CN102465140B - Method for utilizing BGIos100 genes to boost growth of plant roots - Google Patents
Method for utilizing BGIos100 genes to boost growth of plant roots Download PDFInfo
- Publication number
- CN102465140B CN102465140B CN 201010539168 CN201010539168A CN102465140B CN 102465140 B CN102465140 B CN 102465140B CN 201010539168 CN201010539168 CN 201010539168 CN 201010539168 A CN201010539168 A CN 201010539168A CN 102465140 B CN102465140 B CN 102465140B
- Authority
- CN
- China
- Prior art keywords
- plant
- bgios100
- gene
- carrier
- root system
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Abstract
The invention relates to a method for utilizing BGIos100 genes to boost growth of plant roots and provides a method and application for utilizing the BGIos100 genes to boost the growth of the plant roots. The invention also provides a transgenic plant with introduced BGIos100 genes and a method for generating the transgenic plant.
Description
Invention field
The present invention relates to the method for the growth that promotes roots of plants.Especially, the present invention utilizes the BGIos100 gene to promote the growth of roots of plants.
Background of invention
Paddy rice is the important cash crop of China, and its plantation area is about 4.5 hundred million mu.Have approximately in the world 60% population with rice as daily staple food.Molecular breeding by paddy rice improves output, has brought huge income for the grain-production in the whole world.Breeding of the utilization of dwarf gene and the paddy rice that tillers makes the rice yield of China obtain huge leap forward more.But in the quite a long time, the situation that fluctuates has appearred in the rice yield of China.Thus, many breeding work persons have proposed new thinking and imagination from breeding theory and method, wish to make rice yield obtain new breakthrough.In the SOYBEAN IN HIGH-YIELD BREEDING of paddy rice in theory, the International Rice Research Institute has just proposed super hybridization rice theory based on novel strain type in early 1990s, yet, up to the present, in the breeding scientific research of paddy rice and practice, the improvement of the form of paddy rice underground part and physiological character is but failed to be able to particular embodiment in the molecular breeding in paddy rice.
The water and fertilizer utilization of China paddy rice is low at present, this not only causes the waste of a large amount of human and material resources and financial resources, and a large amount of chemical fertilizer and agricultural chemicals enter in rivers and lakes and the underground water by rainwash and soil permeability, and severe contamination is caused on the face of land and underground water.This has become an importance of environmental pollution.On the other hand, nearly half the paddy rice cultivated area in the whole world is in the state of lack of water, has had a strong impact on the raising of rice yield.The a lot of areas of China cause Rice Production to be difficult to development owing to lack irrigation water relatively, and this has influenced taking full advantage of of cultivated land resource to a certain extent.Therefore, improving the water and fertilizer utilization of paddy rice itself, develop water-saving paddy rice, is the another basic demand of new period sustainable agriculture development.And for the utilization rate of fertilizer that improves rice varieties itself, the relevant form of root system and the improvement of physiological character are most important.Along with further developing of environmental protection and agricultural, in economically developed area, solve paddy rice the root lodging easily takes place, improve water and fertilizer utilization and become a key issue that improves rice yield and development.From biology, mechanical mechanism and the hereditary basis thereof of anti-lodging of root system angle research paddy rice, for alleviating the harm that rice root lodges from cultivation and breeding angle, have huge reality and far-reaching significance.
Rice root is the vitals that absorb nutrient and moisture, also is the organ that some materials are synthetic and transport, and its morphological development attracts much attention very early to the influence of rice yield and quality.The breeding scholar mainly pays close attention to environment to the influence (Sun Chuanqing etc. of root growth and development, Scientia Agricultura Sinica .1995,28 (1): 42-48) and the mutual relationship (Ling Qihong etc. between the factors such as root system and output, Scientia Agricultura Sinica .1984, (4): 3-11), yet, but seldom report about the molecular breeding research of root system.The exploitation of expressing relevant molecule marker with root traits shows, the growth of control rice root be quantitative character (people such as Yadav, Theor Appl Genet.1997,94:619-632; Xu Jichen etc., Acta Genetica Sinica .2002,29 (3): 245-249), but this does not cause enough attention.(Scientia Agricultura Sinica .1997 such as Shi Qinghua, 30 (4): 61-67) studied the correlationship of root system development and over-ground part, and point out that cultivating the root type be conducive to mould ideotype in cultivation is the new demand of rice high yield cultivation, dark root system more is conducive to high yield.But it is that desirable rice root type proposes concrete clear and definite index that the breeding work person fails so far with regard to what.
At present, how locate the key that gene that rice root grows has become rice breeding from thinking and a kind of brand-new method of technical proposition.Correlative study shows that detecting the natural selection signal may be the road of a useful gene of brand-new, high-throughout evaluation.Because the time of artificial selection is short, the genetic recombination event is few, the gene of being selected and its adjacent domain meeting close linkage, therefore, if observing the polymorphism of a genome area distributes very special, have significance,statistical, the gene that contains of this zone namely might be relevant with the proterties of selecting with the mutational site so.Studies show that the zone of the full genome of paddy rice about 6% is the SNP hypervariable region, these zones may enrichments the gene relevant with important complicated economical character with the subspecies differentiation (people such as Tang, PLoS Genet.2006,2:e199).(BMC Evolutionary Biology.2008 such as Gao L Z, 8:11) by cultivated rice and common wild-rice are analyzed, set up theoretical population genetics mathematical model, detected 60 artificial selection that microsatellite locus is suffered, found some sites of leaving remarkable selection vestige with and neighbour's possible functional gene.But these researchs are from still remote from the gene of full genomic level multianalysis artificial selection, and this mainly is that model and method also have much room for improvement because data volume is nowhere near.The paddy rice character gene that identifies up to now such as qSH1, Rc, sh4, hd1 (people such as Kovach, Trends in Genetics.2007,23 (11): 578-587), and PROG1 (people such as Jin, Nature Genetics.2008,40 (11): 1365-1369) and GIF1 (people such as Wang, Nature Genetics.2008,40 (11): 1370-1374) remain and obtain by traditional map based cloning means.
The appearance of new-generation sequencing technology (as Solexa, Solid sequenator) is for Cheap highly effective ground obtains the rice root development gene and gene family provides unprecedented chance.Utilize the genome of wild-rice and cultivated rice resurvey order sequenced data and technology, the similarities and differences that can compare the genome structure of each cultivar and wild species, this makes the theory of using evolution genomics obtain the relevant gene of root system development with method or the genome functions element becomes possibility.
For a long time, the genetic improvement of rice root growth form, physiological character is failed to be embodied in the molecular breeding of paddy rice always.Though the root system of hybrid rice takes advantage in form and physiology than conventional variety, make breeding man see importance and the actual effect of root system improvement, fail to propose the concrete improvement index of a cover up to now.Therefore, need further research and development rice root development related gene, to the absorption of nutrition with to the utilization ratio of liquid manure, reduce using of agricultural chemicals with further raising root system, increase tillering and results etc. of over-ground part.
Along with the continuous maturation of rice molecular breeding theory and technology and perfect, and the foundation of genetic conversion system and optimization, utilize novel sequencing technologies to identify the genetic resources that is subjected to artificial selection in conjunction with the genomics method, make utilize genome to resurvey the order technology is excavated the root system development genes involved and genetic transformation becomes possibility.The improvement that the paddy rice underground part is grown will further improve output, quality and the resistance etc. of paddy rice.The exploitation of rice root development related gene and genetic transformation drop into, alleviate environmental pollution, realize that agricultural sustainable development has great importance that for the output that improves the paddy rice over-ground part, reduction agricultural it is conducive to strengthen China's agricultural competitive power in the world.
Summary of the invention
The present invention confirms that by experiment gene BGIos100 (its sequence can be SEQ ID NO:7) has the function that promotes plant root growth.
Therefore, in one aspect, the invention provides the carrier that contains gene BGIos100.In one embodiment, described carrier is expression vector preferably, is more preferably the carrier that efficiently expresses gene BGIos100 in plant, for example comprises the recombinant vectors p6 of gene BGIos100, as recombinant vectors p6+BGIos100 of the present invention.
In yet another aspect, the invention provides the host cell that contains gene BGIos100 or support according to the present invention.In one embodiment, described host cell is agrobacterium tumefaciens preferably, for example agrobacterium tumefaciens EHA105-p6+BGIos100.
In yet another aspect, the invention provides that gene BGIos100 and/or support according to the present invention and/or host cell be used for to promote plant root growth or for the preparation of transgenic plant or be used for the purposes of plant breeding.In one embodiment, described transgenic plant are not compared with carrying out genetically modified plant, show better plant root growth.
In yet another aspect, the invention provides the method that promotes plant root growth, it comprises gene BGIos100 and/or support according to the present invention is transformed into plant, or uses according to host cell infected plant of the present invention.
In one embodiment, by means commonly known in the art, for example the agrobacterium tumefaciens conversion method is transformed into plant with gene BGIos100 or support according to the present invention.
In one embodiment, gene BGIos100 may be operably coupled to effectively expressing controlling element in plant, for example promotor and/or terminator, preferably corn ubiquitin promoter and/or NOS terminator.
In yet another aspect, the invention provides the method that produces transgenic plant, said method comprising the steps of:
1) gene BGIos100 and/or support according to the present invention are transformed into plant callus, or use according to host cell infected plant callus of the present invention;
2) from described callus regeneration transgenic plant.
In one embodiment, do not compare with carrying out genetically modified plant by the transgenic plant that aforesaid method produces, show better plant root growth, for example the root system shallow-layer of transgenic plant distributes and is denseer.
In one embodiment, by means commonly known in the art, for example the agrobacterium tumefaciens conversion method is transformed into plant callus with gene BGIos100 and/or support according to the present invention.
In one embodiment, gene BGIos100 may be operably coupled to effectively expressing controlling element in plant, for example promotor and/or terminator, preferably corn ubiquitin promoter and/or NOS terminator.
In yet another aspect, the invention provides the transgenic plant that produce by aforesaid method.
In yet another aspect, the invention provides and contain gene BGIos100 or carrier of the present invention or by the plant callus of host cell infected of the present invention.
In yet another aspect, the invention provides plant callus mentioned above for the preparation of transgenic plant or be used for the purposes of plant breeding.
In yet another aspect, the invention provides a kind of transgenic plant, it has been imported into gene BGIos100 and/or support according to the present invention and/or according to host cell of the present invention.
In one embodiment, described transgenic plant, compare with not quiding gene BGIos100 or support according to the present invention or according to the control plant of host cell of the present invention, show better plant root growth, for example the root system shallow-layer of transgenic plant distributes and is denseer.
In one embodiment, gene BGIos100 may be operably coupled to effectively expressing controlling element in plant, and described expression regulation element is promotor and/or terminator for example, preferred corn ubiquitin promoter and/or NOS terminator.
In the present invention, recombinant vectors p6 refers to, comprises the pCAMBIA-1301 carrier of corn ubiquitin promoter and NOS terminator.
In the present invention, plant optimization is monocotyledons, and more preferably paddy rice, millet (Setaria italica), wheat, Chinese sorghum, corn are preferably paddy rice especially, and be for example Japanese fine.
The beneficial effect of the invention
The present invention confirms that by experiment gene BGIos100 has the function that promotes plant root growth.Thereby compared with prior art, technical scheme of the present invention will further improve root system to the absorption of nutrition with to the utilization ratio of liquid manure, reduce using of agricultural chemicals, increase tillering and gathering in the crops of over-ground part, further improve output, quality and the resistance of paddy rice.This has great importance for reducing the agricultural input, alleviate environmental pollution, realize agricultural sustainable development and strengthening China's agricultural competitive power in the world.
Explanation about the biomaterial preservation
The present invention relates to following biomaterial:
1. common wild-rice Yuanjiang River seed, it is preserved in Luojiashan, Wuchang, Wuhan City, Hubei Province Wuhan University preservation center on September 6th, 2010, i.e. Chinese typical culture collection center (CCTCC), deposit number is CCTCC P201011;
2. agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105, it is preserved in Luojiashan, Wuchang, Wuhan City, Hubei Province Wuhan University preservation center on December 24th, 2009, be Chinese typical culture collection center (CCTCC), deposit number is CCTCC M 209315;
3. the fine seed of paddy rice Japan, it is preserved in Luojiashan, Wuchang, Wuhan City, Hubei Province Wuhan University preservation center on December 18th, 2009, i.e. Chinese typical culture collection center (CCTCC), deposit number is CCTCC P200910.
Below in conjunction with drawings and Examples embodiment of the present invention are described in detail, but it will be understood by those skilled in the art that following drawings and Examples only are used for explanation the present invention, rather than to the restriction of scope of the present invention.With the following detailed description of preferred embodiment, it is obvious that various purposes of the present invention and favourable aspect will become to those skilled in the art with reference to the accompanying drawings.
Summary of drawings
Fig. 1 is the photo that shows the detected result of callus GUS dyeing.The callus on the left side is the contrast callus of unconverted BGIos100 gene, and the callus on the right is the transgenic calli that has transformed the BGIos100 gene.
Fig. 2 is the photo that shows the root traits observations of paddy rice seedling.Wherein, left side test tube is the transgenic paddy rice seedling that has transformed the BGIos100 gene, and the right test tube is the contrast paddy rice seedling of unconverted BGIos100 gene.
Embodiment
The pcr amplification of embodiment 1:BGIos100 gene and the structure of pMD18-T+BGIos100 recombinant vectors
1.PCR amplification
Use plant genome DNA to extract test kit (TIANGEN novel plant genome DNA extracting reagent kit, catalog number (Cat.No.): the DP320-02) genomic dna (gDNA) of extraction common wild-rice Yuanjiang River (Oryza.rifupongon Yuanjiang) (it is provided by the Dong Yang of Kunming Institute of Zoology, Chinese Academy of Sciences).According to the base sequence of BGIos100 gene, design one couple of PCR specificity amplification primer: upstream primer F1 (SEQ ID NO:1) comprises restriction enzyme site KpnI, and downstream primer R1 (SEQID NO:2) comprises restriction enzyme site BamHI.Yuanjiang River gDNA with said extracted is template, utilizes upstream primer F1, downstream primer R1 and high-fidelity Ex Taq
TM(TaKaRa, DRR100B) polysaccharase carries out pcr amplification.The pcr amplification system is as shown in table 1.
The pcr amplification system of table 1:BGIos100 gene
The PCR reaction conditions is: 94 ℃ of pre-sex change 5 minutes; 94 ℃ of sex change 45 seconds, 55 ℃ of annealing 50 seconds, 72 ℃ were extended 90 seconds, and carried out 35 reaction cycle; 72 ℃ were extended 7 minutes.
Upstream primer F1 (SEQ ID NO:1): GA
GGTACCGACATGGCGAGGTGCTTCC, wherein underscore represents the KpnI restriction enzyme site.Downstream primer R1 (SEQ ID NO:2): GC
GGATCCAACCGTCACTCATCTAAATC, wherein underscore represents the BamHI restriction enzyme site.
Pcr amplification product separates through 1.0% agarose gel electrophoresis, obtains the big or small band about 1560bp that is.Use TIANGEN sepharose DNA to reclaim test kit (catalog number (Cat.No.): DP209-03) carry out purifying and reclaim.
2.pMD18-T+BGIos100 the structure of recombinant vectors
The pcr amplification product that above-mentioned purifying is reclaimed carry out the T/A clone (the pMD18-T plasmid, TaKaRa, D103A), transformed into escherichia coli then, picking positive colony and order-checking are with the sequence of checking goal gene.
Wherein, T/A clone's linked system is as follows:
pMD18-T 1μl
2*Solution I 5μl
The product 10-20ng that purifying reclaims
DdH
2O is supplemented to cumulative volume 10 μ l
(the new sesame in Ningbo, SDC-6) middle connection is at least 8 hours, obtains the pMD18-T+BGIos100 recombinant vectors at the energy-conserving intelligent thermostatic bath in 16 ℃.According to method well known to those skilled in the art, will be transformed into bacillus coli DH 5 alpha through the product after the above-mentioned connection, thereby obtain to contain the recombination bacillus coli of pMD18-T+BGIos100 cloning vector, with its called after DH5 α-BGIos100.By Shenzhen Huada Genetic Technology Co., Ltd the BGIos100 in the pMD18-T+BGIos100 cloning vector is checked order.Sequencing result is consistent with SEQ ID NO:7.
The sequence of SEQ ID NO:7 is as follows:
ATGGCGAGGTGCTTCCCGTACACGCGTAACCCCGTGGCGGAGTCGATGTCTTCGGCGGCGGCGGCGGCGGTTGAGCCGGGGATCGATAAGCTCCAGAAAGAAAGGGAAATGATGCAAAAGAAGGAAAAGAAGGAAAGGAAGAAAGAGAAAAGGAGACAAAAGAAAGCTGCCCAGCTGGGTGAGAAATATGAGACAGATGATCATCACTCTAAGCATGGCCATAAGAAGAGAAAGCACTCAGGCTGTGAAATAGTTGGCGAGGAGACAAGAAAAGTTTGTAATGTTACCATGGAGCATTTGGAGAAGAGCAGTCTTTCTGAAGAGCATGAGGCTCCTTCCTACAGTCAGGCTTTGCGTTGTACCCCAGAGAGCTCACTGGACAGCACTAAGAGGCTGAGGACTGAAGTGTCAAGTAGCCCTAGTCAAACCAGAAATGGTGTTAACATTCGTGTAAAGTTTACACCTACAAATCAAAGAAGAGACCCAGAAGCAACAACAGGAATGTCAATGAAACCAAGAGTTACTGAACAATCACCAGTCAAAGAAACCGGAATGGATCTGTCCATGGCCAATAGGAAGAGAGAGTTCCAGCCTCATGTCAACACAGTGTCAGTGGTGAAACAAGTTGTCTCCCAACAGAAGAACATGTCTATAAGGAATGGCAATTGTTTGGATGAGTCAAGAAAAGTCAGTCAGCAGCATGATGCAAAGTCCATGCAAAGAGTCAATATGGTGCAGAGAGTTAGAACTAAGTCAACACCGATTGCTGCGATGCAAAGAGTTGATCCGCCTTCATCTGAGAAGGCAGTGATGCAAAGAGCTAATCCTGCGCCCACAAAGGTTATGCAAGGGGTTGAAGCTGCACCTGTGAAGTCAATGCAGAGAGCTAATCCCACGTCCACAAAGGTGATGCAAGAGGTTGAAGCTACACCTGTGAAAGCAATGCAAATAGCTGGCCATATCACTCTTTCGAAAGTGTTCAACAGAGAGAGTACTCAAGTTCAGTTGAGGAAAGAAACAGGAGGTCCCCTACTTGGGGGCCAGCTTAACACAGGGCGACCTACTCTGCTAAACAAGCCCAAGGTGTGTGCTGATCCACCTATCTTGTTAAGCAAGCCGGAGATGTTGTGTGTTGAGCCACCTGGCTTGTTGAACAAACCGAAGGCGCATGTCGAACCACCTGTTGTCAAGCAGCAGCAACAGATTGTGCCCGAAGCACAAGAAGAGCCTTGTTCTGTTGGAAGTGTCTTGGCAGCAGCATCCCCAGTAACAGAGGCACAACAGTCCAGCTCTGACCGGAAAAGCCGCAAGGCTGAGAAGAAAGGGAGGAAGCTTGCAGATTTGTTTGTGAACTGGAAACCATCACCCACACAGATGGAAGATACAGATGTTGGTGACCAGGACTGGCTCTTCAGCTGCCGGGCGACCCCTAAAAATAACTGCAGGACCTTCGATGGATCAGCAAGGTGTCAGCCTACCGAGCAGCTCTTCTCGCTGCAGCCCAGAGCAGTCCATTTGCCTGACCTTCTTATGTATCAGCTGCCGTTTGTTGTGCCTTTTTAG
The structure of embodiment 2:p6 recombinant vectors
1. the pcr amplification of corn ubiquitin (ubi) promoter fragment and the structure of pMD18-T+Ubi recombinant vectors
The pcr amplification of Ubi promotor
Use plant genome DNA to extract test kit (TIANGEN novel plant genome DNA extracting reagent kit, catalog number (Cat.No.): the DP320-02) genomic dna (gDNA) of extraction corn variety B73 (Zea mays mays cv.B73).According to the method for describing among the embodiment 1, use following primer, be template with the gDNA of the corn B73 of said extracted, with high-fidelity Ex Taq
TM(TaKaRa, DRR100B) polysaccharase carries out the pcr amplification of Ubi promotor:
Upstream primer F2 (SEQ ID NO:3): GG
CTGCAGTGCAGCGTGACCCGGTCGT contains restriction enzyme site PstI;
Downstream primer R2 (SEQ ID NO:4): GG
CTGCAGAAGTAACACCAAAC contains restriction enzyme site PstI.
Pcr amplification product is after 1.0% agarose gel electrophoresis separates, and (catalog number (Cat.No.): DP209-03) purifying reclaims to use TIANGEN sepharose DNA to reclaim test kit.
The structure of pMD18-T+Ubi recombinant vectors
According to the method for describing among the embodiment 1, the pcr amplification product that above-mentioned purifying is reclaimed connects into the pMD18-T plasmid, and (TaKaRa D103A), is transformed into bacillus coli DH 5 alpha then, thereby obtain to contain the recombination bacillus coli of pMD18-T+Ubi cloning vector, with its called after DH5 α-Ubi.Carry out sequence verification by Shenzhen Huada Genetic Technology Co., Ltd, thereby determine the correct insertion of purpose fragment.
2.pCAMBIA-1301+Ubi the structure of recombinant vectors
According to the specification sheets of manufacturer, use the little extraction reagent kit of the common plasmid of TIANGEN (catalog number (Cat.No.): DP103-03) extract the recombinant vectors pMD18-T+Ubi that contains corn Ubi promoter sequence from DH5 α-Ubi recombination bacillus coli.With restriction enzyme Pst I (available from NEB) recombinant vectors pMD18-T+Ubi is carried out enzyme and cut, reclaim test kit (catalog number (Cat.No.): DP209-03) reclaim corn Ubi promoter fragment with TIANGEN sepharose DNA then.Similarly, cutting the pCAMBIA-1301 plasmid with restriction enzyme Pst I enzyme (is provided by the Dong Yang of Kunming Institute of Zoology, Chinese Academy of Sciences; Perhaps can buy from for example auspicious Gene Tech. Company Limited of Shanghai state), and carry out purifying and reclaim.It is as follows that 50 μ l enzymes are cut system:
ddH
2O 34.9μl
10*Buffer 3 5μl
Pst I 0.1μl(10U)
PMD18-T+Ubi or pCAMBIA-1301 10 μ l (＜1000ng)
According to the specification sheets of manufacturer, (TaKaRa D2011A), connects the Ubi promoter fragment of recovery and the pCAMBIA-1301 plasmid fragment of recovery to use the T4 ligase enzyme.10 μ l linked systems are as follows:
10*T4Buffer 1μl
The pCAMBIA-1301 plasmid 1 μ l (20ng) that reclaims
The Ubi promoter fragment 10-20ng that reclaims
DdH
2O polishing to 9.5 μ l
T4 ligase enzyme 0.5 μ l
(the new sesame in Ningbo, SDC-6) middle connection is at least 8 hours at the energy-conserving intelligent thermostatic bath in 16 ℃ with linked system.
To be transformed into bacillus coli DH 5 alpha through the product after the above-mentioned connection, thereby obtain to contain the recombination bacillus coli of recombinant vectors pCAMBIA-1301+Ubi.According to the specification sheets of manufacturer, use the little extraction reagent kit of the common plasmid of TIANGEN (catalog number (Cat.No.): DP103-03) extract recombinant vectors pCAMBIA-1301+Ubi.
Recombinant vectors pCAMBIA-1301+Ubi with primers F 2 and the gained of R2 carries out the PCR detection, thereby contains required Ubi promotor among the recombinant vectors pCAMBIA-1301+Ubi of conclusive evidence gained.
3.NOS the structure of the pcr amplification of terminator and pMD18-T+NOS recombinant vectors
According to above-described method, use following primer, be template with the pCAMBIA-1301 plasmid, with high-fidelity Ex Taq
TM(TaKaRa, DRR100B) polysaccharase carries out the pcr amplification of NOS terminator:
Upstream primer F3 (SEQ ID NO:5): GG
GAGCTCGAATTTCCCCGATCGTTCAA contains restriction enzyme site Sac I;
Downstream primer R3 (SEQ ID NO:6): GG
GAATTCCCGATCTAGTAACATAGAT contains restriction enzyme site EcoR I.
Pcr amplification product is after 1.0% agarose gel electrophoresis separates, and (catalog number (Cat.No.): DP209-03) purifying reclaims to use TIANGEN sepharose DNA to reclaim test kit.
According to above-described method, the pcr amplification product that above-mentioned purifying is reclaimed connects into the pMD18-T plasmid, and (TaKaRa D103A), is transformed into bacillus coli DH 5 alpha then, thereby obtain to contain the recombination bacillus coli of pMD18-T+NOS cloning vector, with its called after DH5 α-NOS.Carry out sequence verification by Shenzhen Huada Genetic Technology Co., Ltd, thereby determine the correct insertion of purpose fragment.
4.pCAMBIA-1301+Ubi+NOS be the structure of p6 recombinant vectors
According to the specification sheets of manufacturer, use the little extraction reagent kit of the common plasmid of TIANGEN (catalog number (Cat.No.): DP103-03) extract the pMD18-T+NOS cloning vector from DH5 α-NOS recombination bacillus coli.Use above-described method, with restriction enzyme Sac I and EcoR I (available from NEB) the pMD18-T+NOS cloning vector is carried out enzyme and cut, reclaim test kit (catalog number (Cat.No.): DP209-03) reclaim NOS terminator fragment with TIANGEN sepharose DNA then.Similarly, cut the above pCAMBIA-1301+Ubi recombinant vectors of preparation with restriction enzyme Sac I and EcoR I enzyme, and carry out purifying and reclaim.
Use above-described method, with T4 ligase enzyme (TaKaRa, D2011A) the NOS terminator fragment that connect to reclaim and the pCAMBIA-1301+Ubi recombinant vectors fragment of recovery, and will connect product and be transformed into DH5 α, and finally obtain recombinant vectors pCAMBIA-1301+Ubi+NOS, i.e. p6.
The structure of embodiment 3:p6+BGIos100 recombinant vectors
Use above-described method, extract the pMD18-T+BGIos100 recombinant vectors, carry out enzyme with restriction enzyme KpnI/Xba I and cut and reclaim the BGIos100 gene fragment.Similarly, extract the p6 recombinant vectors, carry out enzyme with corresponding restriction enzyme KpnI/XbaI and cut and reclaim big fragment.Use above-described method, the BGIos100 gene fragment and the p6 recombinant vectors fragment that connect to reclaim, and will connect product and be transformed into DH5 α, thereby finally obtain recombinant vectors p6+BGIos100.Carry out sequence verification, thereby determine the correct insertion of purpose fragment.
Embodiment 4: the preparation of reorganization agrobacterium tumefaciens EHA105-p6+BGIos100 cell
According to method well known to those skilled in the art, the competent cell (referring to " molecular cloning experiment guide ", the third edition, Science Press) of preparation agrobacterium tumefaciens EHA105.
The p6+BGIos100 recombinant vectors of embodiment 3 preparation is transformed into the competent cell of agrobacterium tumefaciens EHA105, and concrete grammar is as follows.
EHA105 takes out in Ultralow Temperature Freezer with the agrobacterium tumefaciens competent cell, places on ice and thaws.After thawing, the p6+BGIos100 recombinant vectors that adds 5 μ l, mixing gently, ice bath 10 minutes was put into liquid nitrogen freezing 5 minutes, 37 ℃ of incubations 5 minutes, the LB liquid nutrient medium (concrete prescription sees " molecular cloning experiment guide ", the third edition, Science Press for details) that adds 800 μ l normal temperature then, and in 28 ℃, recovery is 3 hours under the 160rpm.After the recovery, with 8000rpm centrifugal 30 seconds, inhale remove supernatant and stay 200 μ l and blow even, coat (50mg/l Kan, 10mg/l Rif specifically fill a prescription referring to table 4) on the YM culture medium flat plate that contains kantlex-Rifampin (kan-rif).Be inverted for 28 ℃ and cultivated 2-3 days, obtain the single bacterium colony of reorganization agrobacterium tumefaciens.
PCR detects and cut screening reorganization agrobacterium tumefaciens transformant by Kpn I/BamH I enzyme by carrying out with primers F 1 (SEQ ID NO:1) and R1 (SEQ ID NO:2).
It is the reorganization agrobacterium tumefaciens that comprises recombinant vectors p6+BGIos100 that pcr amplification goes out the transformant that band about about 1560bp and enzyme cut out the band about about 1560bp, with its called after reorganization agrobacterium tumefaciens EHA105-p6+BGIos100.
Embodiment 5: the inducing and transforming of rice callus tissue
According to following steps inducing paddy rice callus, and transform described callus with reorganization agrobacterium tumefaciens EHA105-p6+BGIos100.
1) paddy rice Japan fine (Oryza sativa L.japonica.cv.Nipponbare) seed is shelled, with 70% ethanol surface sterilization 30 seconds, sterilized 30 minutes with the clorox of available chlorine 1.5% then, and follow acutely and shake; The sterilization back is cleaned 5 times with aqua sterilisa; Seed after cleaning is placed on the N6D substratum (specifically filling a prescription referring to table 2), seal with sealing film; 29.5 ℃ illumination cultivation 3-4 week;
2) choose the callus (yellow-white, drying, diameter 1-3mm) of active growth, 29.5 ℃ of illumination cultivation are 3 days on new N6D substratum;
3) the single bacterium colony of the reorganization agrobacterium tumefaciens EHA105-p6+BGIos100 of picking embodiment 4 acquisitions was gone up streak culture 3 days in the YM substratum (specifically filling a prescription referring to table 3, table 4) that adds microbiotic (50mg/l Kan, 10mg/l Rif), and culture temperature is 28 ℃; Scrape and get above-mentioned reorganization agrobacterium tumefaciens, be placed on the Syringylethanone (Acetosyringone that has added 30 μ l 100mM, AS) in the 30ml AAM substratum (specifically filling a prescription referring to table 5), gentle resuspended described reorganization agrobacterium tumefaciens EHA105-p6+BGIos100 cell;
4) callus with succeeding transfer culture places the sterilization culture dish; Then the reorganization agrobacterium tumefaciens suspension of step 3) preparation is poured in the described culture dish, described callus was soaked 15 minutes;
5) discard reorganization agrobacterium tumefaciens suspension in the culture dish, with sterilization thieving paper excess liquid on the callus is blotted; Place a sterilization filter paper at N6-AS substratum (specifically filling a prescription referring to table 6), and add the AAM substratum that 1ml contains AS, then callus is transferred on the filter paper; The sealing culture dish, 28 ℃ of dark cultivations 48-60 hour;
6) callus that step 5) is obtained places the 50ml sterile tube, shakes cleaning with aqua sterilisa, becomes clarification until supernatant liquor; Callus is soaked in the sterilized water that contains 500mg/l Pyocianil (Carb) to kill the reorganization agrobacterium tumefaciens; Remove redundant moisture on the callus with sterilization thieving paper, then it is transferred on the N6-AS substratum that contains 1mg/l hygromycin B (HmB) and 50mg/l Carb; With sealing the film phonograph seal culture dish, 29.5 ℃ of illumination cultivation 3-4 weeks.
Embodiment 6: the detection that the GUS in the rice callus tissue expresses
Expression for GUS in the rice callus tissue through transforming that detects embodiment 5 preparations, method (Journal of Integrative Plant Biology according to descriptions such as Chen SY, 2008,50 (6): 742-751), the rice callus tissue that transforms with reorganization agrobacterium tumefaciens EHA105-p6+BGIos100 is dyeed.
Comprise in the 1ml GUS staining fluid: 610 μ l 0.2M Na
2HPO
4Solution (pH=7.0); 390 μ l 0.2M NaH
2PO
4Solution and 10 μ l 0.1M X-gluc.
To be immersed in the GUS staining fluid with the rice callus tissue that reorganization agrobacterium tumefaciens EHA105-p6+BGIos100 transforms, blue until occurring at 37 ℃ of following incubations.The Taking Pictures recording coloration result, and be shown among Fig. 1.The result shows, the rice callus through transforming of embodiment 5 preparations is organized and presented blueness (Fig. 1 right side) after dyed, and the contrast callus of unconverted is through GUS dyeing back color do not change (on the left of Fig. 1).This shows that p6+BGIos100 recombinant vectors of the present invention has been transformed into the rice callus tissue.
Embodiment 7: the detection that the GUS in the transgenic paddy rice seedling expresses
The callus through transforming of embodiment 5 preparations is transferred to the MS-R division culture medium (concrete prescription sees Table 7) that contains 50mg/l hygromycin B (HmB), with the differential growth seedling; With sealing the film phonograph seal culture dish, 29.5 ℃ of illumination cultivation 3-4 weeks; When treating that seedling grows to 3-4cm, seedling is transferred to the 1/2MS root media (specifically filling a prescription referring to table 8) that contains 50mg/l hygromycin B (HmB), with the screening of taking root.
The GUS dyeing process of transgenic paddy rice seedling is identical with the GUS dyeing process of callus among the embodiment 6.The Taking Pictures recording coloration result, the result shows that the root of the rice seedling that the agrobacterium tumefaciens through containing the p6+BGIos100 recombinant vectors transforms and leaf present blueness after GUS dyeing, the root of the contrast seedling of unconverted and leaf color after GUS dyeing does not change.This shows that p6+BGIos100 recombinant vectors of the present invention is transformed in the rice seedling.
Embodiment 8: the character observation of the root system of transgenic paddy rice seedling
The transgenic paddy rice seedling carries out Taking Pictures recording after growing 20 days in the 1/2MS root media, the results are shown among Fig. 2.The result shows that the root system (Fig. 2, left side test tube) of the paddy rice seedling that the agrobacterium tumefaciens through containing the p6+BGIos100 recombinant vectors transforms is compared with the root system (Fig. 2, the right test tube) of the contrast paddy rice seedling of unconverted, and the root system shallow-layer distributes and be denseer.In the present embodiment, cultivated 28 strain transgenic paddy rice seedlings altogether, 25 strains wherein show that shallow-layer distributes and denseer root system (comparing with contrast paddy rice seedling).These data show that BGIos100 gene of the present invention promotes the root growth of plant effectively, and show better plant root growth (compared with the control, its root system shallow-layer distributes and be denseer) with the plant of BGIos100 gene transformation.
The prescription of employed various substratum is shown in hereinafter in the embodiment of the invention.Especially, in the present invention, " conventional sterilization " of substratum referred to the sterilization of following condition: 121 ℃ of following steam sterilizings 20 minutes.
Table 2:N6D substratum
With 1N potassium hydroxide the pH value is adjusted to 5.8, seals the conventional sterilization in back.
N
6Macro mother liquor (20X): saltpetre 56.60g, potassium primary phosphate 8.00g, ammonium sulfate 9.26g, sal epsom 3.70g, calcium chloride 3.32g is settled to 1L with distilled water, and 4 ℃ of preservations are standby.
N
6Micro mother liquor (1000X): potassiumiodide 0.80g, boric acid 1.60g, manganous sulfate 3.33g, zinc sulfate 1.50g is settled to 1L with distilled water, and 4 ℃ of preservations are standby.
Molysite (Fe
2EDTA) stock solution (100X): with 3.73g b diammonium disodium edta (Na
2EDTA2H
2O) and 2.78g FeSO
47H
2O dissolves respectively, and mixes.Be settled to 1000ml with distilled water, 70 ℃ of temperature were bathed 2 hours, cooled off back 4 ℃ of preservations and were no more than 1 month.
N
6VITAMIN stock solution (1000X): VITMAIN B1 0.10g, vitamin B6 0.05g, nicotinic acid 0.05g, glycine 0.20g is settled to 100ml with distilled water, filtration sterilization, 4 ℃ of preservations were no more than for 1 week.
Table 3:YM liquid nutrient medium (containing 50mg/L Kan, 10mg/L Rif)
Table 4:YM solid medium (containing 50mg/L Kan, 10mg/L Rif)
Table 5:AAM substratum
With 1N potassium hydroxide the pH value is adjusted to 5.2, conventional sterilization.
AAM macro (10X): 2.5g magnesium sulfate heptahydrate (MgSO
47H
2O), 1.5g Calcium dichloride dihydrate (CaCl
22H
2O), 1.33g sodium dihydrogen phosphate dihydrate (NaH
2PO
42H
2O), be settled to 1L with distilled water, 4 ℃ of preservations are standby.
The single water manganous sulfate of AAM micro (100X): 0.7g (MnSO
4H
2O), 0.2g Zinc Sulphate Heptahydrate (ZnSO
47H
2O), 0.075g potassiumiodide (KI), 0.3g boric acid (H
3BO
3), 25mg Sodium Molybdate Dihydrate (Na
2MoO
42H
2O), 2.5mg cupric sulfate pentahydrate (CuSO
45H
2O), 2.5mg CoCL2 (CoCl
26H
2O), be settled to 1L with distilled water, 4 ℃ of preservations are standby.
AAM organic (1000X): 0.75g glycine (Glycine), 0.1g nicotinic acid (Nicotinicacid), 0.1g VB
6(Pyridoxine), 1g VB
1(Thiamine), be settled to 100ml with distilled water, 4 ℃ of preservations are standby.
Molysite (Fe
2EDTA) stock solution (100X): see Table 2.
Table 6:N6-AS is substratum altogether
Regulate pH to 5.2.
N
6Macro mother liquor (20X), N
6Micro mother liquor (1000X), molysite (Fe
2EDTA) stock solution (100X), N
6VITAMIN stock solution (1000X): all see Table 2.
Table 7:MS-R division culture medium
Regulate pH value to 5.8, conventional sterilization.
MS macro (20X): ammonium nitrate 33.0g, saltpetre 38.0g, potassium primary phosphate 3.4g, sal epsom 7.4g, calcium chloride 8.8g, dissolving is settled to 1L with distilled water under the room temperature, 4 ℃ of preservations then one by one.
MS micro (1000X): manganous sulfate 16.90g, zinc sulfate 8.60g, boric acid 6.20g, potassiumiodide 0.83g, Sodium orthomolybdate 0.25g, copper sulfate 0.025g, cobalt chloride 0.025g, mentioned reagent is at room temperature dissolved and is settled to 1L with distilled water, 4 ℃ of preservations.
MS VITAMIN stock solution (1000X): vitamins B
10.010g, vitamins B
60.050g, nicotinic acid 0.050g, glycine 0.200g is settled to 100ml with distilled water, filtration sterilization, 4 ℃ of preservations were no more than for 1 week.
Molysite (Fe2EDTA) stock solution (100X): see Table 2.
Table 8:1/2MS root media
Regulate pH value to 5.8.
MS macro (20X): see Table 7.
MS micro (1000X), MS VITAMIN stock solution (1000X): see Table 7.
Molysite (Fe
2EDTA) stock solution (100X): see Table 2.
Reference
Be used for illustrating the present invention herein or provide about patent, publication and the other materials of the other detailed content of enforcement of the present invention integrating with this paper by reference, and provide by following bibliography for simplicity.
1.Feltus FA，Wan J，Schulze SR，Estill JC，Jiang N，Paterson AH.An SNP resource for rice genetics and breeding based on subspecies indica and japonica genome alignments.Genome Research.2004，14：1812-1819；
2.Iafrate AJ，Feuk L，Rivera MN，Listewnik ML，Donahoe PK，QiY，Scherer SW，Lee C.Detection of large-scale variation in the human genome.Nat Genetics.2004，36：949-951；
3.Jin J，Huang W，Gao J，Yang J，Shi M，Zhu M，Luo D，Lin H.Genetic control of rice plant architecture under domestication.Nature Genetics.2008，40(11)：1365-1369；
4.Kovach MJ，Megan T，MT，McCouch SR.New insights into the history of rice domestication.Trends in Genetics.2007，23(11)：578-587；
5.Lu J，Tang T，Tang H，Huang J，Shi S，Wu CI.The accumulation of deleterious mutations in rice genomes：a hypothesis on the cost of domestication.Trends in Genetics.2006，22：126-131；
6.Redon R，Ishikawa S，Fitch KR，Feuk L，Perry GH，Andrews TD，Fiegler H，Shapero MH，Carson AR，Chen W，et al.Global variation in copy number in the human genome.Nature.2006，444：444-454；
7.Shen YJ，Jiang H，Jin JP，Zhang ZB，Xi B，He YY，Wang G，Wang C，Qian L，Li X，et al.Development of genome-wide DNA polymorphism database for map-based cloning of rice genes.Plant Physiology.2004，135：1198-1205；
8.Tang T，Lu J，Huang J，He J，McCouch SR，Shen Y，Kai Z，Purugganan MD，Shi S，Wu CI.Genomic variation in rice：genesis of highly polymorphic linkage blocks during domestication.PLoS Genet.2006，2：e199；
9.Wang E，Wang J，Zhu X，Hao W，Wang L，Li Q，Zhang L，He W，Lu B，Lin H，Ma H，Zhang G，He Z.Control of rice grain-filling and yield by a gene with a potential signature of domestication.Nature Genetics.2008，40(11)：1370-1374；
10.Wang W，Zheng H，Fan C，Li J，Shi J，Cai Z，Zhang G，Liu D，Zhang J，Vang S，et al.High rate of chimeric gene origination by retroposition in plant genomes.Plant Cell.2006，18：1791-1802；
11.Yadav R，Courtois B，Huang N，et al.Mapping genes controlling root morphology and root distribution in a doubled-haploid population of rice.Theor Appl Genet.1997，94：619-632；
12.Gao L Z，Xu H Y.Patterns of mutation rate variation at microsatellites：evolutionary insights from comparisons of Asian cultivated rice(Oryza sativa L.)and related species.BMC Evolutionary Biology.2008，8：11；
13. Ling Qihong, etc. the function of paddy rice different levels root system reaches the research to output formation effect. Scientia Agricultura Sinica .1984, (4): 3-11;
14. stone celebrating China, Huang Yingjin, Li Muying is etc. the relevant genetic research that reaches root traits with overground part of. rice root proterties. Scientia Agricultura Sinica .1997,30 (4): 61-67;
15. grandson passes clearly, etc. the heredity of rice root proterties and leaf water potential and correlation research thereof. Scientia Agricultura Sinica .1995,28 (1): 42-48;
16. Wu Wei is bright, formula China. the meaning of rice root breeding and prospect. rice in China science .2005,19 (2): 174-180;
17. the Xu Ji minister, Zou Liangxing. utilize correlation analysis to identify the molecule marker relevant with the rice root trait expression. Acta Genetica Sinica .2002,29 (3): 245-249.
Sequence table
Claims (13)
1. gene BGIos100 and/or the host cell that contains the carrier of gene BGIos100 and/or contain described carrier be used for to promote the root system of plant shallow-layer to distribute and the purposes of denseer growth, the nucleotide sequence of described gene BGIos100 is shown in SEQ ID NO:7, and described plant is paddy rice.
2. gene BGIos100 and/or the host cell that contains the carrier of gene BGIos100 and/or contain described carrier are for the preparation of transgenic plant or be used for the purposes of plant breeding, and the nucleotide sequence of described gene BGIos100 is shown in SEQ ID NO:7; Described plant is paddy rice; Described transgenic plant are not compared with carrying out genetically modified plant, and the root system shallow-layer distributes and be denseer; Described gene BGIos100 distributes the root system shallow-layer of gained plant in the plant breeding and is denseer.
3. one kind promotes the root system of plant shallow-layer to distribute and denseer method, described method comprises gene BGIos100 and/or the carrier that contains gene BGIos100 is transformed into plant, or with the host cell infected plant that contains described carrier, the nucleotide sequence of described gene BGIos100 is shown in SEQ ID NO:7; Described plant is paddy rice.
4. the method for claim 3 wherein is transformed into plant by the agrobacterium tumefaciens conversion method with described gene and/or described carrier.
5. the method for claim 3, wherein, described gene may be operably coupled to effectively expressing controlling element in plant.
6. the method for claim 5, wherein said expression regulation element comprises promotor and/or terminator.
7. the method for claim 6, wherein said promotor is that corn ubiquitin promoter and/or described terminator are the NOS terminators.
8. method that produces transgenic plant said method comprising the steps of:
1) gene BGIos100 and/or the carrier that contains gene BGIos100 are transformed into plant callus, or with the host cell infected plant callus that contains described carrier;
2) from described callus regeneration transgenic plant, the transgenic plant that produce are not compared with carrying out genetically modified plant, and the root system shallow-layer distributes and be denseer;
Wherein, described plant is paddy rice; The nucleotide sequence of described gene BGIos100 is shown in SEQ ID NO:7.
9. the method for claim 8 wherein is transformed into plant callus by the agrobacterium tumefaciens conversion method with described gene and/or described carrier.
10. the method for claim 8, wherein said gene may be operably coupled to effectively expressing controlling element in plant.
11. the method for claim 10, wherein, described expression regulation element comprises promotor and/or terminator.
12. the method for claim 11, wherein said promotor are corn ubiquitin promoter and/or described terminator is the NOS terminator.
13. the plant callus of host cell infected that contains gene BGIos100 and/or contain the carrier of gene BGIos100 and/or contain described carrier is for the preparation of transgenic plant or be used for the purposes of plant breeding, the nucleotide sequence of described gene BGIos100 is shown in SEQ ID NO:7; Described plant is paddy rice; Described transgenic plant are not compared with carrying out genetically modified plant, and the root system shallow-layer distributes and be denseer; Described gene BGIos100 distributes the root system shallow-layer of gained plant in the plant breeding and is denseer.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010539168 CN102465140B (en) | 2010-11-10 | 2010-11-10 | Method for utilizing BGIos100 genes to boost growth of plant roots |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010539168 CN102465140B (en) | 2010-11-10 | 2010-11-10 | Method for utilizing BGIos100 genes to boost growth of plant roots |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102465140A CN102465140A (en) | 2012-05-23 |
| CN102465140B true CN102465140B (en) | 2013-08-07 |
Family
ID=46069260
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201010539168 Active CN102465140B (en) | 2010-11-10 | 2010-11-10 | Method for utilizing BGIos100 genes to boost growth of plant roots |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102465140B (en) |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110131679A2 (en) * | 2000-04-19 | 2011-06-02 | Thomas La Rosa | Rice Nucleic Acid Molecules and Other Molecules Associated with Plants and Uses Thereof for Plant Improvement |
-
2010
- 2010-11-10 CN CN 201010539168 patent/CN102465140B/en active Active
Non-Patent Citations (4)
| Title |
|---|
| AK120792;Kikuchi S.等;《Genbank》;20081204;全文 * |
| Collection, Mapping, and Annotation of Over 28,000 cDNA Clones from japonica Rice;Shoshi Kikuchi等;《Science》;20030718;第301卷;376-379 * |
| Kikuchi S.等.AK120792.《Genbank》.2008, |
| Shoshi Kikuchi等.Collection, Mapping, and Annotation of Over 28,000 cDNA Clones from japonica Rice.《Science》.2003,第301卷376-379. |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102465140A (en) | 2012-05-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110128515A (en) | A kind of rice grain shape growth and development correlative coding gene and its application | |
| CN104513823B (en) | A kind of preparation method of the genetically modified plants of drought-enduring salt tolerant | |
| AU2020100982A4 (en) | Wheat salt tolerance gene taaap3 and its application | |
| CN110029113A (en) | A kind of rice grain shape growth and development correlative coding gene and its application | |
| CN105705643A (en) | Abiotic stress resistance | |
| CN103224555B (en) | Plant development associated protein GhSOC1 and encoding gene thereof and application | |
| CN102978218A (en) | Cloning of apple stress-resistant related gene MdSIMYB2 and application of cloning of apple stress-resistant related gene MdSIMYB2 | |
| CN103014035B (en) | Tumorous stem mustard stress-resistant gene, plant expression vector, construction method and application thereof | |
| Angon et al. | Roles of CRISPR to mitigate drought and salinity stresses on plants | |
| CN104593384B (en) | Maize Transcription Factor ZmPIF3.2 genes and its application | |
| WO2023207740A1 (en) | Discovery method for salt-tolerant cotton gene based on joint analysis of transcriptome and proteome, and use thereof | |
| CN102465139B (en) | Method for promoting plant root growth by using BGIos389 gene | |
| CN103172717B (en) | Plant low potassium stress resistant related protein GmWRKY50 as well as encoding gene and application thereof | |
| CN102586270A (en) | Rice stress resistance-related OsHMGB3 gene, and encoding protein and application thereof | |
| CN102465140B (en) | Method for utilizing BGIos100 genes to boost growth of plant roots | |
| CN102465141B (en) | Promotion of plant root growth by using BGIos040 gene | |
| CN102465143B (en) | Promotion of plant root growth by using BGIos1025 gene | |
| CN101984060B (en) | Method for promoting growth of plant roots by utilizing BGIos1021 genes | |
| CN101979600B (en) | Method for promoting growth of plant roots by utilizing BGIos135 genes | |
| CN101979599B (en) | Method for promoting plant roots to grow by using BGIos244 genes | |
| CN102465138B (en) | Promotion of plant root growth by using BGIos163 gene | |
| CN102465142B (en) | Method and application for promoting growth of plant roots by using BGIos444 gene | |
| CN103849605A (en) | Method for cultivating resistant plant, and special protein and gene thereof | |
| CN103194458A (en) | Method for improving phosphorus absorption efficiency of wheat plant by using sucrose transporter gene | |
| CN103570813A (en) | Plant-stress-resistance related protein Gh01399, and coding gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20180131 Address after: 518124 Guangdong province Shenzhen City Dapeng Dapeng District Office Pengfei Road No. 7 Patentee after: Shenzhen Huada Sansheng Garden Technology Co., Ltd. Address before: 518083, No. 11, Beishan Industrial Zone, Yantian District, Guangdong, Shenzhen Patentee before: BGI-Shenzhen Co., Ltd. |
|
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20191213 Address after: 518120 A205, Peng Fei Road, Dapeng street, Dapeng New District, Shenzhen, Guangdong, China, 7 Patentee after: Shenzhen Huada gene agriculture Holding Co., Ltd. Address before: 518124 Guangdong province Shenzhen City Dapeng Dapeng District Office Pengfei Road No. 7 Patentee before: Shenzhen Huada Sansheng Garden Technology Co., Ltd. |