CN101245352A - Polygene interferential shRNA plasmid expression vector, construction method and application - Google Patents
Polygene interferential shRNA plasmid expression vector, construction method and application Download PDFInfo
- Publication number
- CN101245352A CN101245352A CNA2007100484739A CN200710048473A CN101245352A CN 101245352 A CN101245352 A CN 101245352A CN A2007100484739 A CNA2007100484739 A CN A2007100484739A CN 200710048473 A CN200710048473 A CN 200710048473A CN 101245352 A CN101245352 A CN 101245352A
- Authority
- CN
- China
- Prior art keywords
- shrna
- carrier
- transcription unit
- mcs
- psilencer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a plasmid vector pSilencer-U6/H1-(shRNA)n which can be used for simultaneously expressing a plurality of shRNA, a construction method and application thereof. The vector is composed of two groups of sequences of multiple cloning sites (MCS), a plurality of target gene shRNA transcription units and plasmid sequences. The shRNA transcription units of a plurality of different or same target genes can be connected in series between the two groups of the sequences of the multiple cloning sites of the vector, a plurality of shRNA transcription units thereon can express one target gene for many times or express a plurality of different sites of one target gene or express different target genes after the transcription of cells or animals, so as to specifically inhibit the expressions of two or more target genes. The vector can be easily used in the gene function research and the research and development of the gene therapeutic drugs for diseases.
Description
One, technical field
The present invention relates in the genomic medicine field based on polygene interferential shRNA plasmid expression vector pSilencer-U6/H1-(shRNA) n and construction process and application.
Two, background technology
RNA disturbs (RNAi) to be meant and utilizes double-stranded RNA (double-stranded RNA, dsRNA) specially bring out degraded with the mRNA of its sequence homology, cause corresponding target genes to be expressed by the PTGS of special inhibition (post-transcriptionalgene silence, PTGS) phenomenon.RNA disturbs and is found in nematode (C.elegans) in 1998 genetic analysis.People in 1999 detect 21-25nt RNA fragment in plant essential by plant RNA i, be called as small molecules interference RNA (short or sallinterfering RNA, siRNA), its mechanism of action is illustrated in fruit bat research subsequently, and achievement is applied to antiviral, antitumor and gene functional research very soon.2001-2003 RNAi technology was cited as the world's ten big sciences achievement then in continuous 3 years, and wherein, calendar year 2001 is listed in second of the world's ten big sciences achievement, classifies the world's ten big sciences as and achieves first in 2002.U.S. Fortune (wealth) magazine in 2003 is with itself and gene recombination technology, monoclonal antibody technique and be called biopharmaceutical industry three big " gold mine ".Its research has obtained encouraging achievement with application in the short time.The RNAi technological achievement obtained Nobel's physiology or medical science prize in 2006.
Why RNAi can cause that the nearly all research in biomedical boundary unprecedentedly attractes attention, and is because siRNA has powerful inhibition expression of target gene effect and height sequence-specific.With the conventional tool of inhibition of gene expression, as antisense oligonucleotide, ribozyme etc. relatively, the efficient of siRNA silencer arrives thousands of times up to tens of times.Moreover, siRNA itself is a kind of gene target medicine that has prospect still, can be widely used in such as treatments such as cancer, virus diseases.At present, first siRNA medicine--obtain FDA (Food and Drug Adminstration) (FDA) approval at the siRNA of VEGF gene and begun to carry out a clinical trial phase.
RNA interferential detailed process is the dsRNA that is introduced by modes such as external source or transgenosis, virus infectiones, the mode that in cell, is relied on ATP by RNA enzyme Dicer, be cut into long 21-23 Nucleotide (nt), 3 ' and hold the double-stranded RNA that has 2 Nucleotide outstanding, be small molecules interference RNA (small interfering RNA, siRNA).SiRNA with protein binding such as nuclease form the reticent mixture of RNA induced gene (RNA induced silencing complex, RISC).RISC is opened into strand with double-stranded siRNA under the effect of ATP, combine with the complimentary positions specificity of the mRNA of expression of target gene, brings out target gene mRNA degraded, thereby suppress expression of target gene on rna level.
The RNAi applied research need prepare the siRNA of 19-23nt.The siRNA preparation can be adopted chemical synthesis, also can adopt the vector expression method to transcribe out the shRNA of target sequence in cell, realizes that by the corresponding siRNA of the spontaneous in vivo generation of shRNA target gene disturbs.Though being directly used in target gene, external synthetic siRNA suppresses convenient and swift, unstable, easily degraded by RNase, the gene interference effect time that produces is short, generally can only keep all left and right sides time, and RNA is synthetic costs an arm and a leg, operation is also convenient not as DNA, so its popularization is limited to.The ultimate principle that the vector expression method is expressed shRNA/siRNA is: the carrier that contains mammals rna plymerase iii promotor U6 or H1, its promotor can start under the specific recognition of intracellular rna polymerase III transcribes out a kind of short rna, when transcribing when running into 4～6 T of successive, transcribe then and stop.Nucleotide reverse complemental about 21 of its two ends of short rna of transcribing out can form hairpin structure, be called bobby pin RNA (short hairpin RNA, shRNA).This bobby pin RNA can be sheared by the Dicer enzyme in vivo very soon becomes siRNA, thereby plays the RNA interference effect.This method is easy and simple to handle, and cost is low, and siRNA compares with chemosynthesis, dna vector is more stable in vivo, target gene expression is suppressed the efficient height, be convenient to carry out the gene functional research of long period, the mammalian cell specific gene expression inhibiting rate of mediation can reach more than 95%; Through suitable resistance screening, can also obtain the permanent interference cell clone that shRNA is stably integrated in cellular genome, obtain specific gene and express by the cell of long term inhibition, and then can further study gene function on phenotype, therefore development is very rapid recently.
At present, shRNA vector expression method used carrier is divided into virus vector and non-virus carrier two classes.Though it is few that virus is made carrier carrier consumption, the transfection efficiency height, the clinical application meeting produces resistance, and its clinical safety receives much attention always; Non-virus carrier is comparatively safe, but transfection efficiency is low, and the carrier consumption is big.Discoveries such as Alan J Bridge, the shRNA expression vector of q.s also can inspire cell Interferon, rabbit effect, even common plasmid transfection mammalian cell, as long as reach certain consumption, also can cause cell Interferon, rabbit effect, therefore, the carrier consumption has certain limit, and this restriction that especially the carrier consumption is subjected to when some need suppress the experiment of two or more genes simultaneously is just bigger.
RNA disturbs has high degree of specificity, and a siRNA can only disturb at a target gene.Can encode the simultaneously carrier of a plurality of shRNA of structure disturbs in order to realize two above target genes simultaneously, can strengthen the inhibition effect to expression of target gene undoubtedly greatly.But shRNA vector expression method wants to accomplish to realize simultaneously that the shRNA expression at a plurality of identical or different target genes is then difficult unusually on a carrier at present, can only accomplish all that generally a carrier is only expressed a target gene shRNA in cell.
The existing at present bibliographical information of the improvement project that helps shRNA vector expression method the problems referred to above to solve.The one, the scheme that Chinese patent publication number CN1611606A discloses: this scheme is initial carrier with the pUCl8 plasmid, the U6 promotor is oppositely inserted between the EcoRI and BamHI of pUCl8 plasmid multiple clone site, obtains pUCl8-U6-MCS; Simultaneously, external synthetic positive-sense strand and the antisence strand dna that has BamHI and XbaI enzyme cutting site, and annealing obtains the double-stranded DNA of each coding " shRNA (as shRNA1, shRNA2, shRNA3, shRNA4, shRNA5 or more)+U6 termination signal ".Afterwards with synthetic each " shRNA+U6 termination signal " thus the double-stranded DNA orientation is inserted into the expression vector that pUCl8-U6-MCS plasmid behind BamHI and XbaI enzyme cutting constructs a plurality of shRNA of coding one by one.This scheme advantage is: the expression vector that structure can be expressed a plurality of shRNA does not simultaneously need to introduce other multiple clone site sequence (MCS) on initial carrier, but directly utilizes the MCS of initial carrier pUCl8.The shortcoming of this scheme is: need to adopt the complicated molecule biological means to separate preparation U6 promotor earlier before a plurality of shRNA expression vector establishments; During vector construction, the U6 promotor that separate to obtain also need with the enzymatic means further respectively orientation be connected on each synthetic " shRNA+U6 termination signal " double-stranded DNA structure, shRNA is many more if this operation relates to expression, and then this directed connection is just more loaded down with trivial details.
Another program that Chinese patent publication number CN1710079A discloses is: design and synthesize two groups of multiple clone site sequences earlier, two groups of multiple clone site sequences of synthetic are incorporated into the shRNA transcription unit both sides of commercialization carrier pSilencer3.0-H1 (Ambion company), shRNA transcription unit, the plasmid pUCl9 basic sequence of two groups of multiple clone site sequences and pSilencer3.0-H1 are made up in order, construct the carrier is carrier that can between two groups of multiple clone site sequences, be connected in series a plurality of shRNA transcription unit earlier; Utilize the isocaudarner restriction enzyme site of the multiple clone site sequence that is arranged in carrier is carrier transcription unit front and back and a restriction enzyme site of multiple clone site sequence then, the shRNA transcription unit (the shRNA coding region sequence in this promotor downstream of H1 promotor+be connected is collectively referred to as a shRNA transcription unit) that to contain a plurality of target gene interference sequences is connected between two MCS of carrier is carrier, constructs the plasmid vector that can express a plurality of shRNA simultaneously thus.This scheme has been saved numerous and diverse step of separating the preparation promotor, directly uses the commercialization carrier pSilencer3.0-H1 that carries promotor H1 to make initial carrier and the encode expression vector of a plurality of shRNA of design construction.The weak point of the disclosure Patent publish scheme is: used promotor is the H1 promotor, and its initial carrier of commercialization that is elected to be the establishing target carrier also only limits to pSilencer3.0-H1.In fact, in the life science, except that the H1 promotor, start the more powerful promotor U6 of its function of rna transcription in addition.Thus, be not difficult to draw, the shRNA/siRNA expression amount that is obtained behind the constructed expression vector transfectional cell of CN1710079A publication number Patent publish scheme is potent not as the U6 promoter vector, thus so that the expression of target gene that produces to suppress effect also potent not as the U6 promoter vector.
For addressing the above problem, the present invention discloses a kind of new for polygene interferential plasmid expression vector scheme.Relate in the vector construction process in the both sides design of initial carrier shRNA transcription unit and introduce two groups of new multiple clone site sequences that are different from CN1710079A publication number patent, and U6 and two kinds of promotors of H1 all can be used to make up polygene shRNA expression vector pSilencer-U6/H1-(shRNA) n.Behind this carrier transfectional cell, the target gene interference sequence that promotor U6 or H1 can start on the carrier is transcribed out a plurality of corresponding shRNA at target-gene sequence, and these shRNA can be processed into a plurality of corresponding siRNA very soon and bring into play its Degradation to corresponding target genes mRNA simultaneously in cell.This expression vector is the plasmid-type carrier, can prepare purifying by the intestinal bacteria high density fermentation, and makes polygene RNAi medicine or the preparation of using for disease treatment.
Polygene shRNA plasmid expression vector and construction process thereof that the present invention makes up are obviously different with CN1710079A publication number patent with CN1611606A:
CN1611606A publication number Patent publish scheme constructs destination carrier does not need synthetic in addition MCS sequence, and that initial carrier is selected for use is common plasmid pUCl8.The constructed destination carrier of the present invention needs the synthetic two groups of MCS sequences of special design, and initial carrier is commercialization carrier pSilencer2.0-U6 and pSilencer3.0-H1.
Compare with CN1710079A publication number Patent publish scheme, the present invention has three aspect differences: two groups of MCS site sequence differences of initial carrier shRNA transcription unit both sides are designed and be introduced in (1).Among the designed two groups of MCS of the present invention, MCS
1Contain KpnI, XbaI, four restriction enzyme sites of EcoRV, EcoRI, long 21bp; MCS
2Contain HindIII, SpeI, four restriction enzyme sites of EcoRV, PstI, long 20bp.Wherein isocaudarner is XbaI and SpeI.In two groups of multiple clone site sequences of CN1710079A publication number Patent publish, KSEE (is equivalent to the MCS among the present invention
1) contain KpnI, SalI, four restriction enzyme sites of EcoRV, EcoRI, long 23bp; HXEP (is equivalent to the MCS among the present invention
2) contain HindIII, XhoI, four restriction enzyme sites of EcoRV, PstI, long 19bp.Wherein isocaudarner is SalI and XhoI.(2) used promotor difference.The used promotor of the present invention comprises also that except H1 effect is better than the promotor U6 of H1, and the used promotor of CN1710079A publication number Patent publish scheme only is H1.(3) the initial carrier of the commercialization that is utilized is different.The initial carrier of the commercialization that the present invention utilized comprises two kinds of pSilencer2.0-U6 and pSilencer3.0-H1, and the initial carrier of commercialization that CN1710079A publication number Patent publish scheme is utilized only limits to pSilencer3.0-H1.
Three, summary of the invention
The present invention relates to a kind of plasmid vector pSilencer-U6/H1-(shRNA) n and construction process and application that can be used for expressing simultaneously a plurality of shRNA.Described carrier pSilencer-U6/H1-(shRNA) n is made up of two groups of multiple clone site sequences (MCS), a plurality of target gene shRNA transcription unit and plasmid sequence, and the promotor in the carrier shRNA transcription unit is mammalian rna polymerase III promotor U6 or H1.Can connect between two groups of multiple clone site sequences of the carrier shRNA transcription unit of a plurality of similar and different target-gene sequences.Behind carrier transfectional cell or the animal, a target gene can repeatedly be expressed by a plurality of shRNA transcription unit on it, or expresses a plurality of different loci of a target gene, or expresses different target genes, thereby can the two or more expression of target gene of special inhibition.
Technical scheme of the present invention is: design and introduce two groups of multiple clone site sequences (MCS) in the shRNA transcription unit both sides of initial carrier pSilencer2.0-U6 or pSilencer3.0-H1 (available from Ambion company) (Fig. 1 and Fig. 2) earlier, two groups of multiple clone site sequences and shRNA transcription unit, plasmid sequence are made up in order, and constructing can be at two groups of multiple clone site sequence (MCS
1And MC
s) between the carrier is carrier pSilencer-U6/H1-2MCS of a plurality of shRNA of series connection transcription unit; Afterwards, utilization is arranged in two the isocaudarner restriction enzyme sites (XbaI and SpeI) of the multiple clone site before and after the carrier is carrier pSilencer-U6/H1-2MCS transcription unit and a restriction enzyme site (PstI) of multiple clone site, and the shRNA transcription unit (the shRNA coding region sequence in this promotor downstream of U6 or H1 promotor+be connected is collectively referred to as a shRNA transcription unit) that will contain a plurality of target-gene sequences is connected on two MCS (MCS of carrier is carrier pSilencer-U6/H1-2MCS
1And MC
s) between, construct thus plasmid vector pSilencer-U6/H1-(shRNA) n that can express a plurality of shRNA simultaneously (n represents shRNA transcription unit number, n=1,2 ..., n).A plurality of shRNA transcription unit can be designed to the same site at a target gene, also can be designed to the different loci at a target gene, can also be designed at different target genes, thereby realize effective special inhibition to one or more target genes.Plasmid expression vector pSilencer-U6/H1-(shRNA) n that can express a plurality of shRNA simultaneously that the present invention makes up can conveniently be used for the research and development of gene functional research and disease gene medicine.
The construction step of plasmid expression vector pSilencer-U6/H1-(shRNA) n that can express a plurality of shRNA simultaneously of the present invention is as follows:
1, carrier is carrier pSilencer-U6/H1-2MCS makes up
(1) is positioned at the multiple clone site sequences Design of initial carrier shRNA transcription unit both sides
The single stranded sequence of two groups of multiple clone site is designed to:
MCS
1(21bp altogether): 5 '-AATTGGTACCTCTAGATATCG-3 ' (1)
3’-CCATGGAGATCTATAGCTTAA-5’ (2)
MCS
2(20bp altogether): 5 '-AGCTTACTAGTGATATCTGC-3 ' (3)
3’-ATGATCACTATAGACGTCGA-5’ (4)
(2) two groups of multiple clone site single stranded sequences of synthetic entrust biotech company to finish.
(3) two groups of multiple clone site single stranded sequence annealing form double-stranded MCS
1And MCS
2
The multiple clone site single stranded sequence adds no RNase water dissolution to 1ug/ul.Paired two groups of multiple clone site single stranded sequences (i.e. (1) and (2), (3) and (4)) each 2ul adds 46ul DNA annealing buffer (10mM Tris-HCl pH7.5,100mM NaCl, 1mM EDTA, pH8.0) to cumulative volume 50ul, hatch 5 minutes, 37 ℃ for 95 ℃ and hatched 1 hour, it is annealed respectively becomes double-stranded MCS
1And MCS
2Contain KpnI, XbaI, four restriction enzyme sites of EcoRV, EcoRI, MCS on the double-stranded MCS1 that annealing forms
2On contain HindIII, SpeI, four restriction enzyme sites of EcoRV, PstI.Wherein XbaI and SpeI are a pair of isocaudarner.In two groups of multiple clone site sequences, remove EcoRI (MCS
1) and HindIII (MCS
2) outside, all the other each restriction enzyme restriction enzyme sites all do not exist in initial carrier pSilencer2.0-U6 and pSilencer3.0-H1.MCS
1Two ends have EcoRI the sticky end 5 '-AATT of protrusion, can be used for connecting the EcoRI point of contact end of initial carrier shRNA transcription unit and the EcoRI point of contact end of plasmid pUCl9; MCS
2Two ends have HindIII the sticky end 5 '-AGCT of protrusion, can be used for connecting the HindIII point of contact end of initial carrier shRNA transcription unit and the HindIII point of contact end of plasmid pUCl9.The double-stranded MCS that annealing forms
1And MCS
2-20 ℃ of preservations are standby.
(4) each segment connects and composes carrier is carrier pSilcencer-U6/H1-2MCS
1. use the initial carrier recovery small segment of EcoRI+HindIII double digestion, obtain shRNA transcription unit fragment.Segmental two ends of this shRNA transcription unit have respectively protrusion EcoRI sticky end 5 '-AATT (its corresponding recessed end 3 '-TTAA can with MCS
1EcoRI the sticky end 5 '-AATT that protrudes is complementary to be connected) and HindIII sticky end 5 '-AGCT (its corresponding recessed end 3 '-TCGA can with MCS
2HindIII the sticky end 5 '-AGCT that protrudes is complementary to be connected); 2. reclaim big fragment with EcoRI+HindIII double digestion plasmid pUCl9, reclaim EcoRI sticky end 5 '-AATT that its two end of the big fragment of plasmid pUCl9 obtain has protrusion respectively (its corresponding recessed end 3 '-TTAA can with MCS
1EcoRI the sticky end 5 '-AATT that protrudes is complementary to be connected) and HindIII sticky end 5 '-AGCT (its corresponding recessed end 3 ' TCGA can with MCS
2HindIII the sticky end 5 '-AGCT that protrudes is complementary to be connected).3. the initial carrier shRNA transcription unit's fragment and big fragment of plasmid pUCl9 and the MCS that recovery are obtained
1, MCS
2Mix and carry out ligation, above-mentioned four kinds of fragments can be realized that head and the tail connect, order-checking afterwards identifies that segment connects exactness, promptly obtains carrier is carrier pSilcencer-U6/H1-2MCS (Fig. 3 and Fig. 4).This carrier is carrier can be conveniently connected a plurality of shRNA transcription unit simultaneously and is formed pSilencer-U6/H1-(shRNA) n.
2, can express plasmid expression vector pSilencer-U6/H1-(shRNA) the n structure of a plurality of shRNA simultaneously
Utilization is arranged in two the isocaudarner restriction enzyme sites (XbaI and SpeI) of the multiple clone site sequence before and after the carrier is carrier pSilcencer-U6/H1-2MCS transcription unit and a restriction enzyme site (PstI) of multiple clone site sequence, can carry out the combination of a plurality of shRNA transcription unit, thereby construct plasmid expression vector pSilencer-U6/H1-(shRNA) n (Fig. 6) that expresses a plurality of shRNA.Be operating as: the carrier is carrier pSilcencer-U6/H1-2MCS of structure cuts back to close small pieces with the XbaI+PstI enzyme, cuts back to close big segment with the SpeI+PstI enzyme again, two recovery segments is connected can realize two shRNA transcription units series connection.Three its relative positions of restriction enzyme site of XbaI, SpeI, PstI after the transcription unit series connection remain unchanged, and more shRNA transcription unit can continue on for connecting.Each tandem transcription units of the pSilencer-U6/H1-that builds (shRNA) n plasmid expression vector is made up of a promotor (U6 or H1) and a special shRNA encoding sequence respectively, and two multiple clone site sequences that a plurality of transcription units are connected on same plasmid expression vector from beginning to end (are MCS
1And MCS
2) between (Fig. 6).Its exactness is identified in order-checking simultaneously.
Four, goal of the invention
First purpose of the present invention provides a kind of plasmid vector pSilencer-U6/H1-(shRNA) n that can be used for expressing simultaneously a plurality of target gene shRNA.
Second purpose of the present invention provides the construction process of described polygene shRNA plasmid expression vector.
The 3rd purpose of the present invention is the application of the described polygene shRNA plasmid expression vector of explanation in preparation disease gene medicine.
A further object of the present invention provides two groups of new multiple clone site sequences and the application of these two groups of multiple clone site sequences in making up polygene shRNA plasmid expression vector is described.
Five, beneficial effect of the present invention
Polygene shRNA plasmid expression vector pSilencer-U6/H1-disclosed by the invention (shRNA) n has following advantage:
(1) identical carrier can realize that a plurality of expression of target gene suppress.Constructed carrier pSilencer-U6/H1-(shRNA) n can continue to transcribe synthetic corresponding shRNA at a plurality of target genes in cell, these shRNA can be processed into a plurality of corresponding siRNA very soon and bring into play its mRNA Degradation to corresponding target genes simultaneously in cell.
(2) suppress the expression of target gene effect stability, easy to operate.The constructed polygene shRNA plasmid expression vector of the present invention is a dna vector, and it can continue synthetic shRNA/siRNA and the performance special restraining effect to expression of target gene in cell.And external artificial synthetic siRNA is easily degraded by RNase, and the gene interference effect of generation can only be kept all left and right sides time, and RNA is synthetic costs an arm and a leg, the difficult popularization, and operation is also convenient not as DNA.
(3) be the plasmid-type carrier.The plasmid-type carrier is safer than its clinical use of virus type carrier, is difficult for producing resistance.And the plasmid-type carrier can pass through intestinal bacteria mass-producing fermentative preparation when making RNAi medicine or preparation, easy and simple to handle, with low cost.
Six, description of drawings
The initial carrier structure figure of Fig. 1, pSilencer3.0-H1.Carrier has promotor H1 available from Ambion company on it, wherein, " H1Promoter+siRNA " between EcoRI and HindIII is a shRNA transcription unit.
The initial carrier structure figure of Fig. 2, pSilencer2.0-U6.Carrier has promotor U6 available from Ambion company on it, wherein " U6Promoter+siRNA " between EcoRI and HindIII is a shRNA transcription unit.
Fig. 3, pSilcencer-H1-2MCS plamid vector construction schema, wherein MCS
1Contain restriction enzyme site KpnI, XbaI, EcoRV, EcoRI, MCS
2Contain restriction enzyme site HindIII, SpeI, EcoRV, PstI, XbaI and SpeI are a pair of isocaudarner, and three restriction enzyme site relative positions of XbaI, SpeI and Pst I remain unchanged, and are to carry out the placed in-line key enzyme of shRNA transcription unit.
Fig. 4, pSilcencer-U6-2MCS plamid vector construction schema.MCS wherein
1Contain restriction enzyme site KpnI, XbaI, EcoRV, EcoRI, MCS
2Contain restriction enzyme site HindIII, SpeI, EcoRV, PstI, XbaI and SpeI are a pair of isocaudarner, and three restriction enzyme site relative positions of XbaI, SpeI and Pst I remain unchanged, and are to carry out the placed in-line key enzyme of shRNA transcription unit.
Fig. 5, single-gene plasmid vector pSilencer-U6/H1-(shRNA)
1Make up schema.The shRNA target sequence structure that is positioned at behind the promotor H1 is made up of " BamHI-target sequence positive-sense strand-9bp loop encircles sequence-target sequence antisense strand-6 T-HindIH " short double-stranded DNA, can transcribe out target sequence bobby pin RNA (shRNA) continually and steadily behind the carrier transfered cell, this shRNA can spontaneous generation siRNA in cell and is brought into play its degrade specifically effect to target gene mRNA.Wherein N represents any in A, T, four kinds of bases of C, G, the base reverse complemental of positive-sense strand (Sense) and antisense strand (Antisense).
Fig. 6, pSilencer-U6/H1-(shRNA) n plasmid expression vector structure iron.Wherein: n represents shRNA transcription unit number, n=1, and 2 ..., n; P
U6/H1Represent H6 or H1 promotor (promoter); Ori is the carrier replication origin; Aampicillin is the penbritin selection markers.
Seven, embodiment
Following embodiment further specifies building process and the application of polygene shRNA plasmid expression vector pSilencer-U6/H1-of the present invention (shRNA) n, wherein embodiment 2 and embodiment 3 with virus of AIDS (HIV) duplicate genes involved env, gag, pol, vif are that example is specifically described.Special needs to be pointed out is that specification sheets illustrated embodiment of the present invention is just in order to help to understand the present invention, they are any restriction of tool not, i.e. the present invention can also have other embodiment except that the specification sheets illustrated embodiment.Therefore, every employing is equal to any technical scheme of replacement or the formation of equivalent transformation form, all drops in the protection domain of requirement of the present invention.
Embodiment 1: make up based on polygene interferential shRNA plasmid expression vector pSilencer-U6/H1-(shRNA) n
Be a plurality of shRNA of realization transcription unit series connection on single carrier, need to design and introduce two groups of multiple clone site sequences (MCS) in the shRNA transcription unit both sides of initial carrier pSilencer2.0-U6 or pSilencer3.0-H1 (available from Ambion company) earlier, two groups of multiple clone site sequences and shRNA transcription unit, plasmid sequence are made up in order, and constructing can be at two groups of multiple clone site sequence (MCS
1And MC
s) between the carrier is carrier pSilencer-U6/H1-2MCS of a plurality of shRNA of serial connection transcription unit.The encoding sequence of a plurality of target gene interferential shRNA transcription unit in series connection between two MCS of pSilencer-U6/H1-2MCS carrier afterwards.
1, pSilcencer-U6/H1-2MCS basis plamid vector construction
(1) is positioned at the multiple clone site sequences Design of initial carrier shRNA transcription unit both sides
The single stranded sequence of two groups of multiple clone site is designed to:
MCS
1(21bp altogether): 5 '-AATTGGTACCTCTAGATATCG-3 ' (1)
3’-CCATGGAGATCTATAGCTTAA-5’ (2)
MCS
2(20bp altogether): 5 '-AGCTTACTAGTGATATCTGC-3 ' (3)
3’-ATGATCACTATAGACGTCGA-5’ (4)
(2) two groups of multiple clone site single stranded sequences of synthetic
Entrust the synthetic above-mentioned two groups of multiple clone site single stranded sequences of biotech company.
(3) two groups of multiple clone site single stranded sequence annealing form double-stranded MCS
1And MCS
2
Be operating as: the multiple clone site single stranded sequence adds no RNase water dissolution to 1ug/ul.Paired two groups of multiple clone site single stranded sequences (i.e. (1) and (2), (3) and (4)) each 2ul adds 46ul DNA annealing buffer (10mM Tris-HCl pH7.5,100mM NaCl, 1mM EDTA, pH8.0) to cumulative volume 50ul, hatch 5 minutes, 37 ℃ for 95 ℃ and hatched 1 hour, it is annealed respectively becomes double-stranded MCS
1And MCS
2Double-stranded MCS
1And MCS
2-20 ℃ of preservations are standby.
Two groups of double-stranded MCS sequences that annealing forms have following characteristics: 1. double-stranded MCS
1On contain KpnI, XbaI, four restriction enzyme sites of EcoRV, EcoRI, MCS
2On contain HindHI, SpeI, four restriction enzyme sites of EcoRV, PstI.2. MCS
1In XbaI and MCS
2In SpeI be a pair of isocaudarner, be used for subsequent builds polygene shRNA plasmid expression vector pSilencer-U6/H1-(shRNA) n.3. in two groups of multiple clone site sequences, remove EcoRI (MCS
1) and HindIII (MCS
2) outside, all the other each restriction enzyme restriction enzyme sites (comprising isocaudarner XbaI and SpeI) all do not exist in initial carrier pSilencer2.0-U6 and pSilencer3.0-H1.4. MCS
1Two ends have EcoRI the sticky end 5 '-AATT of protrusion, can be used for the EcoRI point of contact end of the initial carrier shRNA of follow-up connection transcription unit and the EcoRI point of contact end of plasmid pUCl9; MCS
2Two ends have HindIII the sticky end 5 '-AGCT of protrusion, can be used for the HindIII point of contact end of the initial carrier shRNA of follow-up connection transcription unit and the HindIII point of contact end of plasmid pUCl9.
(4) each segment connects and composes carrier is carrier pSilcencer-U6/H1-2MCS
1. use the initial carrier recovery small segment of EcoRI+HindIII double digestion, obtain shRNA transcription unit fragment.Segmental two ends of this shRNA transcription unit have respectively protrusion EcoRI sticky end 5 '-AATT (its corresponding recessed end 3 '-TTAA can with MCS
1EcoRI the sticky end 5 '-AATT that protrudes is complementary to be connected) and HindIII sticky end 5 '-AGCT (its corresponding recessed end 3 '-TCGA can with MCS
2HindIII the sticky end 5 '-AGCT that protrudes is complementary to be connected); 2. reclaim big fragment with EcoRI+HindIII double digestion plasmid pUCl9, reclaim EcoRI sticky end 5 '-AATT that its two end of the big fragment of plasmid pUCl9 obtain has protrusion respectively (its corresponding recessed end 3 '-TTAA can with MCS
1EcoRI the sticky end 5 '-AATT that protrudes is complementary to be connected) and HindIII sticky end 5 '-AGCT (its corresponding recessed end 3 '-TCGA can with MCS
2HindIII the sticky end 5 '-AGCT that protrudes is complementary to be connected).3. the initial carrier shRNA transcription unit's fragment and big fragment of plasmid pUCl9 and the MCS that recovery are obtained
1, MCS
2Mix and carry out ligation, above-mentioned four kinds of fragments can be realized that head and the tail connect, order-checking afterwards identifies that segment connects exactness, promptly obtains carrier is carrier pSilcencer-U6/H1-2MCS (Fig. 3 and Fig. 4).This carrier is carrier can be conveniently connected a plurality of shRNA transcription unit simultaneously and is formed pSilencer-U6/H1-(shRNA) n.
2, polygene interferential shRNA plasmid expression vector pSilencer-U6/H1-(shRNA) n makes up (n=1,2,3 ...)
Among the carrier is carrier pSilcencer-U6/H1-2MCS of above-mentioned structure, XbaI and SpeI among two groups of MCS are a pair of isocaudarner.Isocaudarner can produce identical sticky end, and enzyme is cut product and can not be cut by former isocaudarner identification with its connection product of ligase enzyme connection back again.The present invention utilizes isocaudarner XbaI can produce identical sticky end with SpeI, connect the principle that its product of back no longer is identified incision with ligase enzyme, a plurality of shRNA transcription unit is connected between two MCS of carrier is carrier pSilcencer-U6/H1-2MCS simultaneously, constructs polygene interferential shRNA plasmid expression vector pSilencer-U6/H1-(shRNA) n thus.The site of XbaI identification is T ↓ CTAGA, the site of SpeI identification is A ↓ CTAGT, and the enzyme of the two is cut product and all contained identical sticky end CTAG, and available ligase enzyme connects, connection is finished postorder and is classified TCTAGT as, and this sequence all can not be again by isocaudarner XbaI and SpeI identification cutting.The carrier is carrier pSilcencer-U6/H1-2MCS that builds cuts back to close small pieces with the XbaI+PstI enzyme, cuts back to close big segment with the SpeI+PstI enzyme again, two recovery segments is connected can realize two shRNA transcription units series connection.Three its relative positions of restriction enzyme site of XbaI, SpeI, PstI after the transcription unit series connection remain unchanged, and are to carry out the placed in-line key enzyme of shRNA transcription unit, and more shRNA transcription unit can continue on for connecting.Each tandem transcription units of the pSilencer-U6/H1-that builds (shRNA) n expression vector is made up of a promotor (U6 or H1) and a special shRNA encoding sequence respectively, and two multiple clone site that a plurality of transcription units are connected on same plasmid expression vector from beginning to end (are MCS
1And MCS
2) between.Its exactness is identified in order-checking.
(1) single-gene shRNA expression vector pSilencer-U6/H1-(shRNA)
1Make up
According to Tuschl double-stranded RNA principle of design, by each target gene of computer-aided analysis (as X, Y, Z ...) sequence and secondary structure thereof, determine specificity shRNA target sequence, and guarantee that by GenBank BLAST retrieval selected sequence and other irrelevant sequence do not have homology.The shRNA specific oligonucleotide dna fragmentation of synthetic target sequence comprises " BamHI-target sequence positive-sense strand-9bp loop encircles sequence-target sequence antisense strand-6 T-HindIII ".5 ' end of the double-stranded DNA that synthetic fragment annealing back forms has the sticky end of BamHI restriction enzyme site, and 3 ' end has the sticky end of HindIII restriction enzyme site, can be directly used in promotor (U6 or the H1) downstream that is connected to the pSilcencer-U6/H1-2MCS carrier.Be operating as: the pSilcencer-U6/H1-2MCS carrier with BamHI and HindIII double digestion, is reclaimed big segment.With the short double-stranded DNA of the formation afterwards evaluation that is connected, screens, checks order of annealing of the big segment of plasmid that reclaims and the dna fragmentation (i.e. " BamHI-target sequence positive-sense strand-9bp loop encircle sequence-target sequence antisense strand-6 T-HindIII ") of shRNA target sequence, can obtain single-gene interference plasmid expression vector pSilencer-U6/H1-(shRNA)
1(shown in Figure 5).
By same procedure can prepare at different single-genes (as X, Y, Z ...) each corresponding shRNA plasmid expression vector of shRNA sequence.
(2) dual-gene shRNA expression vector pSilencer-U6/H1-(shRNA)
2Make up
With pSilencer-U6/H1-(shRNA)
1Cut back to close small pieces with the XbaI+PstI enzyme, cut another single-gene expression vector for preparing with above-mentioned same procedure with the SpeI+PstI enzyme again, and reclaim big segment, the sheet cracked ends of two recovery connects, transforms, screens, and can obtain dual-gene shRNA plasmid expression vector pSilencer-U6/H1-(shRNA)
2
Above shRNA expression vector pSilencer-U6/H1-(shRNA) n of (3) three genes makes up
With pSilencer-U6/H1-(shRNA)
2Cut back to close small pieces with the XbaI+PstI enzyme, cut carrier pSilencer-U6/H1-(shRNA) with the SpeI+PstI enzyme again
1And reclaiming big segment, the sheet cracked ends of two recovery connects, transforms, screens, and can obtain three gene shRNA plasmid expression vector pSilencer-U6/H1-(shRNA)
3
Similar approach can prepare shRNA plasmid expression vector pSilencer-U6/H1-(shRNA) n (Fig. 6) that contains more than three based on special gene sequence.These are connected on one and carry intravital shRNA transcription unit and can be different target genes, also can be same gene different loci or/and a plurality of same locis of same gene.
Can transcribe synthetic shRNA behind the pSilencer-U6/H1-of above-mentioned acquisition (shRNA) the n transfered cell respectively at each target gene, these shRNA are made of 19nt RNA positive-sense strand, 9nt inflection fragment (loop) and 19nt RNA antisense strand sequence, they can be processed into the siRNA at each target gene very soon in cell, and bring into play its special restraining effect to expression of target gene separately.
Can prepare negative control plasmid pSilencer-U6/H1-(shRNA) with same procedure
NegativeShRNA sequence in the control plasmid is analyzed not mRNA at any gene through Blast.
(4) each shRNA expression vector exactness is identified in order-checking
The polygene shRNA expression vector that builds is entrusted biotech firm's order-checking, primer be M13 ±, two-way sequencing result is correct, prove that structure finishes.
Embodiment 2: make up based on HIV polygene interferential shRNA plasmid expression vector pSilencer-U6/H1-HIV-(shRNA) n
1, pSilcencer-U6/H1-HIV-2MCS basis plamid vector construction
Method is pressed embodiment 1.
2, the selection of shRNA target sequence and design
The selection of HIV-1env, gag, pol, vif gene shRNA target sequence is mainly followed the Tushl principle and with reference to some other standard.Carry out the Blast retrieval behind the selected target sequence, make this target sequence and other gene not have homology.
After target sequence is determined, (see Thijn R.Brummelkamp, et al.Science, 2002,296:550-553) the shRNA template DNA of synthetic each target sequence according to rule.Each shRNA template DNA comprises justice, two complementary short dnas of antisense strand, and its fundamental unit is: the ring sequence of BamHI site, target sequence positive-sense strand, 9bp, target sequence antisense strand, 6 T, HindIII site.
(1)HIV-1env
1. said target mrna sequence (19nt):
5’-UCAGUUUAUGGGAUCAAAG-3’
2. shRNA template DNA sequence is:
5’-↓GATCCC
TCAGTTTATGGGATCAAAGTTCAAGAGA
CTTTGATCCCATAAACTGATTTTTTGGAAA-3’(Sense)
3’-GG
AGTCAAATACCCTAGTTTCAAGTTCTCT
GAAACTAGGGTATTTGACTAAAAAACCTTTTCGA↓-5’(Antisense)
(BamHI：G↓GATCC；HindIII：A↓AGCTT)
(2)HIV-1gag
1. said target mrna sequence (19nt):
5’-GAUUGUACUGAGAGACAGG-3’
2. shRNA template DNA sequence is:
5’-↓GATCCC
GATTGTACTGAGAGACAGGTTCAAGAGA
CCTGTCTCTCAGTACAATCTTTTTTGGAAA-3’(Sense)
3’-GG
CTAACATGACTCTCTGTCCAAGTTCTCT
GGACAGAGAGTCATGTTAGAAAAAACCTTTTCGA↓-5’(Antisense)
(BamHI：G↓GATCC；HindIII：A↓AGCTT)
(3)HIV-1pol
1. said target mrna sequence (19nt):
5’-AUGGACAGUACAGCCUAUA-3’
2. shRNA template DNA sequence is:
5’-↓GATCCC
ATGGACAGTACAGCCTATATTCAAGAGA
TATAGGCTGTACTGTCCATTTTTTTGGAAA-3’(Sense)
3’-GG
TACCTGTCATGTCGGATATAAGTTCTCT
ATATCCGACATGACAGGTAAAAAAACCTTTTCGA?↓-5’(Antisense)
(BamHI：G↓GATCC：HindIII：A↓AGCTT)
(4)HIV-1vif
1. said target mrna sequence (19nt):
5’-GUUCAGAAGUACACAUCCC-3’
2. shRNA template DNA sequence is:
5’-↓GATCCC
GTTCAGAAGTACACATCCCTTCAAGAGA
GGGATGTGTACTTCTGAACTTTTTTGGAAA-3’(Sense)
3’-GG
CAAGTCTTCATGTGTAGGGAAGTTCTCT
CCCTACACATGAAGACTTGAAAAAACCTTTTCGA?↓-5’(Antisense)
(BamHI：G↓GATCC；HindIII：A↓AGCTT)
(5) its shRNA sequence of negative (negative control) is not at the mRNA of any specific gene.
Above-mentioned sequence send biotech company synthetic.Line part is dna sequence dna or its complementary sequence of respective target mRNA sequence in the sequence, is transcribed into the double-stranded part that can form bobby pin RNA (shRNA) behind the RNA herein.
3, the structure (n=1,2,3 of HIV polygene interferential shRNA plasmid expression vector pSilencer-U6/H1-HIV-(shRNA) n ...)
(1) HIV single-gene interferential shRNA plasmid expression vector pSilencer-U6/H1-HIV-(shRNA)
1Make up
5 ' end of the double-stranded DNA that synthetic fragment annealing back forms has the sticky end of BamHI restriction enzyme site, 3 ' end has the sticky end of HindIII restriction enzyme site, can be directly used in promotor (U6 or the H1) downstream that is connected to the pSilcencer-U6/H1-HIV-2MCS carrier is carrier.Be operating as: plasmid pSilcencer-U6/H1-HIV-2MCS with restriction endonuclease BamHI and HindIII double digestion, is reclaimed big segment.With the short double-stranded DNA of the formation afterwards evaluation that is connected, screens, checks order of annealing of the big segment of plasmid that reclaims and the dna fragmentation (i.e. " BamHI-target sequence positive-sense strand-9bploop encircle sequence-target sequence antisense strand-6 T-HindIII ") of shRNA target sequence, can obtain at HIV-1env, gag, pol, vif single-gene interferential shRNA plasmid expression vector pSilencerU6/H1-HIV-(shRNA)
1
With env is the shRNA plasmid expression vector called after pSilencer-U6/H1-HIV-(shRNA) of target spot
1 EnvWith gag is the shRNA plasmid expression vector called after pSilencer-U6/H1-HIV-(shRNA) of target spot
1 GagWith pol is the shRNA plasmid expression vector called after pSilencer-U6/H1-HIV-(shRNA) of target spot
1 PolWith vif is the shRNA plasmid expression vector called after pSilencer-U6/H1-HIV-(shRNA) of target spot
1 Vif
Same procedure can prepare the negative control plasmid, called after pSilencer-U6/H1-HIV-(shRNA)
1 Negative, shRNA sequence is wherein analyzed not mRNA at any gene through Blast.
(2) the dual-gene interferential shRNA of HIV plasmid expression vector pSilencer-U6/H1-HIV-(shRNA)
2Make up
With pSilencerU6/H1-HIV-(shRNA)
1Cut back to close small pieces with the XbaI+PstI enzyme, cut another single-gene shRNA plasmid expression vector for preparing with above-mentioned same procedure with the SpeI+PstI enzyme again, and reclaim big segment, the sheet cracked ends of two recovery connects, transforms, screens, and can obtain dual-gene interferential shRNA plasmid expression vector pSilencer-U6/H1-HIV-(shRNA)
2
Each dual-gene shRNA plasmid expression vector name is as follows: with env+gag is the shRNA plasmid expression vector called after pSilencer-U6/H1-HIV-(shRNA) of target spot
2 Env+gagWith env+pol is the shRNA plasmid expression vector called after pSilencer-U6/H1-HIV-(shRNA) of target spot
2 Env+polWith env+vif is the shRNA plasmid expression vector called after pSilencer-U6/H1-HIV-(shRNA) of target spot
2 Env+vifWith gag+pol is the shRNA plasmid expression vector called after pSilencer-U6/H1-HIV-(shRNA) of target spot
2 Gag+polWith gag+vif is the shRNA plasmid expression vector called after pSilencer-U6/H1-HIV-(shRNA) of target spot
2 Gag+vifWith pol+vif is the shRNA plasmid expression vector called after pSilencer-U6/H1-HIV-(shRNA) of target spot
2 Pol+vifWith identical target-gene sequence is the shRNA plasmid expression vector difference called after pSilencer-U6/H1-HIV-(shRNA) of target spot
2 2env, pSilencer-U6/H1-HIV-(shRNA)
2 2gag, pSilencer-U6/H1-HIV-(shRNA)
2 2pol, pSilencer-U6/H1-HIV-(shRNA)
2 2vif
Same procedure can prepare based on dual-gene interferential negative control plasmid, called after pSilencer-U6/H1-HIV-(shRNA)
2 2negative, the shRNA sequence on it is analyzed not mRNA at any gene through Blast.
(3) the above shRNA plasmid expression vector of HIV three genes pSilencer-U6/H1-HIV-(shRNA) n makes up
With pSilencer-U6/H1-HIV-(shRNA)
2Cut back to close small pieces with the XbaI+PstI enzyme, cut carrier pSilencer-U6/H1-HIV-(shRNA) with the SpeI+PstI enzyme again
1And reclaiming big segment, the sheet cracked ends of two recovery connects, transforms, screens, and can obtain HIV three gene interferential shRNA plasmid expression vector pSilencer-U6/H1-HIV-(shRNA)
3
Similar approach can prepare the above shRNA plasmid expression vector of three genes pSilencer-U6/H1-HIV-(shRNA) n.These are connected on one and carry intravital shRNA transcription unit and can be different target genes, also can be same gene different loci or/and a plurality of same locis of same gene.
The name of each above shRNA plasmid expression vector of three genes (comprising its negative control carrier) is the same.ShRNA sequence in the control plasmid is analyzed not mRNA at any gene through Blast.
(4) each shRNA expression vector exactness is identified in order-checking
The plasmid expression vector that builds is entrusted biotech company's order-checking, primer be M13 ±, two-way sequencing result is correct, prove that structure finishes.Can transcribe synthetic shRNA behind the pSilencer-U6/H1-HIV-of above-mentioned acquisition (shRNA) the n transfered cell respectively at HIV-1env, gag, pol, vif gene, these shRNA are made of 19nt RNA positive-sense strand, 9nt inflection fragment (loop) and 19nt RNA antisense strand sequence, they can be processed into the siRNA at HIV-1env, gag, pol, vif gene very soon in cell, and bring into play the special restraining effect that corresponding target genes is expressed separately.
The application of embodiment 3:HIV polygene interferential shRNA plasmid expression vector in preparation treating AIDS medicine
ShRNA plasmid expression vector pSilencer-U6/H1-HIV-(shRNA) the n transformed into escherichia coli of above-mentioned structure, utilize intestinal bacteria to carry out high density fermentation (in the fermentor tank), centrifugal collection thalline, plasmid extracting method extracting and purifying pSilencer-U6/H1-HIV-(shRNA) n plasmid is measured OD routinely
260Plasmid concentration, the product exactness is identified in order-checking.Get pure product plasmid and be mixed with injection or make oral capsule, can be used for the treatment of HIV patient and aids patient.Plasmid expression vector can be transcribed synthetic corresponding shRNA at HIV-1env, gag, pol, vif gene respectively in body cell, these shRNA can be processed into a plurality of corresponding siRNA very soon and bring into play its mRNA degraded to the HIV corresponding target genes simultaneously in cell, thereby suppress many genetic expressions of HIV, kill hiv virus.
Claims (7)
1. carrier pSilencer-U6/H1-(shRNA) n who can be used for expressing simultaneously a plurality of shRNA, form by two groups of multiple clone site sequences (MCS), a plurality of shRNA transcription unit and plasmid sequence, the a plurality of shRNA transcription unit of can connecting between two groups of multiple clone site sequences, a plurality of shRNA transcription unit can be used for repeatedly expressing a target gene, or express a plurality of different loci of a target gene, or express different target genes, it is characterized in that: two groups of multiple clone site sequences of described carrier are:
MCS
1(21bp altogether): 5 '-AATTGGTACCTCTAGATATCG-3 '
3’-CCATGGAGATCTATAGCTTAA-5’；
MCS
2(20bp altogether): 5 '-AGCTTACTAGTGATATCTGC-3 '
3’-ATGATCACTATAGACGTCGA-5’。
2. the described carrier pSilencer-U6/H1-of claim 1 (shRNA) n is characterized in that: each shRNA transcription unit of described carrier comprise a mammalian promoter U6 or H1 and be connected promotor U6 or H1 after target gene shRNA encoding sequence.
3. the shRNA transcription unit of claim 1 or 2 described carriers is characterized in that: the target gene shRNA encoding sequence that is positioned at after promotor U6 of transcription unit or the H1 is as follows:
(1) be any disease gene target sequence, the sequential structure general formula is:
5’-↓GATCCC
NNNNNNNNNNNNNNNNNNNTTCAAGAGA
NNNNNNNNNNNNNNNNNNNTTTTTTGGAAA-3(Sense)
3’-GG
NNNNNNNNNNNNNNNNNNNAAGTTCTCT
NNNNNNNNNNNNNNNNNNNAAAAAACCTTTTCGA↓-5’(Antisense)
(BamHI：G↓GATCC；HindIII：A↓AGCTT)
Wherein the N of line part is any in A, T, four kinds of bases of C, G, the base reverse complemental of positive-sense strand (Sense) and antisense strand (Antisense);
(2) comprising:
①HIV-1?env
5’-↓GATCCC
TCAGTTTATGGGATCAAAGTTCAAGAGA
CTTTGATCCCATAAACTGATTTTTTGGAAA-3’(Sense)
3’-GG
AGTCAAATACCCTAGTTTCAAGTTCTCT
GAAACTAGGGTATTTGACTAAAAAACCTTTTCGA↓-5’(Antisense)
(BamHI：G↓GATCC；HindIII：A↓AGCTT)
②HIV-1?gag
5’-↓?GATCCC
GATTGTACTGAGAGACAGGTTCAAGAGA
CCTGTCTCTCAGTACAATCTTTTTTGGAAA-3’(Sense)
3’-GG
CTAACATGACTCTCTGTCCAAGTTCTCT
GGACAGAGAGTCATGTTAGAAAAAACCTTTTCGA↓-5’(Antisense)
(BamHI：G↓GATCC；HindIII：A↓AGCTT)
③HIV-1?pol
5’-↓GATCCC
ATGGACAGTACAGCCTATATTCAAGAGA
TATAGGCTGTACTGTCCATTTTTTTGGAAA-3’(Sense)
3’-GG
TACCTGTCATGTCGGATATAAGTTCTCT
ATATCCGACATGACAGGTAAAAAAACCTTTTCGA↓-5’(Antisense)
(BamHI：G↓GATCC；HindIII：A↓AGCTT)
④HIV-1?vif
5’-↓?GATCCC
GTTCAGAAGTACACATCCCTTCAAGAGA
GGGATGTGTACTTCTGAACTTTTTTGGAAA-3’(Sense)
3’-GG
CAAGTCTTCATGTGTAGGGAAGTTCTCT
CCCTACACATGAAGACTTGAAAAAACCTTTTCGA?↓-5’(Antisense)
(BamHI：G↓GATCC；HindIII：A↓AGCTT)
。
4. the described carrier pSilencer-U6/H1-of claim 1 (shRNA) n, it is characterized in that: described carrier is the plasmid vector of any kind.
5. construction of carrier that can be used for expressing simultaneously a plurality of shRNA, it is characterized in that: in the design of shRNA transcription unit both sides and introduce two groups of multiple clone site sequences (MCS), thereby two groups of multiple clone site sequences and shRNA transcription unit, plasmid sequence are made up in order construct the carrier is carrier pSilencer-U6/H1-2MCS that can between two groups of multiple clone site sequences, be connected in series a plurality of shRNA transcription unit; Afterwards, thus utilize a restriction enzyme site of the isocaudarner restriction enzyme site be arranged in the multiple clone site before and after the carrier is carrier shRNA transcription unit and multiple clone site to carry out the combination of a plurality of shRNA transcription unit and construct carrier pSilencer-U6/H1-(shRNA) n that can express a plurality of shRNA simultaneously.
6. the application of carrier in preparation disease gene medicine that can be used for expressing simultaneously a plurality of shRNA.
7. the application of multiple clone site sequence in making up any shRNA expression vector according to claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2007100484739A CN101245352A (en) | 2007-02-13 | 2007-02-13 | Polygene interferential shRNA plasmid expression vector, construction method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2007100484739A CN101245352A (en) | 2007-02-13 | 2007-02-13 | Polygene interferential shRNA plasmid expression vector, construction method and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101245352A true CN101245352A (en) | 2008-08-20 |
Family
ID=39946032
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2007100484739A Pending CN101245352A (en) | 2007-02-13 | 2007-02-13 | Polygene interferential shRNA plasmid expression vector, construction method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101245352A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102492722A (en) * | 2011-12-06 | 2012-06-13 | 广西大学 | Mammary gland-specific expression buffalo prolactin (PRL) gene vector, construction method and application thereof |
| CN105002179A (en) * | 2015-07-14 | 2015-10-28 | 中国农业科学院哈尔滨兽医研究所 | shRNA transgenic recombinant plasmid for inhibiting swine influenza viruses and use thereof |
| CN105518136A (en) * | 2013-07-10 | 2016-04-20 | 巴斯夫欧洲公司 | RNAI for the control of phytopathogenic fungi and oomycetes by inhibiting the expression of CYP51 genes |
| CN111518807A (en) * | 2020-04-30 | 2020-08-11 | 深圳大学 | Oligonucleotide chain for inhibiting expression of mikania micrantha light capture protein, recombinant vector and construction method |
| CN114606196A (en) * | 2020-12-04 | 2022-06-10 | 南京大学 | Cell therapy for siRNA expression and in vivo delivery |
-
2007
- 2007-02-13 CN CNA2007100484739A patent/CN101245352A/en active Pending
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102492722A (en) * | 2011-12-06 | 2012-06-13 | 广西大学 | Mammary gland-specific expression buffalo prolactin (PRL) gene vector, construction method and application thereof |
| CN102492722B (en) * | 2011-12-06 | 2014-09-10 | 广西大学 | Mammary gland-specific expression buffalo prolactin (PRL) gene vector, construction method and application thereof |
| CN105518136A (en) * | 2013-07-10 | 2016-04-20 | 巴斯夫欧洲公司 | RNAI for the control of phytopathogenic fungi and oomycetes by inhibiting the expression of CYP51 genes |
| CN105002179A (en) * | 2015-07-14 | 2015-10-28 | 中国农业科学院哈尔滨兽医研究所 | shRNA transgenic recombinant plasmid for inhibiting swine influenza viruses and use thereof |
| CN105002179B (en) * | 2015-07-14 | 2018-07-06 | 中国农业科学院哈尔滨兽医研究所 | It can inhibit shRNA transgenosis recombinant plasmid and its application of swine influenza virus |
| CN111518807A (en) * | 2020-04-30 | 2020-08-11 | 深圳大学 | Oligonucleotide chain for inhibiting expression of mikania micrantha light capture protein, recombinant vector and construction method |
| CN114606196A (en) * | 2020-12-04 | 2022-06-10 | 南京大学 | Cell therapy for siRNA expression and in vivo delivery |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6865169B2 (en) | RNA Interfering Agent for P21 Gene Regulation | |
| EP2585595B1 (en) | Rna molecules and uses thereof | |
| US9953131B2 (en) | Multi-targeting short interfering RNAs | |
| Wang et al. | A Web-based design center for vector-based siRNA and siRNA cassette | |
| US20190300882A1 (en) | Methods of treating neuroblastoma and reagents therefor | |
| Shang et al. | Ribozyme-enhanced single-stranded Ago2-processed interfering RNA triggers efficient gene silencing with fewer off-target effects | |
| CN101245352A (en) | Polygene interferential shRNA plasmid expression vector, construction method and application | |
| US20220298507A1 (en) | Compositions and methods for rna interference | |
| Dykxhoorn | RNA interference as an anticancer therapy: a patent perspective | |
| CN100357436C (en) | SiRNA for inhibiting Stat3 gene expression and preparation thereof | |
| Munir et al. | Computational design of small interfering RNAs and small hairpin RNAs to silence mutated P53 gene expressions | |
| CN104031916A (en) | Novel RNAi precursor, and preparation and application thereof | |
| CN102433352B (en) | MicroRNA structure-based construction method and function verification of hepatic cell selective multi-target interfering plasmid vector | |
| WO2018018077A1 (en) | Methods of treating breast cancer and reagents therefor | |
| CN108245527A (en) | Pass through the method and drug of miR-1181 progress anticancers and its application | |
| Opalinska et al. | Nucleic Acid Therapeutics for Hematologic Malignancies—Theoretical Considerations | |
| CN106636084A (en) | Novel shRNA expression vector, preparation and applications thereof | |
| CN112226435A (en) | Nucleotide sequence for reducing uricase gene expression and application thereof | |
| US20120065246A1 (en) | Rna molecules and therapeutic uses thereof | |
| Xia et al. | Effective siRNA targets screening for human telomerase reverse transcriptase | |
| US11312958B2 (en) | Components and methods for producing toxic RNAs in eukaryotic cells | |
| Karpilow et al. | siRNA: enhanced functionality through rational design and chemical modification | |
| US9777277B2 (en) | Organic small hairpin RNAs | |
| CN117645998A (en) | ArRNA and application thereof | |
| Liu et al. | Silencing effect of shRNA expression vectors with stem length of 21, 27 or 29 bp |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20080820 |