CN102443636A - Universal GAPDH gene fluorescence quantitative polymerase chain reaction kit - Google Patents

Abstract

The invention relates to a fluorescence quantitative polymerase chain reaction kit which is simple and fast to operate and can realize effective quantitative amplification detection of GAPDH genes of human beings, rats and mice. The kit comprises a PCR amplification buffering reaction system composed of specific primers and probe of GAPDH, heatproof DNA polymerase, dNTPs, template DNA, magnesium ions, a PCR buffer solution, ultrapure water, etc., and a standard ACTB template, wherein, the sequences of the primers and probe are an upstream primer P1 (SEQ ID NO:1), a downstream primer P2 (SEQ ID NO:2) and a TaqMan probe sequence (SEQ ID NO:3) respectively, the concentration of each of the primer and probe is 0.28 mu mol/L, Taq DNA polymerase is 1.5 U/50 mu l, the substrate of dNTPs is 0.25 mmol/L, there are a plurality of the templates cDNA, 2.5 mmol/L of Mg<++> and 1 XPCR of the buffer solution, and the sequence of a standard GAPDH gene template is SEQ ID NO:4.

Description

General GAPDH gene by fluorescence quantitative polymerase chain reaction test kit

Technical field

The present invention relates to a kind of easy and simple to handle, quick; And can the detection by quantitative people, rat, three species glyceraldehyde-3-phosphate dehydrogenases of mouse (glyceraldehyde-3-phosphate dehydrogenase); The DNA amplification in vitro test kit that GAPDH gene and mRNA express, this invention belongs to the fluorescent quantitation DNA amplification in vitro technical field in the molecular Biological Detection technology.

Background technology

Polymerase chain reaction (polymerase chain reaction, be called for short PCR) be the most frequently used in the existing DNA amplification in vitro technology, also be otherwise effective technique; This technology system is placed on heat-resisting DAN polysaccharase, special primer, dNTPs substrate, template DNA, mg ion etc. in the same buffering reaction system; Carry out repeatedly the thermal cycling of high-temperature denatured, low-temperature annealing, middle temperature chain extension, in reaction solution, be 2 thereby reach target dna fragment ⁿDoubly amplification (wherein n is a times of thermal cycle); Fluorescent quantitative PCR technique is then on the basis of PCR reaction; Coupling detects with real-time fluorescence and the Computer Analysis technology; Promptly in the PCR reaction system, add specific fluorescent substance; Come the amplification situation of real-time detection DNA through detecting after each thermal cycling the change in fluorescence situation in the PCR reaction system, and obtain the fluorescent quantitation change curve of each sample, and then obtain the Ct value (cycle number when change in fluorescence reaches threshold value) of each reaction tubes; Simultaneously; Under identical reaction system and reaction conditions, detect the target DNA of the dose known amounts of 4-5 multiple dilution; Obtain its Ct value; Logarithm with the starting template number is an X-coordinate, is ordinate zou preparation standard curve with the Ct value, and the Ct value of typical curve and each sample is carried out quantitatively determined to the initiate dna template number of each reaction in view of the above; The aqMan probe technique is present the most frequently used fluorescent quantitative PCR technique; The TaqMan probe be one can with the oligonucleotide of the target DNA sequence complementary pairing of detection to be amplified, its 5 ' end mark a fluorescence report group (R), its 3 ' end mark a fluorescent quenching group (Q); When this probe was in unbound state or does not react, the fluorescence that R produced will be by the Q cancellation; In the PCR annealing process, this probe can be hybridized with target gene, and is cut off by the circumscribed activity of polymeric that depends on of TaqDNA polysaccharase, makes R separate with Q, and free R sends fluorescence and detected by fluorescence detection device; Along with the carrying out of PCR reaction, free R and PCR product increase accordingly; Therefore, the power of the fluorescent signal that produces according to R can be measured the quantity of PCR reaction product indirectly; The establishing criteria curve can carry out quantitatively determined to the initiate dna template number of each reaction again.

Summary of the invention

In fluorescence quantitative PCR detection, often run into the situation that detects the gene relative expression quantity, wherein the internal reference gene is usually selected GAPDH.In view of this; We have optimized one through a large amount of experimental studies and have overlapped the primer and the probe that can effectively detect people, rat, three species GAPDH of mouse genetic expression; Optimize the condition that its PCR reaction; And be assembled into general GAPDH genetic expression detection fluorescent quantitative poly Kettenreaktion test kit, to satisfy the needs that life science and medical science detect.

Technical scheme of the present invention is achieved in that the GAPDH standard sequence that at first obtains people, rat, mouse; Carry out the BLAST homology relatively; Design corresponding primer and probe according to comparative result again; At last primer, probe are added in the pcr amplification buffering reaction system of compositions such as containing hot resistant DNA polymerase, dNTPs, template cDNA, mg ion, PCR damping fluid, ultrapure water, on thermal cycler, carry out the thermal cycling repeatedly of high temperature, low temperature, middle temperature; And when middle temperature, detect and the record fluorescent value.

The primer that is optimized and the sequence of probe are distinguished as follows:

Upstream primer P1:5 '-AAG CTC ATT TCC TGG TAT GAC A-3 ' (SEQ ID NO:1);

Downstream primer P2:5 '-ACA TGG CCT CCA AGG AGT AAG A-3 ' (SEQ ID NO:2);

TaqMan probe sequence: 5 '-FAM-CAA CAG GGT GGT GGA CCT C-TAMRA-3 ' (SEQ ID NO:3);

Optimize the pcr amplification buffering reaction system that and form by primer, probe, hot resistant DNA polymerase, dNTPs, template DNA, Mg++, PCR damping fluid, ultrapure water etc., the final concentration of each composition respectively as follows: every 0.28umol/L of special primer and probe, Taq archaeal dna polymerase 1.5/50ul, dNTPs substrate 0.25mmol/L, template cDNA are some, Mg++2.5mmol/L, damping fluid 1XPCR; Wherein the 1XPCR damping fluid comprises 50mmol/L KCl, 10mmol/L Tris.HClPH8.3,0.01% gelatin.

This GAPDH quantitative fluorescent PCR is owing to primer and probe complete homology in people, rat, mouse, thus the GAPDH gene that can effectively increase and derive from these species, thus detect GAPDH expression of gene amount.

According to above-mentioned result of study; Install in the pcr amplification pipe dividing after above-mentioned primer, probe and other PCR reagent mix, and the standard GAPDH gene template that is equipped with serial dilution degree such as 10E+8/ML, 10E+7/ML, 10E+6/ML, 10E+5/ML, 10E+4/ML is assembled into general GAPDH gene by fluorescence quantitative polymerase chain reaction test kit; The sequence of standard GAPDH gene template is:

5’-AAGCTCATTTCCTGGTATGACAACGAATTTGGCTACAGCAACAGGGTGGTGGCCTCATGGCCCACATGGCCTCCAAGGAGTAAGA-3’(SEQ?ID?NO：4)

Embodiment 1

1, each 20D of synthetic following primer and probe on dna synthesizer, and be diluted to 10umol/L with TE damping fluid (wherein contain 10mmol/LTris, 1 contains 10mmol/L EDTA); Wherein upstream primer P1 sequence is: 5 '-AAG CTC ATTTCC TGG TAT GAC A-3 ' (SEQ ID NO:1); Downstream primer P2:5 '-ACA TGG CCT CCA AGG AGTAAG A-3 ' (SEQ ID NO:2); TaqMan probe sequence: 5 '-FAM-CAA CAG GGT GGT GGA CCT C-TAMRA-3 ' (SEQ ID NO:3)

2, get each primer, each 37.5ul of probe, 25mmol/L dNTPs 18ul,, 25mmol/L MgCl ₂150ul, 10XPCR reaction buffer 150ul, 5U/ul Taq archaeal dna polymerase 9ul, ultrapure water 990.5ul join in the clean sterile test tube of 2ml, and fully mixing is prepared 1400ul FQ-PCR reaction premixed liquid.

3, premixed liquid is become by the 46.7ul/ pipe to be distributed into 30 tubules (with 200ul pcr amplification pipe); Be equipped with standard GAPDH gene template 5 pipes of serial dilution degree such as 10E+8/ML, 10E+7/ML, 10E+6/ML, 10E+5/ML, 10E+4/ML again; Each 20ul of every pipe promptly has been assembled into general GAPDH gene by fluorescence quantitative polymerase chain reaction test kit; Wherein the sequence of standard GAPDH gene template is:

5’-AAGCTCATTTCCTGGTATGACAACGAATTTGGCTACAGCAACAGGGTGGTGGCCTCATGGCCCACATGGCCTCCAAGGAGTAAGA-3’(SEQ?ID?NO：4)

4, FQ-PCR amplification

Each is equipped with in the reaction tubes of 46.7ulPCR reaction premixed liquid and adds 3.3ul cDNA to be measured respectively, water or standard GAPDH gene template, concussion mixing; Machine is gone up in quantitative real time PCR Instrument (like PE9700) in instantaneous centrifugal back; 96 ℃ of following sex change 5 minutes, then by 94 ℃ 20 seconds, 55 ℃ 30 seconds; 60 ℃ of thermal cyclings in 30 seconds 45 times, and in the time of 60 ℃ the detection record fluorescent signal; After the PCR reaction finished, the Ct value that reads each reaction was in order to quantitative analysis; In 3% sepharose performing PCR product electrophoresis, observe the result of each PCR reaction of gray scale scanning analytic record simultaneously under the ethidium bromide staining, GelDoc1000.

5. result

In the FQ-PCR of 30 samples reaction, through electrophoresis detection, add in the reaction product of sample to be measured and standard substance, all detected the PCR product band about the big or small 85bp of expection, and the negative control that does not add the DNA sample is not seen corresponding amplified production; The reaction of adding standard GAPDH gene template and sample to be measured has all obtained the change in fluorescence curve of S shape, adds the Ct value of standard GAPDH gene template; Linear with the logarithm that adds the template copy number; Can fit to straight line, slope-3.36, intercept is 41.3; Relation conefficient 9.9 explains that this reaction system and reaction conditions all meet the requirement of accurate quantification research.

Claims (4)

1. One kind simple to operate, quick, effectively quantitative amplification detects the GAPDH gene by fluorescence quantitative polymerase chain reaction test kit of people, rat, mouse; Wherein comprise the pcr amplification buffering reaction system that the special primer of GAPDH, probe and hot resistant DNA polymerase, dNTPs, template DNA, mg ion, PCR damping fluid, ultrapure water etc. are formed, and standard GAPDH template.
2. 2. general GAPDH gene by fluorescence quantitative according to claim 1 polymerase chain reaction test kit, it is characterized in that: the primer and probe sequence are respectively: upstream primer P1:5 '-AAG CTC ATT TCC TGG TAT GAC A-3 ' (SEQ ID NO:1); Downstream primer P2:5 '-ACA TGG CCT CCA AGG AGT AAG A-3 ' (SEQ ID NO:2); TaqMan probe sequence: 5 '-FAM-CAA CAG GGT GGT GGA CCT C-TAMRA-3 ' (SEQ ID NO:3).
3. 3. general GAPDH gene by fluorescence quantitative according to claim 1 polymerase chain reaction test kit is characterized in that: every 0.28umol/L of special primer and probe, Taq archaeal dna polymerase 1.5/50ul, dNTPs substrate 0.25mmol/L, template cDNA are some, Mg++2.5mmol/L, damping fluid 1XPCR; Wherein the 1XPCR damping fluid comprises 50mmol/L KCl, 10mmol/L Tris.HCl PH8.3,0.01% gelatin.
4. 4. general GAPDH gene by fluorescence quantitative according to claim 1 polymerase chain reaction test kit, it is characterized in that: standard GAPDH gene template sequence is: 5 '-AAGCTCATTTCCTGGTATGACAACGAATTTGGCTACAGCAACAGGGTGGTGGCCTC ATGGCCCACATGGCCTCCAAGGAGTAAGA-3 ' (SEQ ID NO:4); Its concentration is respectively 10E+8/ML, 10E+7/ML, 10E+6/ML, 10E+5/ML, 10E+4/ML.