and filter out positive colony, obtain pMD18T-BCN-PRL-BCNpolyA carrier; This carrier is cut and is connected with Sal enzyme with NotI with the pEF321-EGFP-IRES-NEO-SV40polyA carrier of transforming through restriction enzyme site with the p-BCNcmv-EGFP-SV40polyA carrier of prior preparation respectively, proceed in DH5 α and filter out positive colony, obtain supplying the pMD18T-BCN-PRL/His-BCNpolyA-cmv-EGFP-SV40polyA carrier (carrier one) of procaryotic injection and can supplying the pMD18T-BCN-PRL/His-BCNpolyA-EF321-EGFP-IRES-NEO-SV40poly A carrier (carrier two) of screening.
Three, on cell levels, detect mammary specific expression buffalo PRL genophore
By Lipo2000 liposome transfection method for pMD18T-BCN-PRL/His-BCNpolyA-cmv-EGFP-SV40polyA carrier, transfection Bcap37 clone.As shown in Figure 4, after 48h, observe fluorescence, visible green luciferase expression, collecting cell extracts total RNA and total protein.Total RNA is after reverse transcription, and PCR method detects the expression of PRL gene, detects primer: upstream primer 5 '-ACCCCCGTCTGTCCCAAT-3 '; Downstream primer 5 '-GATTTTGACATCGCTACAGAGT-3 '.Amplification condition: 94 ℃, 30sec; 61 ℃, 30sec; 72 ℃, 55sec; Totally 35 circulations.1.5% agarose electrophoresis detects proof (as shown in Figure 5, Bcap37 clone is divided into four groups, with PRL carrier, EGFP-N1 carrier and the blank (only adding liposome 2000) of the liposome 2000 PRL carrier that this 3.8kbBCN of transfection starts respectively, 5.2kbBCN startup; In figure, A shows, two carrier RT-PCR amplifications of buffalo PRL that 3.8kbBCN promotor starts with 5.2kb promotor obtain and the increase PRL positive fragment of identical 804bp of corresponding plasmid PCR, and EGFP-N1 and blank do not increase and obtain positive fragment; In figure, B shows, all can the increase positive fragment of β-action reference gene of obtaining 190bp of four groups of cells), BCN can start PRL gene at Bcap37 transcription.Total protein carries out Western Blot detection, and primary antibodie is the anti-6 * His protein antibodies of mouse, and two resist for sheep anti-mouse antibody, and detected result is positive.Above result shows, BCN promotor can start the expression of PRL/His in Bcap37 clone.
Four, production and the detection of mammary specific expression buffalo PRL protein transgene mouse
Employing goes intracellular toxin plasmid extraction kit to extract pMD18T-BCN-PRL/His-BCNpolyA-cmv-EGFP-SV40polyA plasmid, with SalI and this plasmid of PvuI double digestion, carries out glue recovery, reclaims fragment and is dissolved in TE solution.After the dilution of linearization plasmid carrier, be injected in the zygote protokaryon of mouse, zygote transplation entered to the uterine tube place of the female mouse of replace-conceive of estrus synchronization, treat the sub-mouse of output.Get the sub-mouse tail point tissue of output, carry the laggard performing PCR of genomic dna and detect, obtain 8 positive mouse (as shown in Figure 6,2,3,7,9,10,12,14He 15 roads).The transgenic mice obtaining through evaluation is carried out to EGFP fluoroscopic examination, utilizing emitted light 525nm, exciting light 488nm, added fluorescence background spectral filter 425nm, time shutter is 5sec, wherein in 4 mouse, detect obvious green fluorescence, 1 detects faint green fluorescence, and 3 are not detected green fluorescence.
F0, for transgenic mice and wild-type mice mating, is obtained to F1 generation transgenic mice.Extract its tail point tissue gene group DNA and carry out PCR and detect screening, for avoiding false positive, select two pairs of primers to increase, electrophoresis detection all positive mouse is reserved seed for planting and is gone down to posterity.
To turn the female mouse of PRL gene and newborn mouse isolation lactation after 4 hours, the oxytocin of abdominal injection 0.3IU, the new anesthetized mice of 10min pneumoretroperitoneum injection speed dormancy, dabs nipple with the cotton balls that is moistened with warm water and adopts milk around.Volume by the milk collecting by 1: 10 adds after ddH2O dilution, and 4 ℃ of centrifugal 10min of 5000g get intermediate solution layer and do Western Blot detection.Primary antibodie is the anti-6 * His protein antibodies of mouse, and two resist for sheep anti-mouse antibody, and detected result is positive.Prove thus, BCN promotor can start the expression of PRL/His in intravital mouse mammary gland, and PRL/His albumen in milk, detected.
Five, in transgenic mice milk, buffalo PRL protein concentration detects
By the isolation of farrowing female mouse and the newborn mouse of the tenth day after 4 hours, the oxytocin of abdominal injection 0.3IU, the 10min pneumoretroperitoneum injection speed new anesthetized mice of sleeping, adopts milk after dabbing around nipple with the cotton balls that is moistened with warm water.Volume by the milk collecting by 1: 10 adds after ddH2O dilution, and 4 ℃ of centrifugal 10min of 5000g, get intermediate solution layer and detect as buffalo PRL Elisa.As shown in Figure 7, standard substance group data are done to matched curve analysis, y=51091 * e (6.1022x), R 2=0.9991, the mean concns that calculates buffalo PRL in mouse milk is 56.71ng/ml, and individual maximum concentration is 104.8ng/ml.
Six, the impact of mammary specific expression PRL gene pairs lactation related gene expression
Extract the total RNA of mammary tissue of farrowing female mouse of the tenth day, after reverse transcription, with deionized water, be diluted to 100ng/ μ l left and right, as the template of real-time quantitative.Detect primer: butterfat synthesis related gene---the upstream primer of acetyl-CoA carboxylase ACACA: 5 '-GAGGAGAACATCAAATACATCAG-3 ', downstream primer: 5 '-ATCCTTACAACTTCT GCTCG-3 '; The upstream primer of lactose synthesis related gene---β-Isosorbide-5-Nitrae-galactosyltransferase B4galt1: 5 '-CGGCATTCAAGAGACAAGA-3 ', downstream primer: 5 '-CGCATCGTTTCCTTTGTA-3 '; Milk-protein genes involved---the upstream primer of β casein CSN2: 5 '-TAGCACCCTTCCTTCCAC-3 ', downstream primer: 5 '-GTACATTTCCAGTTTCAGTCAG-3 '; The upstream primer of PRL: 5 '-GCTGCCATACCTCCTCC, downstream primer: 5 '-GGTGACTAGGTGATACAGAGG-3 '; The upstream primer of reference gene β-actin: 5 '-CATCCGTAAAGACCTCTATGC-3 ', downstream primer 5 '-ACATCTGCTGGAAGGTGGAC-3 '.Amplification condition: 95 ℃, 20sec; 60 ℃, 20sec; 72 ℃, 30sec; Totally 40 circulations.Experimental result show (see Fig. 8, mouse is divided into four groups: first group is PRL albumen in milk, to be detected, under ultraviolet lamp, sees green fluorescence, tail point tissue gene group detect PRL and EGFP gene positive turn PRL DNA murine; Second group is PRL albumen in milk, not detected, under ultraviolet lamp, sees green fluorescence, tail point tissue gene group detect PRL and EGFP gene positive turn PRL DNA murine; The 3rd group is PRL albumen in milk, not detected, under ultraviolet lamp, has no green fluorescence, tail point tissue gene group detect PRL and EGFP gene positive turn PRL DNA murine; The 4th group is non-transgenic mouse.Get the 10th day female mouse mammary gland of above four groups of lactations, QRT-PCR detects the expression level of ACACA, B4galt1, CSN2, PRL gene, in the mammary gland of mouse of result demonstration PRL genetic expression, the expression level of B4galt1 and CSN2 gene significantly improves compared with other groups, wherein the expression level utmost point of CSN2 gene significantly improves), compare with control group, the expression of buffalo PRL gene has significantly improved the expression level of β casein gene in lactose synthesis related gene and milk-protein, and the expression of butterfat genes involved is not made significant difference.

Claims (6)

1. a construction process for mammary specific expression buffalo PRL genophore, is characterized in that mainly comprising the following steps:
<1> extracts the total mRNA of buffalo hypophysis, after reverse transcription, adopt Auele Specific Primer to carry out the cDNA sequence that pcr amplification obtains total length buffalo PRL, after glue reclaims purified pcr product, its TA clone is inserted in pMD18T carrier, obtains pMD18T-PRL carrier;
Described in step <1>, primer is: upstream primer 5'-AGCCTAGGACGAGAGCTTC-3', downstream primer 5'-GGGGTACC GATTTTGACATCGCTACAGAGT-3';
It is template that <2> be take the carrier obtaining in step <1>, with the primer that is added with restriction enzyme site and His label, carry out pcr amplification, obtain the CDS fragment of buffalo PRL gene, and its TA is cloned in pMD18T carrier, obtain pMD18T-PRL/His carrier;
Described in step <2>, primer is: upstream primer
5'-CGGGATCCATGCACCATCATCATCATCATCTGGTGCCACGCGGTTCTACCCCC GTCTGTCCCAAT-3', downstream primer 5'-GGGGTACCGATTTTGACATCGCTACAGAGT-3';
<3> be take pMD18T as carrier framework, enzyme is cut and is connected into KpnI-BCNpolyA-SacI, BamHI-PRL/His-KpnI, SalI-NotI-BCN-BamHI, SalI-cmv-EGFP-SV40polyA-NotI or KpnI-BCNpolyA-SacI, BamHI-PRL/His-KpnI, SalI-NotI-BCN-BamHI, SalI-cmv-EGFP-SV40polyA-NotI, SalI-EF321-EGFP-IRES-NEO-SV40polyA-NotI fragment successively, obtains
Carrier one pMD18T-BCN-PRL/His-BCNpolyA-cmv-EGFP-SV40polyA,
Or carrier two pMD18T-BCN-PRL/His-BCNpolyA-EF321-EGFP-IRES-NEO-SV40poly A;
Described PRL gene is prolactin PRL gene, and described BCN is beta-casein promotor BCN.
2. the mammary specific expression buffalo PRL genophore that described in claim 1, method obtains.
3. the application of mammary specific expression buffalo PRL genophore in producing transgenic mice or buffalo described in claim 2.
4. application according to claim 3, is characterized in that: adopt procaryotic injection method, described carrier one or carrier two are transferred in mouse or buffalo embryo, obtain transgenic mice or the buffalo of mammary specific expression buffalo PRL albumen.
5. application according to claim 4, it is characterized in that: SalI and PvuI enzyme are cut described carrier one, reclaiming fragment is dissolved in TE solution, linearized vector plasmid is injected in the zygote protokaryon of mouse after dilution, again zygote transplation is entered to the uterine tube place of the female mouse of replace-conceive of estrus synchronization, treat the sub-mouse of output, through identifying, obtain described transgenic mice.
6. transgenic mice or the buffalo application in producing buffalo PRL albumen described in claim 3.
CN201110400876.1A 2011-12-06 2011-12-06 Mammary gland-specific expression buffalo prolactin (PRL) gene vector, construction method and application thereof Expired - Fee Related CN102492722B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201110400876.1A CN102492722B (en) 2011-12-06 2011-12-06 Mammary gland-specific expression buffalo prolactin (PRL) gene vector, construction method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201110400876.1A CN102492722B (en) 2011-12-06 2011-12-06 Mammary gland-specific expression buffalo prolactin (PRL) gene vector, construction method and application thereof

Publications (2)

Publication Number Publication Date
CN102492722A CN102492722A (en) 2012-06-13
CN102492722B true CN102492722B (en) 2014-09-10

Family

ID=46184584

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201110400876.1A Expired - Fee Related CN102492722B (en) 2011-12-06 2011-12-06 Mammary gland-specific expression buffalo prolactin (PRL) gene vector, construction method and application thereof

Country Status (1)

Country Link
CN (1) CN102492722B (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1873011A (en) * 2006-05-10 2006-12-06 扬州大学 Method for constructing idiosyncratic carrier of galactophore of transgenic animal in high expression level
CN101245352A (en) * 2007-02-13 2008-08-20 马义才 Polygene interferential shRNA plasmid expression vector, construction method and application
CN101265483A (en) * 2008-04-25 2008-09-17 中国人民解放军军事医学科学院生物工程研究所 Mammary gland specificity expression vector and construction method thereof

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6018039A (en) * 1996-07-30 2000-01-25 Satow; Hiroyasu MC26 gene expression-regulatory region

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1873011A (en) * 2006-05-10 2006-12-06 扬州大学 Method for constructing idiosyncratic carrier of galactophore of transgenic animal in high expression level
CN101245352A (en) * 2007-02-13 2008-08-20 马义才 Polygene interferential shRNA plasmid expression vector, construction method and application
CN101265483A (en) * 2008-04-25 2008-09-17 中国人民解放军军事医学科学院生物工程研究所 Mammary gland specificity expression vector and construction method thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
任艳萍等.水牛乳腺特异性表达PRL基因载体构建与表达检测.《中国畜牧兽医学会动物繁殖学分会第十五届学术研讨会论文集(上册)》.2010, *

Also Published As

Publication number Publication date
CN102492722A (en) 2012-06-13

Similar Documents

Publication Publication Date Title
JP2863789B2 (en) DNA sequence in proteins expressed in the mammary gland for efficient secretion
JP6531239B2 (en) Cell transfection method
CN111154763B (en) Application of long-chain non-coding RNA lncMGPF in regulation and control of pig muscle development function
CN109943564B (en) Construction method and application of hybrid mouse model with Amh gene fixed-point knock-in 2A-Cre
CN106148455A (en) A kind of derivant and application thereof
CN113122539B (en) RNA interference fragment of donkey Zfy gene, expression vector and application thereof
CN113957074A (en) Construction method and application of cerebellar ataxia disease model
CN105671079A (en) Mouse with human nerve growth factor transgenes as well as preparation method and application of mouse
CN104232643B (en) RNAi interference fragments, interference carrier, preparation method and applications
CN102492722B (en) Mammary gland-specific expression buffalo prolactin (PRL) gene vector, construction method and application thereof
CN103255168B (en) Construct and application thereof
CN110250108A (en) RPRM gene knock-out mice model and its construction method and application
CN102747102A (en) HSA (Human Serum Albumin) mammary gland specific expression vector and reconstitution cell constructed by HSA mammary gland specific expression vector
CN1705743B (en) Porcine uroplakin II promoter and the production method of useful proteins using said promoter
CN110218743B (en) Construction method of taurine transporter gene knockout rat model based on CRISPR/Cas9 technology
CN106337049A (en) Breeding method of anti-influenza transgenic animals expressing double genes
CN107937439B (en) Application of gene and construction method of animal model
CN112553205A (en) Antisense RNA sequence combination for inhibiting gonad development of pelteobagrus fulvidraco, method and application thereof
JPH03504560A (en) Transgenic animals for testing multidrug resistance
CN113462692B (en) Mstn gene knockout method suitable for fertilized egg of culter alburnus and application
CN115806986B (en) Milk goat Zfy gene interference fragment, expression vector and application thereof
CN104313052A (en) Mammary gland specific co-expression vector for stably expressing human coagulation factor VIII by utilizing vWF
CN117721152B (en) Application of TTP in preparation of osteoarthritis medicines
Chen et al. Production of transgenic mice expressing the goat H-FABP gene by intratesticular injection
BAI et al. The establishment of double-transgenic mice that co-express the appA and MxA genes mediated by type a spermatogonia in vivo

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20140910

Termination date: 20151206

EXPY Termination of patent right or utility model