CN102492675A - Construction and expression of AusMan5A-TviCBM fusion enzyme gene - Google Patents
Construction and expression of AusMan5A-TviCBM fusion enzyme gene Download PDFInfo
- Publication number
- CN102492675A CN102492675A CN2011104104345A CN201110410434A CN102492675A CN 102492675 A CN102492675 A CN 102492675A CN 2011104104345 A CN2011104104345 A CN 2011104104345A CN 201110410434 A CN201110410434 A CN 201110410434A CN 102492675 A CN102492675 A CN 102492675A
- Authority
- CN
- China
- Prior art keywords
- cbm
- man5a
- enzyme
- merged
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a method for designing and constructing AusMan5A-TviCBM fusion enzyme gene, wherein the AusMan5A-TviCBM fusion enzyme is strong in substrate affinity and high in catalyzing efficiency. The nucleotide sequence of the AusMan5A-TviCBM fusion enzyme is SEQ ID NO.1, the amino acid sequence thereof is SEQ ID NO.2, and corresponding genes thereof are named man5A-cbm. The invention further discloses a construction and a high-efficient expression and purifying method of engineering bacteria of fusion enzyme. The prepared fusion enzyme has the characteristics of strong substrate affinity and high catalyzing efficiency and has greater industrialized production protentials and economic values.
Description
Technical field
The present invention relates to genetically engineered and field of protein expression, relate in particular to structure and expression that AusMan5A-TviCBM merges the enzyme gene, and the research of the character of this enzyme and application.
Background technology
'beta '-mannase (β-1; 4-D-mannan mannohydrolase; EC 3.2.1.78) is a kind of β-1 that can degrade from the inside of homogeneous mannosans and different mannosans main chain; The lytic enzyme of 4-seminose glycosidic bond belongs to the semicellulose enzyme, and it is present in mikrobe, the plant and animal widely.It can be widely used in fields such as food, medicine, feed, papermaking, printing and dyeing and petroleum industry.In the food and medicine field; 'beta '-mannase can produce functional oligose after acting on mannosans; This oligose can reduce blood sugar for human body and cholesterol levels effectively and help the growth of beneficial flora in the humans and animals enteron aisle, so regulate humans and animals immunity system, improve immunizing power.In fodder industry, it eliminates ANFs as the effective mannosans composition in the degrading plant cell walls of fodder additives, improves capacity usage ratio, improves feed conversion rate.In paper industry, the collaborative use of semicelluloses such as 'beta '-mannase and beta-xylanase degraded enzyme, pulp treatment can obviously be improved papery.'beta '-mannase is used in the bleaching process of textile printing and dyeing, can remove adherent excess dyestuff on the product effectively, more can reduce the consumption of chlorine and alkali and the problem of environmental pollution that they bring, help the protection of ecotope.The mikrobe of having reported at present that can produce 'beta '-mannase mainly comes from bacterium, fungi and actinomycetes, the subtilis in the bacterium for example, and the aspergillus in the fungi, wood are mould, mould, yeast, and the streptomycete in the actinomycetes etc.At present, more about the report of the 5th family's 'beta '-mannase, their optimum pH is 3.0～7.5, and optimum temperuture is at 45～92 ℃.
In recent years; Along with to the elimination of mannosans ANFs and the discovery of mannooligo saccharide physiological function in the exploitation of occurring in nature semicellulose resource, the diet; The demand of 'beta '-mannase is increasing, causes the research and development of 'beta '-mannase is got into a new upsurge.But just domestic and international pertinent literature or patent report, mikrobe 'beta '-mannase fermenting enzyme activity is generally not high, has caused production cost very high, thereby has hindered the widespread use of this enzyme in various fields.For fermentation production rate and the enzymic activity that improves 'beta '-mannase, early stage research work mainly concentrates on screening, mutagenesis, the product enzyme induction of zymogenic bacteria kind, the separation and purification of enzyme and character, aspects such as enzymic hydrolysis substrate mode and application.Get into the nineties, along with the widespread use of genetic engineering technique and protein engineering, research work progressively turns to the clone of enzyme gene and the aspects such as research of expression and enzyme active sites.At present, though more existing about the clone of beta-mannase gene and the document and the patent report of expression, the molecular modification of relevant mannase based on design and rational does not especially see that about the research of chimaeric enzyme gene design and expression report is arranged.
Summary of the invention
The purpose of this invention is to provide the AusMan5A-TviCBM that a kind of substrate avidity is strong, catalytic efficiency (is high and merge the design of enzyme and the method for structure, original Aspergillus usamii Man5A has been carried out molecular modification.
Technical scheme of the present invention: the glucide binding domains (CBM) of the 'beta '-mannase of original Aspergillus usamii Man5A and T.viride WL 0422 is merged; Construct AusMan5A-TviCBM and merge enzyme; The nucleotides sequence that merges enzyme is classified SEQ ID NO:1 as, and correspondingly unnamed gene is man5A-cbm.
The recombinant plasmid pUCm-T-man5A that carries Aspergillus usamii Aus Man5A gene has by Southern Yangtze University's structure and preservation (number of patent application: 201010550927.4).
T.viride WL 0422 bacterial strain is by Southern Yangtze University screening and preservation, and this bacterial strain is open at the No.1 Pg.1 of " Jiangsu food and fermentation " magazine in 2006, and the inventor promises to undertake that this bacterial strain provided to the public in 20 years.
The aminoacid sequence of described chimaeric enzyme is SEQ ID NO:2.
The activity determination method of described chimaeric enzyme:
In 25mL tool plug test tube A and B, each mass concentration that adds use pH 4.8, acetate-sodium acetate buffer preparation is 0.5% carob bean gum solution 2.4mL, and 50 ℃ of preheating 10min add the enzyme liquid that 0.1mL suitably dilutes, 50 ℃ of accurate response 10min in the A pipe; Respectively add 2.5mL 3 ' immediately, 5 '-dinitrosalicylic acid (DNS) reagent, in the B pipe, add 0.1mL enzyme liquid again, A and B pipe all boil 7min; Respectively add deionized water 5mL after the cooling, shake up; 540nm sentences the B pipe and measures A pipe absorbance for blank, and finds corresponding reducing sugar (in seminose) content and be converted to unit of enzyme activity from the seminose typical curve.Unit of enzyme activity's definition: under this condition determination, produce the required enzyme amount of 1 μ mol reducing sugar with PM and be defined as 1 beta-mannase unit of enzyme activity (IU).
The structure of described chimaeric enzyme gene and the method for expression:
(1) foundation of CBM DB: according to the information of including among the Carbohydrate-Active enZYmes Database (http://www.cazy.org/); Choose CBM1 (mainly being cellulose binding domain) member and set up a CBM DB, and include ground relevant document with the Km value.
(2) docking and molecular dynamics simulation of CBM and substrate: choose representational several CBM and carry out molecular docking with substrate with AutoDock4.2 is soft respectively; Carry out molecular dynamics simulation with GROMACS then, the CBM that finally chooses the viride mannase is fused to the carboxyl terminal of Aus Man5A.
(3) chimaeric enzyme Aus Man5A-CBM gene is synthetic: based on the chimaeric enzyme gene order of top design, adopt overlapping pcr that the gene order of Aus Man5A and the nucleotide sequence of CBM are merged.Two pairs of primers that overlapping PCR relates to are respectively:
AMan5A-F:GAATTCTCCTTCGCCAGCACCTC, the upstream primer of the gene fragment of Aspergillus usamii Aus Man5A to be merged;
AMan5A-R:TTGTACCGCCGGCACTATCAATAGCAGCAA, the downstream primer of the gene fragment of Aspergillus usamii Aus Man5A to be merged;
Tman5A-F1:TGATAGTGCCGGCGGTACAACCACTCC, the upstream primer of CBM gene fragment to be merged;
Tman5A-R:GCGGCCGCTCATGTATTCAGGCATTGCG, the downstream primer of CBM gene fragment to be merged;
PCR synthesizes upstream and downstream fragment to be merged respectively earlier, and the PCR product reclaims the purpose band with 1% agarose gel electrophoresis analysis and rubber tapping.Respectively get then 2ul upstream and downstream fragment each other primer and template carry out the preliminary synthetic of chimaeric enzyme gene, add a large amount of amplifications that AMan5A-F and Tman5A-R primer carry out the chimaeric enzyme gene at last.With 1% agarose gel electrophoresis analysis, rubber tapping is reclaimed the purpose band and is connected (pUCm-T-man5A-cbm) with pUCm-T, transforms JM109, after enzyme is cut evaluation correctly, serves the Hai Shenggong order-checking with the PCR product.
PUCm-T-man5A-cbm that sequencing result is correct and pPIC9K plasmid all carry out double digestion with EcoR I and Not I; The enzyme that rubber tapping is reclaimed is cut product and under the effect of T4 dna ligase, is connected; Obtain recombinant plasmid pPIC9K-man5A-cbm (Fig. 1), and recombinant plasmid is carried out sequencing.
(4) structure of GS115/man5A-cbm, expression, product purification and determination of activity: pPIC9K-man5A-cbm is carried out linearizing with Sal I; Carrying out electricity according to the Pichia anomala expression handbook changes, screens, and obtains the pichia spp recon GS115/man5A-cbm of high copy; Carry out abduction delivering according to the normal process on the handbook, measure the mannosans enzymic activity of chimaeric enzyme with the DNS method; Fermented liquid obtains electrophoretically pure chimaeric enzyme through frozen centrifugation, ultrafiltration, ion exchange chromatography and gel permeation chromatography.
(5) mensuration of chimaeric enzyme kinetic constant: (1～10mg/mL) measures hydrolysis reaction according to the condition of enzyme activity determination, calculates K with the method for double-reciprocal plot then to get the carob bean gum of different concns respectively
mAnd V
Max
Beneficial effect of the present invention: the invention provides a kind of design of Aspergillus usamii Aus Man5A-CBM chimaeric enzyme and the method for structure, the structure of novel chimaeric enzyme engineering bacteria GS115/man5A-cbm is with the method with purifying that efficiently expresses of its chimaeric enzyme.Chimaeric enzyme has the advantage that substrate avidity is strong, catalytic efficiency (is high, and bigger suitability for industrialized production, application potential and economic worth are arranged, and has also established theoretical basis for the research of other 'beta '-mannase.
Description of drawings
Fig. 1: the structure synoptic diagram of recombinant plasmid pPIC9K-man5A-cbm
Embodiment
Below in conjunction with specific embodiment, further set forth working method of the present invention.But these embodiment only are used to specify the present invention, and are not used in restriction scope of the present invention.
The structure of embodiment 1 chimaeric enzyme gene and expression plasmid thereof
Adopt overlapping pcr structure fusion gene man5A-cbm, mainly be divided into for four steps: with AMan5A-F and AMan5A-R is that primer carries out first round PCR (94 ℃ of 4min; 30 circulations, 94 ℃ of 30s, 53 ℃ of 30s, 72 ℃ of 1min; 72 ℃ of 10min) gene fragment of Aspergillus usamii Aus Man5A synthetic to be merged; With Tman5A-F1 and Tman5A-R is that primer carries out second and takes turns PCR (94 ℃ of 4min; 30 circulations, 94 ℃ of 30s, 53 ℃ of 30s, 72 ℃ of 1min; 72 ℃ of 10min) gene fragment of CBM synthetic to be merged; With 1% agarose gel electrophoresis analysis, the purpose band is reclaimed in rubber tapping with two-wheeled PCR product, and mixing behind the purifying carries out third round PCR (94 ℃ of 4min under the condition of no primer respectively; 10 circulations, 94 ℃ of 30s, 52 ℃ of 30s, 72 ℃ of 70s; 72 ℃ of 10min); With third round PCR reaction solution is template, is that primer carries out four-wheel PCR (94 ℃ of 4min with AMan5A-F and Tman5A-R; 30 circulations, 94 ℃ of 30s, 53 ℃ of 30s, 72 ℃ of 70s; 72 ℃ of 10min).With 1% agarose gel electrophoresis analysis, rubber tapping is reclaimed the purpose band and is connected (pUCm-T-man5A-cbm) with pUCm-T, transforms JM109, after enzyme is cut evaluation correctly, serves the Hai Shenggong order-checking with four-wheel PCR product.Correct pUCm-T-man5A-cbm and the pPIC9K plasmid of order-checking all carried out double digestion with EcoR I and Not I; The enzyme that reclaims is cut product and under the effect of T4DNA ligase enzyme, is connected; Obtain recombinant plasmid pPIC9K-man5A-cbm, and recombinant expression plasmid is carried out sequencing.
Structure, expression, product purification and the determination of activity of embodiment 2 GS115/man5A-cbm
With Sal I pPIC9K-man5A-cbm is carried out linearizing, carry out electricity according to the Pichia anomala expression handbook and transform, screen, obtain the pichia spp recon GS115/man5A-cbm of high copy.This genetic engineering bacterium is expressed 96h with 1.0% methanol induction, adopts the DNS method to record that the mannosans enzymic activity reaches 65IU/mL in the fermented liquid.The supernatant of fermented liquid after centrifugal is the crude enzyme liquid of chimaeric enzyme; This crude enzyme liquid is 10 through molecular weight cut-off; The ultra-filtration membrane of 000Da concentrates; Through DEAE-Sepharose Fast Flow ion exchange chromatography and Sephadex G-75 gel permeation chromatography purifying, purifying is single band after SDS-PAGE detects again.
Claims (2)
1. the AusMan5A-TviCBM that substrate avidity is strong, catalytic efficiency (is high merges enzyme, and its Nucleotide and aminoacid sequence are respectively SEQ ID NO:1 and SEQ ID NO:2.
2. the structure of chimaeric enzyme engineering bacteria and expression method:
(1) foundation of CBM DB: according to the information of including among the Carbohydrate-Active enZYmes Database (http://www.cazy.org/); Choose CBM1 (mainly being cellulose binding domain) member and set up a CBM DB, and include the document relevant with the Km value;
(2) docking and molecular dynamics simulation of CBM and substrate: choose representational several CBM and carry out molecular docking with substrate with AutoDock4.2 is soft respectively; Carry out molecular dynamics simulation with GROMACS then, the CBM that finally chooses the viride mannase is fused to the carboxyl terminal of Aus Man5A;
(3) structure of chimaeric enzyme gene and expression plasmid thereof:, adopt overlapping pcr that the gene order of Aus Man5A and the nucleotide sequence of CBM are merged based on the chimaeric enzyme gene order of top design.Two pairs of primers that overlapping PCR relates to are respectively:
AMan5A-F:GAATTCTCCTTCGCCAGCACCTC, the upstream primer of the gene fragment of Aspergillus usamii Aus Man5A to be merged;
AMan5A-R:TTGTACCGCCGGCACTATCAATAGCAGCAA, the downstream primer of the gene fragment of Aspergillus usamii Aus Man5A to be merged;
Tman5A-F1:TGATAGTGCCGGCGGTACAACCACTCC, the upstream primer of CBM gene fragment to be merged;
Tman5A-R:GCGGCCGCTCATGTATTCAGGCATTGCG, the downstream primer of CBM gene fragment to be merged;
Adopt overlapping pcr structure fusion gene man5A-cbm, mainly be divided into for four steps: with AMan5A-F and AMan5A-R is that primer carries out first round PCR (94 ℃ of 4min; 30 circulations, 94 ℃ of 30s, 53 ℃ of 30s, 72 ℃ of 1min; 72 ℃ of 10min) gene fragment of Aspergillus usamii Aus Man5A synthetic to be merged; With Tman5A-F1 and Tman5A-R is that primer carries out second and takes turns PCR (94 ℃ of 4min; 30 circulations, 94 ℃ of 30s, 53 ℃ of 30s, 72 ℃ of 1min; 72 ℃ of 10min) synthetic CBM gene fragment to be merged; With 1% agarose gel electrophoresis analysis, the purpose band is reclaimed in rubber tapping with two-wheeled PCR product, and mixing behind the purifying carries out third round PCR (94 ℃ of 4min under the condition of no primer respectively; 10 circulations, 94 ℃ of 30s, 52 ℃ of 30s, 72 ℃ of 70s; 72 ℃ of 10min); With third round PCR reaction solution is template, is that primer carries out four-wheel PCR (94 ℃ of 4min with AMan5A-F and Tman5A-R; 30 circulations, 94 ℃ of 30s, 53 ℃ of 30s, 72 ℃ of 70s; 72 ℃ of 10min).With 1% agarose gel electrophoresis analysis, rubber tapping is reclaimed the purpose band and is connected (pUCm-T-man5A-cbm) with pUCm-T, transforms JM109, after enzyme is cut evaluation correctly, serves the Hai Shenggong order-checking with four-wheel PCR product.Correct pUCm-T-man5A-cbm and the pPIC9K plasmid of order-checking all carried out double digestion with EcoR I and Not I; The enzyme that reclaims is cut product and under the effect of T4DNA ligase enzyme, is connected; Obtain recombinant plasmid pPIC9K-man5A-cbm, and recombinant expression plasmid is carried out sequencing;
(4) structure of GS115/man5A-cbm, expression, product purification and determination of activity: pPIC9K-man5A-cbm is carried out linearizing with Sal I; Carry out electricity according to the Pichia anomala expression handbook and transform, screen, obtain the pichia spp recon GS115/man5A-cbm of high copy; This genetic engineering bacterium is expressed 96h with 1.0% methanol induction, adopts the DNS method to record that the mannosans enzymic activity reaches 65IU/mL in the fermented liquid; The supernatant of fermented liquid after centrifugal is the crude enzyme liquid of chimaeric enzyme; This crude enzyme liquid is 10 through molecular weight cut-off; The ultra-filtration membrane of 000Da concentrates; Through DEAE-Sepharose Fast Flow ion exchange chromatography and Sephadex G-75 gel permeation chromatography purifying, purifying is single band after SDS-PAGE detects again.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011104104345A CN102492675A (en) | 2011-12-12 | 2011-12-12 | Construction and expression of AusMan5A-TviCBM fusion enzyme gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011104104345A CN102492675A (en) | 2011-12-12 | 2011-12-12 | Construction and expression of AusMan5A-TviCBM fusion enzyme gene |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102492675A true CN102492675A (en) | 2012-06-13 |
Family
ID=46184538
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2011104104345A Pending CN102492675A (en) | 2011-12-12 | 2011-12-12 | Construction and expression of AusMan5A-TviCBM fusion enzyme gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102492675A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111850019A (en) * | 2019-04-25 | 2020-10-30 | 新乡医学院 | Construction method of agarase fusion enzyme engineering strain |
-
2011
- 2011-12-12 CN CN2011104104345A patent/CN102492675A/en active Pending
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111850019A (en) * | 2019-04-25 | 2020-10-30 | 新乡医学院 | Construction method of agarase fusion enzyme engineering strain |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Sukumaran et al. | Cellulase production using biomass feed stock and its application in lignocellulose saccharification for bio-ethanol production | |
| Amore et al. | Potential of fungi as category I Consolidated BioProcessing organisms for cellulosic ethanol production | |
| CN102787130B (en) | Acid and high temperature resistant alpha-amylase, and its gene, engineering bacterium and preparation method | |
| CN104651383A (en) | Recombinant pichia pastoris engineering bacteria and production method thereof | |
| MX2014000665A (en) | Method for the production of cellulases by a filamentous fungus adapted to a fermenter having a low volumetric oxygen transfer coefficient kla. | |
| US11447761B2 (en) | Xylanase mutant and its preparation method and application | |
| CN102286443B (en) | Method for producing mixture of recombinant isoamylase, alpha-amylase and glucamylase | |
| CN103038340A (en) | Biofuel production | |
| CN104109660A (en) | Enzyme activity enhanced xylanase | |
| CN102260694B (en) | Acidproof medium-temperature alpha-amylase and preparation method thereof | |
| Valadares et al. | The secretome of two representative lignocellulose-decay basidiomycetes growing on sugarcane bagasse solid-state cultures | |
| CN103275883A (en) | Xylanase recombined and expressed engineering bacterium | |
| CN101748108B (en) | Acidophil Beta-glucanase GLU7A and gene and application thereof | |
| CN102226166A (en) | Gene engineering strain for efficiently expressing pullulanase and construction method thereof | |
| CN102392037A (en) | Cloning and expression of beta-1, 4-endo-mannanase (An Man5A) gene | |
| CN102392036A (en) | Cloning of beta-1,4-endomannase (Tvi Man5A) gene and preparation of recombinase | |
| CN102994476B (en) | Saccharifying enzyme | |
| CN102492675A (en) | Construction and expression of AusMan5A-TviCBM fusion enzyme gene | |
| CN106884030A (en) | The method for improving the fermentation yield of the fusion protein of containing cellulose binding domain | |
| CN102154343A (en) | Clone of novel beta-mannanase gene and preparation method of recombinase thereof | |
| CN102994530A (en) | Design and preparation for mannose with high substrate affinity | |
| Ng et al. | Cloning and expression of Cel8A from Klebsiella pneumoniae in Escherichia coli and comparison to cel gene of Cellulomonas uda | |
| CN104404015A (en) | Design and manufacturing method for Aus Man5A-CBM27 fusion enzyme | |
| CN103642776A (en) | Directed evolution method for improving heat resistance of aspergillus oryzae GH11 xylanase | |
| CN102127555A (en) | Cloning of beta-1,4-endo-glucanase gene and preparation of recombinase |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20120613 |