WO2022121754A1 - Method for detecting activity of one or more polymerases - Google Patents

Abstract

Provided is a method for detecting the activity of one or more polymerases, the method comprising amplifying a nucleic acid molecule by using a polymerase and a primer group so as to obtain an amplified product, performing melting curve analysis on the amplified product by using a detection probe, and obtaining the melting peak height (Rm) of the amplified product according to the results of the melting curve analysis, thereby analyzing the activity of one or more polymerases.

Description

A method for detecting the activity of one or more polymerases technical field

The present invention provides a method for detecting the activity of one or more polymerases using melting curve analysis.

Background technique

MMLV reverse transcriptase gene, derived from the mouse leukemia virus (Molony Murine Leukemia Virus) genome, MMLV is often used for the preparation of multiple or multiple mutants, which can be screened out by large-scale tests with high efficiency or other biological characteristics of reverse transcriptase. Traditional techniques can more accurately measure the activity of reverse transcriptase. For example, methods for detection of reverse transcriptase activity are generally product-enhanced reverse transcriptase assay (PERT) and polymerase chain reaction based reverse transcriptase assay (PBRT). However, there is still a lack of methods for roughly judging reverse transcriptase activity. If the reverse transcriptase activity can be quickly and easily distinguished, the efficiency can be improved.

The present application intends to use melting curve technology for the judgment of enzyme activity to solve the problems of traditional methods. The melting curve refers to the curve of the degree of degradation of the double helix structure of DNA with increasing temperature. The original melting curves used embedded dyes to quantify products, but these dyes had the major disadvantage of detecting both specific and nonspecific nucleic acid products. The melting curve was significantly improved by the introduction of fluorescently labeled probes. The use of these fluorescent probes has led to the development of melting curve methods that enable the detection of specific nucleic acid products only. The invention improves the melting curve analysis, and innovatively realizes the application of the melting curve analysis in the determination of reverse transcriptase activity.

SUMMARY OF THE INVENTION

In order to solve the above problems, the present application uses detection probes to perform melting curve analysis on nucleic acid products of nucleic acid molecules amplified by polymerases, and calculate the peak heights of melting peaks, thereby realizing the detection of the activity of one or more polymerases.

Accordingly, in a first aspect, the application provides a method for detecting the activity of one or more polymerases, the method comprising:

(a) providing a sample containing a nucleic acid molecule, a primer set capable of amplifying the nucleic acid molecule, and providing one or more polymerases to be detected;

(b) providing at least one detection probe labeled with a reporter group and a quencher group, wherein the reporter group can emit a signal, and the quencher group can absorb or quench the signal emitted by the reporter group; and the detection probe emits a signal when hybridized to its complementary sequence that is different from the signal emitted when it is not hybridized to its complementary sequence; under conditions that allow nucleic acid hybridization or annealing Under the following conditions, the detection probe can specifically hybridize to a designated region of the nucleic acid molecule;

(c) using the polymerase and primer set to amplify the nucleic acid molecule to obtain an amplification product, and using the detection probe to perform melting curve analysis on the amplification product respectively;

(d) obtaining the melting peak height (Rm) of the amplification product according to the melting curve analysis result of step (c), so as to analyze the activity of one or more polymerases.

In certain embodiments, wherein, in step (c), the nucleic acid molecule is mixed with the polymerase and the primer set and amplified, and then, after the amplification, the detection probe is adding to the product of step (b), and performing melting curve analysis; or, in step (b), mixing the nucleic acid molecule with the polymerase, the primer set and the detection probe, and performing Amplification and then, after the end of the amplification, a melting curve analysis is performed.

In certain embodiments, in step (d), the activity of the plurality of polymerases is analyzed by comparing the melting peak heights (Rm) of the amplification products of the plurality of polymerases to be tested.

In certain embodiments, in step (a), 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30 are provided , 40, 50, or more polymerases.

In certain embodiments, in step (a), at least 2 polymerases are provided (eg, a first polymerase, a second polymerase). The first polymerase performs an amplification reaction on the sample containing nucleic acid molecules and obtains a first amplification product. The detection probe can hybridize to the region of the first amplification product, and passes through the first melting peak and the first Rm value. The second polymerase amplifies the sample containing nucleic acid molecules and obtains a second amplification product, the detection probe can hybridize to the region of the second amplification product, and generates a second melting peak and a second Rm value . When the first Rm value is greater than the second Rm value, the activity of the first polymerase is stronger than that of the second polymerase. When the second Rm value is greater than the first Rm value, the activity of the second polymerase is stronger than that of the first polymerase. Therefore, by comparing the magnitudes of different Rm values, the activities of various polymerases can be judged.

In certain embodiments, in step (d), the melting peak peak height (Rm), or raw data for the melting curve (eg, _Tm value, corresponding to the fluorescence signal value of the fluorescence channel), is obtained by a real-time fluorescent PCR instrument A calculation was performed to obtain the melting peak height (Rm).

In certain embodiments, the melting peak peak height (Rm) is determined by the analysis software (eg, SLAN Fully Automatic Medical PCR Analysis System 8.2.2) of a fluorescence PCR instrument (eg, Hongshi fluorescence PCR instrument SLAN-96S/48P). Automatic output. Specifically, the slope of the tangent line is calculated by derivation of the melting curve. The maximum change in the slope of the tangent line is the peak and valley of the melting peak. The peak and valley located on the left side of the melting peak are defined as the starting point. The peak and valley on the side is defined as the end point. Connect the start point and end point of the peak of the melting curve into a line, and use the highest point of the peak as an extension line in the vertical direction. The distance between the intersection of the two and the highest point of the peak is the output of the analysis software. The Rm value.

In certain embodiments, the melting peak peak height (Rm) is determined by the raw data (eg, melting curve, _Tm ) output by a fluorescent PCR instrument (eg, fluorescent PCR instrument BioRad CFX96, fluorescent PCR instrument Roche LightCycler 480) and its accompanying software value, corresponding to the fluorescence signal value of the fluorescence channel) is calculated.

In certain embodiments, in step (a) or (b) of the method, deoxynucleoside triphosphates (dNTPs), water, a solution containing ions (eg, Mg ²⁺ ), single-stranded DNA binding are further provided protein, or any combination thereof.

In certain embodiments, the sample comprises or is DNA, RNA, or any combination thereof.

In certain embodiments, the nucleic acid molecule is selected from DNA, RNA, or any combination thereof.

In certain embodiments, the amplification product is selected from DNA, RNA, or any combination thereof. In certain embodiments, the amplification product is RNA.

In certain embodiments, the sample is derived from eukaryotes (eg, animals, plants, fungi), prokaryotes (eg, bacteria, actinomycetes), viruses, bacteriophages, or any combination thereof.

In certain embodiments, the polymerases are each independently selected from DNA polymerases, RNA polymerases, or any combination thereof.

In certain embodiments, the polymerase is a DNA polymerase, each independently obtained from a bacterium selected from the group consisting of: Thermus aquaticus (Taq), Thermus thermophiles (Tth), Thermus filiformis, Thermis flavus, Thermococcus Thermus antranildanii,Thermus caldophllus,Thermus chliarophilus,Thermus flavus,Thermus igniterrae,Thermus lacteus,Thermus oshimai,Thermus ruber,Thermus rubens,Thermus scotoductus,Thermus silvanus,Thermus thermophllus,Thermotoga maritima,Thermotoga litoraripolitana,Thermosphos Thermococcus barossi, Thermococcus gorgonarius, Thermotoga maritima, Thermotoga neapolitana, Thermosiphoafricanus, Pyrococcus woesei, Pyrococcus horikoshii, Pyrococcus abyssi, Pyrodictium occultum, Aquifexpyrophilus and Aquifex aeoolieus.

In certain embodiments, the polymerase is a DNA polymerase, each independently selected from the group consisting of Bst DNA polymerase, T7 DNA polymerase, phi29 DNA polymerase, T4 DNA polymerase, T5 DNA polymerase , Pfu DNA polymerase, vent DNA polymerase or any combination thereof.

In certain embodiments, the polymerase is a DNA polymerase including reverse transcriptase.

In certain embodiments, the polymerase is a reverse transcriptase, each independently selected from the group consisting of MMLV reverse transcriptase, AMV reverse transcriptase, HIV reverse transcriptase, or any combination thereof.

In certain embodiments, wherein, in step (a) of the method, for each nucleic acid molecule, at least one pair of primer sets is provided, the primer set comprising at least one forward primer and at least one reverse primer .

In certain embodiments, wherein the forward primer and reverse primer each independently comprise or consist of naturally occurring nucleotides, modified nucleotides, non-natural nucleotides, or any combination thereof .

In certain embodiments, wherein, in step (b) of the method, for each amplification product, at least one detection probe is provided (eg, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more detection probes).

In certain embodiments, each detection probe and the double-stranded hybrid formed by the amplification product have different melting points ( _Tm ); in certain embodiments, the detection probe and all The melting point (T _m ) between the double-stranded hybrids formed by the amplification products of the nucleic acid molecules differs by more than 1°C (eg, 1°C, 2°C, 3°C).

In certain embodiments, the detection probes each independently comprise or consist of naturally occurring nucleotides (eg, deoxyribonucleotides or ribonucleotides), modified nucleotides, non-natural nucleosides acid (eg, peptide nucleic acid (PNA) or locked nucleic acid), or any combination thereof.

In certain embodiments, the detection probes are each independently 15-1000nt in length, eg, 15-20nt, 20-30nt, 30-40nt, 40-50nt, 50-60nt, 60-70nt, 70-80nt , 80-90nt, 90-100nt, 100-200nt, 200-300nt, 300-400nt, 400-500nt, 500-600nt, 600-700nt, 700-800nt, 800-900nt, 900-1000nt.

In certain embodiments, the detection probes each independently have a 3'-OH terminus; alternatively, the 3'-terminus of the detection probes is blocked; Add a chemical moiety (eg, biotin or alkyl) to the 3'-OH of the acid by removing the 3'-OH of the last nucleotide of the detection probe, or by replacing the last nucleotide with a double deoxynucleotides, thereby blocking the 3'-end of the detection probe.

In certain embodiments, in step (d), the product of step (c) is gradually heated or cooled and the signal emitted by the reporter group on each detection probe is monitored in real time, thereby obtaining each A curve of the signal intensity of the reporter group as a function of temperature; the curve is then derived to obtain a melting curve for the product of step (d).

In certain embodiments, the reporter group and the quencher group are separated by a distance of 10-80 nt or more.

In certain embodiments, the reporter groups in the detection probe are each independently a fluorophore (eg, ALEX-350, FAM, VIC, TET, CAL

Gold 540, JOE, HEX, CAL Fluor Orange 560, TAMRA, CAL Fluor Red 590, ROX, CAL Fluor Red 610, TEXAS RED, CAL Fluor Red 635, Quasar 670, CY3, CY5, CY5.5, Quasar 705); and , a quenching group is a molecule or group capable of absorbing/quenching the fluorescence (eg, DABCYL, BHQ (eg, BHQ-1 or BHQ-2), ECLIPSE, and/or TAMRA).

In certain embodiments, the detection probes each independently have the same or different reporter groups. In certain embodiments, the detection probes each independently have the same or different quencher groups.

In certain embodiments, the detection probes are each independently resistant to nuclease activity (eg, 5' nuclease activity, eg, 5' to 3' exonuclease activity); eg, the detection probes The backbone of the needle contains modifications that resist nuclease activity, such as phosphorothioate linkages, alkyl phosphotriester linkages, aryl phosphotriester linkages, alkyl phosphonate linkages, arylphosphonate linkages, hydrophosphates bond, alkyl phosphoramidate bond, aryl phosphoramidate bond, 2'-O-aminopropyl modification, 2'-O-alkyl modification, 2'-O-allyl modification, 2'-O- Butyl modification, and 1-(4'-thio-PD-ribofuranosyl) modification.

In certain embodiments, the detection probes are each independently linear, or have a hairpin structure.

In a second aspect of the present application, there is provided a kit comprising: one or more nucleic acid molecules, at least one pair of primer sets capable of amplifying the nucleic acid molecules, and at least one detection probe needle, the detection probe is capable of hybridizing or annealing to an amplification product of a nucleic acid molecule, and the detection probe is labeled with a reporter group and a quencher group, wherein the reporter group is capable of signaling, and, the quenching group is capable of absorbing or quenching the signal emitted by the reporter group; and the detection probe emits a different signal when hybridized to its complementary sequence than when it is not hybridized to its complementary sequence signal of.

In certain embodiments, the kit further comprises: a polymerase, deoxynucleoside triphosphates (dNTPs), water, a solution containing ions (eg, ^Mg2+ ), a single-stranded DNA binding protein, or any combination thereof.

In certain embodiments, the nucleic acid molecule is selected from DNA, RNA, or any combination thereof.

In certain embodiments, the sample is derived from eukaryotes (eg, animals, plants, fungi), prokaryotes (eg, bacteria, actinomycetes), viruses, bacteriophages, or any combination thereof.

In certain embodiments, the nucleic acid molecule is lambda DNA.

In certain embodiments, the primer set comprises at least one forward primer and at least one reverse primer.

In certain embodiments, the forward primer and reverse primer each independently comprise or consist of naturally occurring nucleotides, modified nucleotides, non-natural nucleotides, or any combination thereof.

In certain embodiments, the primers of the primer set have the nucleotide sequences set forth in SEQ ID NO:1 and SEQ ID NO:2.

In certain embodiments, at least one detection probe is provided for each nucleic acid molecule (eg, 1, 2, 3, 4, 5, 6, 7, 8, 9 are provided , 10, or more detection probes).

In certain embodiments, the detection probe is as previously defined.

In certain embodiments, the detection probe has the nucleotide sequence set forth in SEQ ID NO:3.

In certain embodiments, the polymerases are each independently selected from DNA polymerases, RNA polymerases, or any combination thereof.

In certain embodiments, the polymerase is a DNA polymerase, each independently obtained from a bacterium selected from the group consisting of: Thermus aquaticus (Taq), Thermus thermophiles (Tth), Thermus filiformis, Thermis flavus, Thermococcus Thermus antranildanii,Thermus caldophllus,Thermus chliarophilus,Thermus flavus,Thermus igniterrae,Thermus lacteus,Thermus oshimai,Thermus ruber,Thermus rubens,Thermus scotoductus,Thermus silvanus,Thermus thermophllus,Thermotoga maritima,Thermotoga litoraripolitana,Thermosphos Thermococcus barossi, Thermococcus gorgonarius, Thermotoga maritima, Thermotoga neapolitana, Thermosiphoafricanus, Pyrococcus woesei, Pyrococcus horikoshii, Pyrococcus abyssi, Pyrodictium occultum, Aquifexpyrophilus and Aquifex aeoolieus.

In certain embodiments, the polymerase is a DNA polymerase, each independently selected from the group consisting of Bst DNA polymerase, T7 DNA polymerase, phi29 DNA polymerase, T4 DNA polymerase, T5 DNA polymerase , Pfu DNA polymerase, vent DNA polymerase or any combination thereof.

In certain embodiments, the polymerase is a DNA polymerase including reverse transcriptase.

In certain embodiments, the polymerase is a reverse transcriptase, each independently selected from the group consisting of MMLV reverse transcriptase, AMV reverse transcriptase, HIV reverse transcriptase, or any combination thereof.

In certain embodiments, the kits are used to detect one or more (eg, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 species, 20 species, 30 species, 40 species, 50 species, or more polymerases) polymerase activity.

Definition of Terms

In the present invention, unless otherwise specified, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. In addition, the operation steps such as molecular genetics, nucleic acid chemistry, chemistry, molecular biology, biochemistry, cell culture, microbiology, cell biology, genomics and recombinant DNA used in this paper are conventional steps widely used in the corresponding fields. . Meanwhile, for a better understanding of the present invention, definitions and explanations of related terms are provided below.

As used herein, the term "melting peak height (Rm)" can be used to characterize the nucleic acid content to be determined in a system, and the Rm value is proportional to the amount of product within a certain concentration range. The slope of the tangent line is calculated by derivation of the melting curve, the maximum change of the slope of the tangent line is defined as the peak valley of the melting peak, the peak valley located on the left side of the melting peak is defined as the starting point, and the peak located on the right side of the melting peak is defined as the starting point. The valley is defined as the end point, and the start point and end point of the peak of the melting curve are connected into a line, and the highest point of the peak is used as an extension line in the vertical direction. The distance between the intersection of the two and the highest point of the peak is the Rm value.

As used herein, the term "amplification product" refers to an amplified nucleic acid produced by amplifying a nucleic acid template.

As used herein, the term "polymerase", also known as polymerase, is a general term for a class of enzymes specialized in the biocatalytic synthesis of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). It can be divided into the following groups: (1) DNA-dependent DNA polymerases; (2) RNA-dependent DNA polymerases; (3) DNA-dependent RNA polymerases; (4) RNA-dependent RNA polymerases. Among them, the first two are DNA polymerases, and the latter two are RNA polymerases. As used herein, the term "DNA polymerase" refers to an enzyme that uses a nucleic acid strand as a template to synthesize DNA strands. DNA polymerases use existing DNA or RNA as a template to synthesize DNA. In the methods of the present invention, the DNA polymerase may be a naturally occurring DNA polymerase, or a variant or fragment of a natural enzyme having the above-mentioned activities. As used herein, the term "RNA polymerase" refers to an enzyme that uses nucleic acid strands as templates to synthesize RNA strands. RNA polymerases use existing DNA or RNA as templates to synthesize RNA. In the methods of the present invention, the RNA polymerase may be a naturally occurring RNA polymerase, or a variant or fragment of a natural enzyme having the above-mentioned activities.

As used herein, the term "reverse transcriptase" refers to an enzyme capable of replicating RNA into complementary DNA or cDNA. Reverse transcription is the process of copying an RNA template into DNA. In the methods of the present invention, the reverse transcriptase can be a naturally occurring RNA polymerase, or a variant or fragment that retains the above-mentioned activities.

As used herein, and as commonly understood by those of skill in the art, the terms "forward" and "reverse" are used only for convenience in describing and distinguishing two primers in a primer pair; they are relative, does not have a special meaning.

As used herein, the terms "targeting sequence" and "target-specific sequence" refer to those capable of selectively/specifically hybridizing or annealing to a target nucleic acid sequence under conditions that permit hybridization, annealing, or amplification of the nucleic acid. A sequence comprising a sequence complementary to a target nucleic acid sequence. In this application, the terms "targeting sequence" and "target-specific sequence" have the same meaning and are used interchangeably. It is readily understood that a targeting sequence or target-specific sequence is specific for a target nucleic acid sequence. In other words, a targeting sequence or target-specific sequence only hybridizes or anneals to a specific target nucleic acid sequence, and not to other nucleic acid sequences, under conditions that allow nucleic acid hybridization, annealing, or amplification.

As used herein, the term "complementary" means that two nucleic acid sequences are capable of forming hydrogen bonds with each other according to the principles of base pairing (Waston-Crick principle), and thereby forming duplexes. In this application, the term "complementary" includes "substantially complementary" and "completely complementary". As used herein, the term "completely complementary" means that every base in one nucleic acid sequence is capable of pairing with bases in another nucleic acid strand without mismatches or gaps. As used herein, the term "substantially complementary" means that a majority of bases in one nucleic acid sequence are capable of pairing with bases in the other nucleic acid strand, allowing for mismatches or gaps (eg, one or mismatches or gaps of several nucleotides). Typically, two nucleic acid sequences that are "complementary" (eg, substantially complementary or fully complementary) will selectively/specifically hybridize or anneal under conditions that allow nucleic acid hybridization, annealing, or amplification, and form a duplex . Accordingly, the term "non-complementary" means that two nucleic acid sequences cannot hybridize or anneal under conditions that permit hybridization, annealing, or amplification of the nucleic acids to form a duplex. As used herein, the term "not perfectly complementary" means that bases in one nucleic acid sequence cannot perfectly pair with bases in another nucleic acid strand, at least one mismatch or gap exists.

As used herein, the terms "hybridization" and "annealing" mean the process by which complementary single-stranded nucleic acid molecules form a double-stranded nucleic acid. In this application, "hybridization" and "annealing" have the same meaning and are used interchangeably. Typically, two nucleic acid sequences that are completely complementary or substantially complementary can hybridize or anneal. The complementarity required for hybridization or annealing of two nucleic acid sequences depends on the hybridization conditions used, in particular the temperature.

As used herein, the term "PCR reaction" has the meaning commonly understood by those skilled in the art, which refers to a reaction (polymerase chain reaction) that amplifies a target nucleic acid using a nucleic acid polymerase and primers.

As used herein, the term "detection probe" refers to an oligonucleotide labeled with a reporter group and a quencher group. When the probe is not hybridized to other sequences, the quencher group is positioned to absorb the signal of the quenched reporter group (eg, the quencher group is located adjacent to the reporter group), thereby absorbing or quenching the reporter group signal sent. In this case, the probe does not emit a signal. Further, when the probe is hybridized to its complementary sequence, the quencher group is located in a position that cannot absorb or quench the signal of the reporter group (eg, the quencher group is located away from the reporter group), so that it cannot absorb or quench the signal of the reporter group. Quench the signal from the reporter group. In this case, the probe emits a signal.

As used herein, the term "melting curve analysis" has the meaning commonly understood by those skilled in the art and refers to the analysis of the presence or identity of a double-stranded nucleic acid molecule by determining the melting curve of the double-stranded nucleic acid molecule. method, which is commonly used to assess the dissociation characteristics of double-stranded nucleic acid molecules during heating. Methods for performing melting curve analysis are well known to those skilled in the art (see, eg, The Journal of Molecular Diagnostics 2009, 11(2):93-101). In this application, the terms "melting curve analysis" and "melting analysis" have the same meaning and are used interchangeably.

In certain preferred embodiments of the present application, melting curve analysis can be performed by using a self-quenching probe labeled with a reporter group and a quencher group. Briefly, at ambient temperature, probes are capable of forming duplexes with their complementary sequences through base pairing. In this case, the reporter group (such as a fluorophore) and the quencher group on the probe are separated from each other, and the quencher group cannot absorb the signal (such as a fluorescent signal) emitted by the reporter group. At this time, it is possible to detect The strongest signal (eg fluorescent signal). As the temperature increases, the two strands of the duplex begin to dissociate (ie, the probe gradually dissociates from its complementary sequence), and the dissociated probe assumes a single-stranded free coil state. In this case, the reporter group (eg, fluorophore) and the quencher group on the dissociated probe are in close proximity to each other, whereby the signal (eg, fluorescent signal) emitted by the reporter group (eg, fluorophore) is absorbed by the quenching group. Therefore, as the temperature increases, the detected signal (eg, the fluorescent signal) gradually becomes weaker. When the two strands of the duplex are completely dissociated, all probes are in a single-stranded free coil state. In this case, all of the signal (eg, fluorescent signal) emitted by the reporter group (eg, fluorophore) on the probe is absorbed by the quencher group. Thus, the signal (eg, fluorescent signal) emitted by the reporter group (eg, fluorophore) is substantially undetectable. Therefore, by detecting the signal (such as a fluorescent signal) emitted by the duplex containing the probe during the heating or cooling process, the hybridization and dissociation process of the probe and its complementary sequence can be observed, and the signal intensity changes with temperature. changing curve. Further, by derivation analysis of the obtained curve, a curve with the change rate of signal intensity as the ordinate and the temperature as the abscissa (ie, the melting curve of the duplex) can be obtained. The peak in the melting curve is the melting peak, and the corresponding temperature is the melting point (T _m ) of the duplex. In general, the more closely the probe matches the complementary sequence (eg, fewer mismatched bases and more paired bases), the higher the _Tm of the duplex. Thus, from the _Tm of the duplex, the presence and identity of the sequence complementary to the probe in the duplex can be determined. Herein, the terms "melting peak", "melting point" and " _Tm " have the same meaning and are used interchangeably.

In certain preferred embodiments of the present application, melting curve analysis can be performed by using detection probes labeled with reporter and quencher groups. The detection principle is the same as above.

Beneficial Effects of Invention

The detection method of the present application is different from the traditional detection methods in the past, and a method for detecting the activity of one or more polymerases is realized by using melting curve analysis. In particular, the method of the present application can simultaneously determine the activities of multiple polymerases. Moreover, the operation is simple and the steps are simple, and the activity of the polymerase can be roughly judged while saving the detection time.

The embodiments of the present invention will be described in detail below with reference to the drawings and examples, but those skilled in the art will understand that the following drawings and examples are only used to illustrate the present invention, rather than limit the scope of the present invention. Various objects and advantageous aspects of the present invention will become apparent to those skilled in the art from the accompanying drawings and the following detailed description of the preferred embodiments.

Description of drawings

Figure 1 shows a schematic diagram of the melting peak-to-peak (Rm) calculation method.

Figure 2 shows the results of the assay of the activity of MMLV-L139P using the method of the present invention.

Figure 3 shows the results of assaying the activity of MMLV-L435G/D524A using the method of the present invention.

Figure 4 shows the results of the assay of the activity of MMLV-E302K/D524A using the method of the present invention.

Figure 5 shows the results of assaying the activity of MMLV-D524A using the method of the present invention.

Figure 6 shows the results of assays for the activity of MMLV-D524A/E562K using the method of the present invention.

Detailed ways

The present invention will now be described with reference to the following examples, which are intended to illustrate, but not limit, the invention.

Unless otherwise indicated, the experiments and methods described in the Examples were performed essentially according to conventional methods well known in the art and described in various references. For example, conventional techniques of biochemistry, molecular biology, genomics and recombinant DNA used in the present invention can be found in Sambrook, Fritsch and Maniatis, " MOLECULAR CLONING: A LABORATORY MANUAL, 2nd editor (1989); CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (F.M. Ausubel et al.) Editor, (1987)); "METHODS IN ENZYMOLOGY" series (Academic Publishing Company): "PCR 2: A PRACTICAL APPROACH" (M.J. MacPherson), B.D. Edited by B.D. Hames and G.R. Taylor (1995)).

In addition, if the specific conditions are not indicated in the examples, it is carried out according to the conventional conditions or the conditions suggested by the manufacturer. The reagents or instruments used without the manufacturer's indication are conventional products that can be obtained from the market. Those skilled in the art appreciate that the examples describe the invention by way of example and are not intended to limit the scope of the invention as claimed. All publications and other references mentioned herein are incorporated by reference in their entirety.

Example 1

In this example, nucleic acid fragments of known length are constructed in advance, and the method of the present invention is applied to detect the length of the constructed DNA fragments, so as to verify the feasibility and accuracy of the method of the present invention.

1. Construction of DNA fragments to be tested

In this example, λ DNA (purchased from Life technologies (Shanghai)) was used as a template to construct DNA fragments, and the length of the constructed DNA fragments was 2024 bp. The PCR method and corresponding primers were used for amplification, wherein the primers used are shown in Table 1. The enzyme used for PCR amplification is 2xTaKaRa Taq ^™ HS Perfect Mix (purchased from TaKaRa). The specific reaction system is shown in Table 2, and the reaction program is shown in Table 3.

Table 1. Primers and sequences used

primer name	Sequence (5'-3')	SEQ ID NO:
λDNA-F	TAATACGACTCACTATAGGGACAGGTGCTGAAAGCGAG	1
λDNA-2024-R	CAGCGTCTGTTCATCGTCGTG	2

Table 2. PCR reaction system for constructing 2024bp fragments

reactive components	Volume (μL)
λDNA template	5
2xTaKaRa Taq TM HS Perfect Mix	25
50μM λDNA-F	0.2
50μM λDNA-2024-R	0.2
RNase Free Water	19.6

Table 3. Reaction program for PCR

2. Fragment determination and analysis

According to the nucleotide sequence of the product amplified by the primers, design probe 1 that binds to the amplified product. Probe 1 can bind to the 1152nt to 1189 nt of the nucleotide sequence of the amplified product. The specific sequence is shown in Table 4. .

Table 4. Sequences of probes

Using detection probe 1, the amount of amplified product was determined by melting curve analysis. In short, after denaturing the amplified product obtained above at high temperature, the probe is hybridized with it at a lower temperature, and by gradually increasing the temperature and detecting its fluorescence signal, the analysis software supporting the fluorescence PCR instrument can calculate and analyze the corresponding value. The melting peak-to-peak value (Rm value). The schematic diagram of the Rm value is shown in Figure 1. Specifically, the slope of the tangent line is calculated by derivation of the melting curve. The maximum change of the slope of the tangent line is defined as the peak valley of the melting peak, and the peak valley located on the left side of the melting peak is defined. As the starting point, the peak valley on the right side of the melting peak is defined as the ending point, and the starting point and the ending point of the melting curve peak are connected into a line, and the highest point of the peak is used as a vertical extension line, and the distance between the intersection points The distance from the highest point of the peak is the Rm value. The Rm value is proportional to the amount of the product within a certain concentration range, and can be used to characterize the nucleic acid content to be determined in the system. The Rm value in this example is automatically output by the analysis software SLAN automatic medical PCR analysis system 8.2.2 which is matched with the Hongshi fluorescence PCR instrument (SLAN-96S/48P).

The reaction procedure for detection is shown in Table 5, and the detection system used is shown in Table 6. The preparation process of the system was operated on ice, and the prepared reaction system was placed in a fluorescence quantitative PCR instrument for reaction. Wherein, the formula of 10× PCR buffer is: (NH ₄ ) ₂ SO ₄ 21.142 g, Tris 81.164 g, Tween-20 1.0 mL, pH 8.8.

Table 5. Reaction Procedures for DNA Fragment Detection

Table 6. Reaction Procedures for DNA Fragment Detection

reactive components	Volume (μL)
10x PCR buffer	2.5
MgCl 2 (25mM)	1.5

5 μM Probe 1 (1152-1189)	2
DNA fragment of interest	12.5
RNase Free Water	6.5

The measurement results of the amplified products are shown in FIG. 1 . The solid black line is the melting peak of the detected amplification product. The Rm value output by the software of the fluorescence PCR instrument is 92.90. The experimental results of this embodiment prove that the method of the present invention can detect the amplification product and the amount of the amplification product, and the detection result is accurate.

Example 2

In this example, λ DNA (purchased from Life technologies (Shanghai)) was used as a template, and five kinds of reverse transcriptases were used for amplification reaction, and the method of the present invention and the traditional enzyme activity assay method were used to measure the activities of five kinds of reverse transcriptases respectively. Compare.

1. Construction of target RNA fragments

The construction of the target RNA fragment uses the HiScribe T7 fast and efficient RNA synthesis kit (purchased from NEB Company, Beijing), and the specific transcription reaction system is shown in Table 7:

Table 7. Reaction system for constructing target RNA fragments

reactive components	Volume (μL)
10xReaction Buffer	2
100mM ATP	2
100mM TTP	2
100mM GTP	2
100mM CTP	2
DNA fragment of interest	8

2. The method of the present invention measures the activity of the enzyme

Utilize the method of the present invention to use MMLV standard strains and five MMLV mutants or combinations (D524A/E562K, D524A, E302K/D524A, L435G/D524A and L139P) for determination (for the construction process and specific sequences of MMLV standard strains, see Yu, Chen, Weiguo, et al. A novel and simple method for high-level production of reverse transcriptase from Moloney murine leukemia virus(MMLV-RT) in Escherichia coli[J]. Biotechnology Letters, 2009; MMLV mutants D524A, E302K and L435G See Yasukawa K, Mizuno M, Konishi A, et al.Increase in thermal stability of Moloney murine leukaemia virus reverse transcriptase by site-directed mutagenesis [J].Journal of Biotechnology, 2010,150(3): 299-306; For the construction process and specific sequence of MMLV mutant L139P, see Bahram A, Holly H. Novel mutations in Moloney Murine Leukemia Virus reverse transcriptase increase thermostability through tighter binding to template-primer[J].Nuclc Acids Research,2009,37 (2): 473-481. (L139P corresponds to the literature); MMLV mutants D524A/E562K, D524A, E302K/D524A, L435G/D524A The construction process and specific sequences refer to Konishi, Atsushi, Hisayoshi, Tetsuro, Yokokawa, Kanta, et al. al.Amino acid substitutions away from the RNase H catalytic site increase the thermal stability of Moloney murine leukem ia virus reverse transcriptase through RNase H inactivation[J].Biochemical&Biophysical Research Communications,2014,454(2):269-274). Amplify the target fragment by reverse transcription, the reverse transcription system is shown in Table 8, and the reverse transcription reaction conditions are shown in Table 9.

Table 8. Reverse transcription reaction system

component	Dosage (μl)
5x MMLV Buffer	4
MMLV	1
50 μM λDNA-F	1
target RNA fragment	1.2
RNase Free Water	12.8

Table 9. Reverse Transcription Reaction Conditions

temperature	time
42℃	30min
85℃	1min

After the reaction was completed, the amounts of the amplified products of the five reverse transcriptases were measured by the method of the present invention. The specific experimental process is as described in Example 1. In short, 12.5 μL of the product was added to the PCR reaction tube to be tested, the detection probe 1 was combined with the product, and the products amplified by the five enzymes were calculated by melting curve analysis. The Rm values of the 5 products are shown in Figures 2 to 5, respectively, and the specific Rm values are shown in Table 12.

3. Determination of enzyme activity by traditional methods

First, 5 kinds of reverse transcriptases were used to carry out reverse transcription amplification of the target RNA fragments respectively. The reaction program of reverse transcription reaction was shown in Table 9, and the reaction system was shown in Table 10. The 5x MMLV Buffer contained 250mM Tris-HCl, pH8. 3, 375 mM KCl, 15 mM _MgCl2 . Using 1×MMLV enzyme stock solution (20mM Tris-HCl, pH7.8, 100mM NaCl, 1mM EDTA, 1mM DTT, 50% glycerol (v/v)), the five MMLV mutants to be tested and MMLV standard The strains were diluted to 10ng/μL, 5ng/μL, 2.5ng/μL in turn, and kept on ice for later use. 2 μL of diluted MMLV mutants, MMLV standard strains or 1×MMLV enzyme stock solution (control) at different concentrations were added to the reaction system. Gently pipet and mix 5 times with a 10 μL pipette. Avoid bubbles during operation. Place the reaction solution in a microcentrifuge and centrifuge briefly for 3 seconds. After the reaction, the product was diluted 10 times, and then added to the aliquoted reaction tubes, 25 μL per well.

Table 10. Reverse transcription reaction system

component	Dosage
5x MMLV Buffer	4
reverse transcriptase or control	2
50 μM λDNA-F	1
target RNA fragment	1.2
RNase Free Water	11.8

Then, the activities of the five reverse transcriptases were measured by PCR method, and the reaction solution for detecting the enzyme activities was prepared using Quant-iT ^TM PicoGreen ^TM dsDNA Assay Kit, which was purchased from Invitrogen, product number P7589, according to the kit instructions. The reaction was carried out on a Hongshi fluorescence PCR instrument (SLAN-96S/48P), and the fluorescence signal was collected at the end of the reaction, and the end-point fluorescence signal was automatically output using the analysis software (SLAN automatic medical PCR analysis system 8.2.2). Calculate the difference between the fluorescence value of the MMLV mutant and the control fluorescence value, denoted as S1; calculate the difference between the fluorescence value of the MMLV standard strain and the control fluorescence value, denoted as S2; use the ratio of S1/S2 as the enzyme activity.

4. Test results

Table 11 shows the results of the detection of five reverse transcriptases by two methods. The results of the detection and differentiation of the activities of the five reverse transcriptases by the method of the present invention are as follows: the activities of D524A/E562K, D524A, E302K/D524A, L435G/D524A and L139P increase in sequence. The distinction results are consistent. Moreover, the detection purpose can be achieved quickly and simply by using the method of the present invention.

Table 11. Enzyme activity test results

mutant	Enzyme activity	Rm
MMLV-D524A/E562K	1.43	24.91
MMLV-D524A	1.75	26.89
MMLV-E302K/D524A	1.93	47.19
MMLV-L435G/D524A	2.41	51.62
MMLV-L139P	2.83	91.56

Although specific embodiments of the present invention have been described in detail, those skilled in the art will appreciate that various modifications and changes can be made to the details in light of all the teachings that have been published, and that these changes are all within the scope of the present invention . The full division of the invention is given by the appended claims and any equivalents thereof.

Claims (11)

1. A method of detecting the activity of one or more polymerases, the method comprising:

   (a) providing a sample containing a nucleic acid molecule, a primer set capable of amplifying the nucleic acid molecule, and providing one or more polymerases to be detected;

   (b) providing at least one detection probe labeled with a reporter group and a quencher group, wherein the reporter group can emit a signal, and the quencher group can absorb or quench the signal emitted by the reporter group; and the detection probe emits a signal when hybridized to its complementary sequence that is different from the signal emitted when it is not hybridized to its complementary sequence; under conditions that allow nucleic acid hybridization or annealing Under the following conditions, the detection probe can specifically hybridize to a designated region of the nucleic acid molecule;

   (c) using the polymerase and primer set to amplify the nucleic acid molecule to obtain an amplification product, and using the detection probe to perform melting curve analysis on the amplification product respectively;

   (d) obtaining the melting peak height (Rm) of the amplification product according to the melting curve analysis result of step (c), so as to analyze the activity of one or more polymerases.
2. The method of claim 1, wherein, in step (c), the nucleic acid molecule is mixed with the polymerase and the primer set, and amplified, and then, after the amplification, the detection probe is added to the into the product of step (b), and performing melting curve analysis; or, in step (b), mixing the nucleic acid molecule with the polymerase, the primer set and the detection probe, and performing amplification. increase, and then, after the end of amplification, perform melting curve analysis.
3. The method of claim 1 or 2 having one or more of the following features:

   (1) in step (d), by comparing the melting peak heights (Rm) of the amplification products of the multiple polymerases to be tested, thereby analyzing the activities of multiple polymerases;

   (2) In step (a), provide 1 type, 2 types, 3 types, 4 types, 5 types, 6 types, 7 types, 8 types, 9 types, 10 types, 20 types, 30 types, 40 types, 50 or more polymerases;

   (3) In step (d), the melting peak height (Rm) is obtained by a real-time fluorescent PCR instrument, or the original data of the melting curve (for example, the _Tm value, the fluorescence signal value of the corresponding fluorescence channel) is calculated to obtain melting Peak-to-peak height (Rm).
4. The method of any one of claims 1-3, in step (a) or (b) of the method, further providing deoxynucleoside triphosphates (dNTPs), water, containing ions (eg Mg ²⁺ ) solution, single-stranded DNA binding protein, or any combination thereof.
5. The method of any one of claims 1-4, wherein the method has one or more technical features selected from the following:

   (1) the sample comprises or is DNA, RNA, or any combination thereof;

   (2) the nucleic acid molecule is selected from DNA, RNA, or any combination thereof;

   (3) the amplification product is selected from DNA, RNA, or any combination thereof; preferably, the amplification product is RNA;

   (4) The sample is derived from eukaryotes (eg, animals, plants, fungi), prokaryotes (eg, bacteria, actinomycetes), viruses, bacteriophages, or any combination thereof.
6. The method of any one of claims 1-5, wherein the polymerase has one or more technical characteristics selected from the group consisting of:

   (1) The polymerases are each independently selected from DNA polymerases, RNA polymerases, or any combination thereof;

   (2) The polymerase is a DNA polymerase each independently obtained from a bacterium selected from the group consisting of: Thermus aquaticus (Taq), Thermus thermophiles (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, Thermus antranildanii ,Thermus caldophllus,Thermus chliarophilus,Thermus flavus,Thermus igniterrae,Thermus lacteus,Thermus oshimai,Thermus ruber,Thermus rubens,Thermus scotoductus,Thermus silvanus,Thermus thermophllus,Thermotoga maritima,Thermotoga neapolitana,Thermosipho africanus,Thermococcus litoralis,Thermococcus barossi,Thermococcus gorgonarius, Thermotoga maritima, Thermotoga neapolitana, Thermosiphoafricanus, Pyrococcus woesei, Pyrococcus horikoshii, Pyrococcus abyssi, Pyrodictium occultum, Aquifexpyrophilus and Aquifex aeoolieus;

   (3) The polymerase is a DNA polymerase, and the DNA polymerases are each independently selected from Bst DNA polymerase, T7 DNA polymerase, phi29 DNA polymerase, T4 DNA polymerase, T5 DNA polymerase, Pfu DNA polymerase Enzyme, vent DNA polymerase or any combination thereof;

   (4) the polymerase is a DNA polymerase, and the DNA polymerase includes a reverse transcriptase;

   (5) The polymerase is a reverse transcriptase, each independently selected from the group consisting of MMLV reverse transcriptase, AMV reverse transcriptase, HIV reverse transcriptase, or any combination thereof.
7. The method of any one of claims 1-6, wherein, in step (a) of the method, for each nucleic acid molecule, at least one pair of primer sets is provided, the primer set comprising at least one forward primer and at least one reverse primer.
8. The method of claim 7, wherein the forward primer and the reverse primer each independently comprise or consist of naturally occurring nucleotides, modified nucleotides, non-natural nucleotides, or any combination thereof composition.
9. The method of any one of claims 1-8, wherein, in step (b) of the method, for each amplification product, at least one detection probe is provided (for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more detection probes).
10. The method of any one of claims 1-9, wherein the detection probe has one or more technical features selected from the group consisting of:

    (1) Each detection probe and the double-stranded hybrid formed by the amplification product have different melting points ( _Tm ); preferably, the detection probe and the amplification product of the nucleic acid molecule have different melting points (Tm). The melting point ( _Tm ) between the formed double-stranded hybrids differs by more than 1°C (eg, 1°C, 2°C, 3°C);

    (2) The detection probes each independently comprise or consist of naturally occurring nucleotides (such as deoxyribonucleotides or ribonucleotides), modified nucleotides, non-natural nucleotides (such as peptides) nucleic acid (PNA) or locked nucleic acid), or any combination thereof;

    (3) The lengths of the detection probes are each independently 15-1000nt, such as 15-20nt, 20-30nt, 30-40nt, 40-50nt, 50-60nt, 60-70nt, 70-80nt, 80-90nt , 90-100nt, 100-200nt, 200-300nt, 300-400nt, 400-500nt, 500-600nt, 600-700nt, 700-800nt, 800-900nt, 900-1000nt;

    (4) The detection probes each independently have a 3'-OH terminus; alternatively, the 3'-terminus of the detection probe is blocked; The addition of a chemical moiety (eg, biotin or alkyl) to the -OH by removing the 3'-OH of the last nucleotide of the detection probe, or replacing the last nucleotide with a dideoxynucleotide , thereby blocking the 3'-end of the detection probe;

    (5) in step (d), the product of step (c) is gradually heated or cooled and the signal emitted by the reporter group on each detection probe is monitored in real time, so as to obtain the signal of each reporter group a curve of signal intensity as a function of temperature; then, the curve is derived to obtain the melting curve of the product of step (d);

    (6) the reporter group and the quenching group are separated by a distance of 10-80nt or longer;

    (7) The reporter groups in the detection probe are each independently a fluorescent group (for example, ALEX-350, FAM, VIC, TET, CAL

    

    Gold 540, JOE, HEX, CAL Fluor Orange 560, TAMRA, CAL Fluor Red 590, ROX, CAL Fluor Red 610, TEXAS RED, CAL Fluor Red 635, Quasar 670, CY3, CY5, CY5.5, Quasar 705); and , the quenching group is a molecule or group capable of absorbing/quenching the fluorescence (eg DABCYL, BHQ (eg BHQ-1 or BHQ-2), ECLIPSE, and/or TAMRA);

    (8) The detection probes each independently have the same or different reporter groups; preferably, the detection probes each independently have the same or different quenching groups;

    (9) The detection probes each independently have resistance to nuclease activity (eg, 5' nuclease activity, eg, 5' to 3' exonuclease activity); eg, the backbone of the detection probe Contains modifications that resist nuclease activity, such as phosphorothioate linkages, alkyl phosphotriester linkages, aryl phosphotriester linkages, alkyl phosphonate linkages, aryl phosphonate linkages, hydrophosphate linkages, alkyl phosphoramidate bond, aryl phosphoramidate bond, 2'-O-aminopropyl modification, 2'-O-alkyl modification, 2'-O-allyl modification, 2'-O-butyl modification, and 1-(4'-thio-PD-ribofuranosyl) modification;

    (10) The detection probes are each independently linear or have a hairpin structure.
11. A kit comprising: one or more nucleic acid molecules, at least one pair of primer sets capable of amplifying the nucleic acid molecules, and at least one detection probe capable of interacting with the nucleic acid molecules The amplified product of the molecule is hybridized or annealed, and the detection probe is labeled with a reporter group and a quencher group, wherein the reporter group can emit a signal, and the quencher group can absorb or quench the signal emitted by the reporter group; and the signal emitted by the detection probe in the case of hybridization to its complementary sequence is different from the signal emitted in the case of not hybridized to its complementary sequence;

    Preferably, the kit further comprises: a polymerase, deoxynucleoside triphosphates (dNTPs), water, a solution containing ions (eg, Mg ²⁺ ), a single-stranded DNA binding protein, or any combination thereof;

    Preferably, the kit has any one or more of the following features:

    (1) the nucleic acid molecule is selected from DNA, RNA, or any combination thereof;

    Preferably, the sample is derived from eukaryotes (eg, animals, plants, fungi), prokaryotes (eg, bacteria, actinomycetes), viruses, bacteriophages, or any combination thereof;

    Preferably, the nucleic acid molecule is λDNA;

    (2) the primer set comprises at least one forward primer and at least one reverse primer;

    Preferably, the forward primer and reverse primer each independently comprise or consist of naturally occurring nucleotides, modified nucleotides, non-natural nucleotides, or any combination thereof;

    Preferably, the primers of the primer set have the nucleotide sequences shown in SEQ ID NO:1 and SEQ ID NO:2;

    (3) For each nucleic acid molecule, provide at least one detection probe (for example, provide 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more detection probes);

    Preferably, the detection probe is as defined in claim 9;

    Preferably, the detection probe has the nucleotide sequence shown in SEQ ID NO: 3;

    Preferably, the polymerase has one or more technical features selected from the following:

    (1) The polymerases are each independently selected from DNA polymerases, RNA polymerases, or any combination thereof;

    (2) The polymerase is a DNA polymerase each independently obtained from a bacterium selected from the group consisting of: Thermus aquaticus (Taq), Thermus thermophiles (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, Thermus antranildanii ,Thermus caldophllus,Thermus chliarophilus,Thermus flavus,Thermus igniterrae,Thermus lacteus,Thermus oshimai,Thermus ruber,Thermus rubens,Thermus scotoductus,Thermus silvanus,Thermus thermophllus,Thermotoga maritima,Thermotoga neapolitana,Thermosipho africanus,Thermococcus litoralis,Thermococcus barossi,Thermococcus gorgonarius, Thermotoga maritima, Thermotoga neapolitana, Thermosiphoafricanus, Pyrococcus woesei, Pyrococcus horikoshii, Pyrococcus abyssi, Pyrodictium occultum, Aquifexpyrophilus and Aquifex aeolieus;

    (3) The polymerase is a DNA polymerase, and the DNA polymerases are each independently selected from Bst DNA polymerase, T7 DNA polymerase, phi29 DNA polymerase, T4 DNA polymerase, T5 DNA polymerase, Pfu DNA polymerase Enzyme, vent DNA polymerase or any combination thereof;

    (4) the polymerase is a DNA polymerase, and the DNA polymerase includes a reverse transcriptase;

    (5) the polymerase is a reverse transcriptase, and the reverse transcriptases are each independently selected from MMLV reverse transcriptase, AMV reverse transcriptase, HIV reverse transcriptase, or any combination thereof;

    Preferably, the kit is used to detect one or more (eg, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20 , 30, 40, 50, or more polymerases) polymerase activity.

Images