CN102433341A - Prokaryotic expression product of epinephelus coioides antibacterial peptide and preparation method thereof - Google Patents
Prokaryotic expression product of epinephelus coioides antibacterial peptide and preparation method thereof Download PDFInfo
- Publication number
- CN102433341A CN102433341A CN2011103864276A CN201110386427A CN102433341A CN 102433341 A CN102433341 A CN 102433341A CN 2011103864276 A CN2011103864276 A CN 2011103864276A CN 201110386427 A CN201110386427 A CN 201110386427A CN 102433341 A CN102433341 A CN 102433341A
- Authority
- CN
- China
- Prior art keywords
- expression
- prohep3
- preparation
- hepcidin3
- expression vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a prokaryotic expression product of epinephelus coioides antibacterial peptide and a preparation method thereof and relates to genetic engineering expression of fishes in the technical field of biology. A constructed expression vector containing an EC-hepcidin3 gene can be subjected to induced expression in escherichia coli; and a large amount of expression products are obtained in vitro by purifying the expression product at high efficiency. The expression vector containing the EC-hepcidin3 gene is a recombinant expression vector pET28a/EC-hepcidin 3 constructed by inserting an EC-hepcidin 3 precursor peptide gene sequence in a prokaryotic expression vector pET28a+. The expression product obtained in vitro is a recombinant protein EC-proHep3 obtained by induced expression and purification of the recombinant expression vector pET28a/EC-hepcidin 3 in the escherichia coli.
Description
Technical field
The present invention relates to the fish gene engineering expression in the biological technical field, especially relate to expression vector and the expression product of a kind of Epinephelus coioides antimicrobial petide Hepcidin3 and make up the preparation method.
Background technology
Antibacterial peptide (Antimicrobial peptides; AMPs) be the important composition composition of fish innate immune system; Fish can secrete and produce the invasion and attack that multiple antibacterial peptide is resisted pathogenic micro-organisms a large amount of in the aquatic environment, and these pathogenic micro-organisms comprise various bacteria, fungi and virus or the like.Utilize Protocols in Molecular Biology;, activated antibacterial peptide product a large amount of in external acquisition; Further use these antibacterial peptide products and possibly strengthen the immunizing power of aquatic animal; Improve cultured output, and have important science, reality and economic implications solving the problems such as bacterial drug resistance, fishery products drug residue and water environment pollution that cause owing to long-term abuse of antibiotics that face in the sea farming.
Epinephelus coioide (Epinephelus coioides, orange-spotted grouper) is commonly called as blue spot, is lower floor fish in the water warm, mainly is distributed in the Indian Ocean, Red sea, Mediterranean Sea, North Western Pacific and south east asia.Its delicious meat, nutritious, strong stress resistance, growth is fast, body colour is gorgeous; Market value is high and stable; At present Epinephelus coioide has become in the world the amount of growing seedlings and has propagated the highest ablen of output artificially, also is one of important marine fish in China Fujian, Guangdong, Hainan, Taiwan Si Sheng.But in recent years because the fish disease outburst that invasive organism causes, make the Epinephelus coioide aquaculture bearing enormous economic loss (1. woods is built brightness. the biological characteristics of Epinephelus coioide and cultural technique [J]. Shandong fishery, 2008,25 (2): 22-23; 2. yellow auspicious virtue. the research [J] that the Epinephelus coioide vibrio alginolyticus is sick. aquatic science, 2005,24 (6): 1-3; 3. plum is iced, Zhou Yongcan, Xu Xiandong, Wang Shifeng, Xie Zhenyu. separation of Epinephelus coioide tail pathogenic bacteria and evaluation [J]. and tropical oceanography newspaper, 2010,29 (6): 118-124).
The applicant in early-stage Study from the green hata (Epinephelus awoara) clone obtained the hepcidin gene that 1 mature peptide has 4 cysteine residues; Then the clone has obtained in addition the hepcidin gene that 1 new mature peptide contains 4 cysteine residues from the culturing Epinephelus coioides of Zhangpu, Fujian; Has homology with other 2 hepcidin gene EC-hepcidin1 and the EC-hepcidin2 that in Epinephelus coioide, find that reported; Supposition is its variant, so called after EC-hepcidin3.The mature peptide of having found artificial synthetic EC-hepcidin1 and EC-hepcidin2 has antibiotic, antiviral effect (4.Jing-Geng Zhou, Jing-Guang Wei, Dan Xu; Hua-Chun Cui, Yang Yan, Zheng-Liang Ou-Yang; Xiao-Hong Huang; You-Hua Huang, Qi-Wei Qin.Molecular cloning and characterization of two novel hepcidins from orange-spotted grouper, Epinephelus coioides [J] .Fish&Shellfish Immunology; 2011,30:559-568).
The same with other fish hepcidin structures of having found; EC-hepcidin3 comprises the signal peptide that is positioned at the N end of endoplasmic reticulum target; Leading peptide and the mature peptide that is positioned at C end, wherein leading peptide and mature peptide constitute jointly precursor peptide (propeptide of EC-hepcidin3, EC-proHep3).
Summary of the invention
The object of the invention aims to provide prokaryotic expression product of a kind of Epinephelus coioides antimicrobial petide and preparation method thereof.
The present invention makes up a kind of contain the EC-hepcidin3 expression carrier can be in intestinal bacteria abduction delivering, and through the efficiently purifying expression product and at a large amount of expression product of external acquisition.The said EC-hepcidin3 expression carrier that contains is at prokaryotic expression carrier pET-28a
+The recombinant expression vector pET28a/EC-hepcidin3 that middle insertion EC-hepcidin3 precursor peptide gene order is constituted.
Expression product in external acquisition according to the invention is the recombinant protein EC-proHep3 that recombinant expression vector pET28a/EC-hepcidin3 obtains behind abduction delivering and purifying in intestinal bacteria.
The gene order of said EC-hepcidin3 precursor peptide is shown in sequence table the 1st sequence.
The aminoacid sequence of said EC-hepcidin3 precursor peptide is shown in sequence table the 2nd sequence.
The preparation method of said recombinant protein EC-proHep3 may further comprise the steps:
1) makes up recombinant expression vector;
2) step 1) gained recombinant expression vector is imported host cell, acquisition can be expressed the genetically engineered bacteria strain of EC-proHep3;
3) the genetically engineered bacteria strain that obtained of fermentation culture and carry out abduction delivering obtains expression product;
4) purification procedures 3) expression product of gained, obtain recombinant protein EC-proHep3.
In step 1), said expression vector can be pET-28a
+Deng.
In step 2) in, said host cell can be intestinal bacteria E.coli Rosette etc.
In step 3), said expression product is earlier to express thalline through centrifugal collection, the supernatant that centrifugal again collection obtains after the resuspended and ultrasonication with the expression thalline.
In step 4), said separation and purification can be adopted the affinity chromatography purifying.
The present invention utilizes prokaryotic expression carrier pET-28a by Protocols in Molecular Biology
+With prokaryotic expression bacterial strain E.coli Rosette, success at vivoexpression soluble, be prone to recombinant protein EC-proHep3 purifies and separates, that have anti-microbial activity.
Recombinant protein EC-proHep3 has broad-spectrum antibacterial activity; To gram-positive microorganism such as micrococcus lysodeikticus (Micrococcus lysodeikticus Fleming), Corynebacterium glutamicum (Corynebacterium glutamicum) and streptococcus aureus (Staphylococcus aureus), Gram-negative bacteria such as Pseudomonas stutzeri (Pseudomonas stutzeri) and Pseudomonas fluorescens (Pseudomonas fluorescens) all had the obvious suppression effect.
The gene engineering expression product of recombinant protein EC-proHep3 will be researched and developed aspects such as resisting pathogenic microbes new drug, fodder additives and immunostimulant and have important use value in the Epinephelus coioide aquaculture.
The present invention makes up a kind of contain the EC-hepcidin3 expression carrier can be in intestinal bacteria abduction delivering, and through the efficiently purifying expression product and at a large amount of expression product of external acquisition.The said EC-hepcidin3 expression carrier that contains is at prokaryotic expression carrier pET-28a
+The recombinant expression vector pET28a/EC-hepcidin3 that middle insertion EC-hepcidin3 precursor peptide gene order is constituted.
Expression product in external acquisition according to the invention is the recombinant protein EC-proHep3 that recombinant expression vector pET28a/EC-hepcidin3 obtains behind abduction delivering and purifying in intestinal bacteria.
Description of drawings
Fig. 1 is a pcr amplification Epinephelus coioides antimicrobial petide Hepcidin3 precursor peptide gene order electrophorogram as a result.In Fig. 1,1 is the pcr amplification after product; M is DL2000DNA Marker.
Fig. 2 is pET-28a
+The carrier enzyme is cut the electrophorogram after the processing.In Fig. 2, bp represents the base pair number; M is DL2000DNA Marker; 1 for not carrying out the pET-28a that enzyme is cut
+Carrier, 2 for using the pET-28a after NcoI and XhoI carry out double digestion
+Carrier.
Fig. 3 is for detecting the SDS-PAGE electrophorogram of protein expression situation.In Fig. 3, KDa represents proteinic molecular weight (kilodalton); M1 is protein Marker; 1 for the pET28a/EC-hepcidin3 recombinant expression vector induce before the bacterial protein sample; 2 induce back bacterial protein sample for the pET28a/EC-hepcidin3 recombinant expression vector.
Fig. 4 is the SDS-PAGE electrophorogram of the soluble analysis of expression product, and in Fig. 4, KDa represents proteinic molecular weight (kilodalton); M2 is protein Marker; 1 supernatant samples for ultrasonication expression thalline and the collection of centrifugal back; 2 for expressing the deposit sample that collect thalline and centrifugal back for ultrasonication.
Fig. 5 is the purifying figure of affinity chromatography purification of recombinant proteins EC-proHep3.In Fig. 5, X-coordinate is the liquor capacity Volume (ml) of purification column of flowing through; Ordinate zou is the ultraviolet absorption value Absorbance (mAU) of solution under the 280nm wavelength behind the outflow purification column; A is for flowing out component, and b is an elution fraction.
Fig. 6 is the SDS-PAGE electrophorogram behind the recombinant protein EC-proHep3 purifying.In Fig. 6,1 is to flow out component sample in the purge process; 2 is elution fraction sample in the purge process; M2 is protein Marker; KDa represents proteinic molecular weight (kilodalton).
Embodiment
Below be described with reference to the accompanying drawings technical scheme of the present invention through embodiment.
The structure of embodiment 1 Epinephelus coioides antimicrobial petide Hepcidin3 recombinant expression vector
1) acquisition of Epinephelus coioides antimicrobial petide Hepcidin3 precursor peptide gene
According to pET-28a
+MCS on the carrier and Epinephelus coioides antimicrobial petide Hepcidin3 gene order, the synthetic specificity upstream and downstream of design primer, pcr amplification Epinephelus coioides antimicrobial petide Hepcidin3 precursor peptide gene order.
Add the NcoI restriction enzyme site at the 5` of upstream primer ECH-exp-S1 end, add the XhoI restriction enzyme site at the 5` of downstream primer ECH-exp-A1 end, terminator codon and 6 * His are histidine-tagged: downstream primer adopts the XhoI restriction enzyme site:
ECH-exp-S1:5`GCG
GCTTACCCGTCACTGGAGTAG 3`, italic also marks underscore and partly representes the NcoI restriction enzyme site introduced.
ECH-exp-A1:5`CCG
TTGGAAGTCACAGCGGACTCC 3`; Italic also marks underscore and partly representes the XhoI restriction enzyme site introduced; Terminator codon partly represented in black matrix, is 6 * His-Tag sequence in the square frame.
With Epinephelus coioides antimicrobial petide Hepcidin3cDNA reorganization pMD18-T positive plasmid is amplification template; With ECH-exp-S1 and ECH-exp-A1 is the upstream and downstream primer; (available from TaKaRa company) carries out the pcr amplification target gene fragment with Ex Taq enzyme, and reaction system is as shown in table 1.
Table 1
| Aseptic MiliQ water | 69μL |
| 10 * buffer (contains Mg 2+) | 10μL |
| ?dNTPs(2.5mM?each) | 8μL |
| ?pMD?18-T/EC-Hepcidin3 | 4μL |
| Upstream primer ECH-exp-S1 (10 μ M) | 4μL |
| Downstream primer ECH-exp-A1 (10 μ M) | 4μL |
| Ex Taq enzyme (5U/ μ L) | 1μL |
| Total reaction volume | 100μL |
Mix, on thermal cycler, carry out the PCR reaction: 94 ℃ of preparatory sex change 5min according to following program; 94 ℃ of sex change 30sec, 60 ℃ of annealing 30sec, 72 ℃ are extended 1min; After carrying out 30 circulations, 72 ℃ are extended 5min.
Reaction is carried out 1.5% (W/V) sepharose-TAE electrophoresis with all reaction solutions after finishing, and reclaims test kit with the Qiagen gel and reclaims specific fragment, and obtaining PCR product length is 236bp (referring to Fig. 1).
Get the target gene fragment of the above-mentioned recovery of 2 μ g, with NcoI and XhoI Restriction Enzyme double digestion, reaction solution places 37 ℃ of water-baths to react 8h.It is as shown in table 2 that enzyme is cut system.
Table 2
| 10×K?buffer | 6μL |
| 10×BSA | 6μL |
| NcoI | 1.5μL |
| XhoI | 1.5μL |
| Reclaim target gene fragment | 25μL |
| MilliQ water | 20μL |
| Total reaction volume | 60μL |
Reaction is cut efficient with 1.5% (W/V) sepharose-TAE electrophoresis detection enzyme after finishing, and the target gene fragment after enzyme is cut is reclaimed in the heavy altogether agent of TaKaRa nucleic acid.Target gene fragment after the processing has the sticky end of NcoI and XhoI.
2) pET-28a
+The processing of plasmid
The pET-28a that has with-80 ℃ of preservations
+E.colistraindh5 line on the LB flat board of the kantlex that contains 50 μ g/mL 37 ℃ of overnight cultures.Picking mono-clonal bacterium colony was inoculated in 5mL and contained in the LB liquid nutrient medium of kantlex of 50 μ g/mL next day, and 37 ℃, 200rpm/min cultivates 8h to logarithmic phase, and centrifugal collection thalline extracts pET-28a in a small amount
+Plasmid.
Get the pET-28a after the said extracted
+Plasmid, with NcoI and XhoI Restriction Enzyme double digestion, reaction solution places 37 ℃ of water-baths to react 8h.It is as shown in table 3 that enzyme is cut system.
Table 3
| 10×K?buffer | 6μL |
| 10×BSA | 6μL |
| NcoI | 1.5μL |
| XhoI | 1.5μL |
| pET-28a +Plasmid | 25μL |
| MilliQ water | 20μL |
| Total reaction volume | 60μL |
Reaction is cut efficient (referring to Fig. 2) with 1.0% (W/V) sepharose-TAE electrophoresis detection enzyme after finishing, and the plasmid after enzyme is cut is reclaimed in the heavy altogether agent of TaKaRa nucleic acid.Plasmid after the processing has the sticky end of NcoI and XhoI.
3) structure of pET28a/EC-hepcidin3 recombinant expression vector, conversion and evaluation
To pass through the pET-28a that has the sticky end of NcoI and XhoI after a series of processing
+Plasmid with have identical sticky end target gene fragment and connect, reaction system is as shown in table 4.
Table 4
| pET-28a +Plasmid | 1μL |
| Target gene fragment | 4μL |
| Ligation?Solution?I | 5μL |
| Total reaction volume | 10μL |
The embodiment abduction delivering of 2 pET28a/EC-hepcidin3 recombinant expression vectors in intestinal bacteria and the soluble analysis of expression product
1) abduction delivering
The pET28a/EC-hepcidin3 recombinant expression vector is converted in the E.coli Rosette competent cell, and coats on the LB solid medium flat board that contains 50 μ g/ml kantlex 37 ℃ of overnight cultures.Picking mono-clonal bacterium colony was inoculated in 20ml and contained in the LB liquid nutrient medium of 50 μ g/ml kantlex next day, and 200rpm, 37 ℃ of shaking culture are to OD
600Be about 0.3～0.4, add then IPTG to final concentration be 0.4mM, under 30 ℃, 180rpm shaking culture 6h.Get each 1ml of bacterium liquid that IPTG induces front and back, centrifugal collection thalline utilizes polyacrylamide gel electrophoresis (SDS-PAGE) to detect proteic expression (referring to Fig. 3).The result shows before the pET28a/EC-hepcidin3 recombinant expression vector is induced to have tangible protein band less than the 19kDa place after IPTG induces in E.coli Rosette.
2) soluble analysis
With the centrifugal collection thalline of the bacterium liquid after inducing; PBS solution (pH8.0) suspension thalline with precooling; After-20 ℃ of freeze thawing 1 time, ultrasonic disruption somatic cells under condition of ice bath, ultrasonication liquid is centrifugal and collect supernatant and deposit sample respectively at 4 ℃; Utilize the SDS-PAGE electrophoresis, carry out the soluble analysis (referring to Fig. 4) of expression product.The result shows that target protein matter is solubility expression, and size is about 10kDa.
Embodiment 3 affinity chromatography purification of recombinant proteins EC-proHep3
1) prepares the metal a flat iron plate for making cakes and close chromatography column
The metal chelate affinity chromatography filler is sepharose fast flow (GE Healthcare).
Chromatography reagent is:
Solution A: 200mmol/L single nickel salt;
Solution B: 25mmol/L NaH
2PO
4, 500mmol/L NaCl, pH 4.0 (transferring) with phosphoric acid;
Solution C: 50mmol/L phosphoric acid buffer, 200mmol/L NaCl, 50mmol/L imidazoles, pH 8.0;
Solution D: 50mmol/L phosphoric acid buffer, 150mmol/L NaCl, 400mmol/L imidazoles, pH 8.0.
After all solution are all used 0.45 μ m membrane filtration, for use.
Behind the affinity chromatography medium dress post, operate according to following steps:
The solution A a flat iron plate for making cakes closes Ni
2+Ultrapure washing post; The Ni that the solution B flush away is unnecessary
2+Ultrapure washing post; The abundant balance chromatography column of solution C.The liquor capacity that uses in per step all is about 5 column volumes.So far, the metal chelate affinity chromatography post is ready to, for use.
2) preparation of upper prop sample
According to the description among the embodiment 2, the supernatant after the collection ultrasonication, and, treat column purification through 0.45 μ m membrane filtration.
3) go up column purification
With the whole upper props of ready sample, and after collecting the outflow component, elder generation is with the unconjugated foreign protein of solution C flush away of 5～10 column volumes; The foreign protein that possibly have some non-specific binding again with the further flush away of imidazoles gradient; Use solution D wash-out target protein at last, and collect elution fraction (referring to Fig. 5).
Take a morsel and flow out component and carry out SDS-PAGE electrophoresis evaluation (referring to Fig. 6) with elution fraction.The result shows that the EC-proHep3 recombinant protein can specificly combine with nickel ion chelating affinity column, and after imidazoles solution (400mM) the competition washing through higher concentration, fusion expressed product is by wash-out, and purity is higher.
The elutriant that will contain target protein is packed in the dialysis band of anticipating, and under coldcondition, puts into Tris-Cl damping fluid (50mM Tris, 100mM NaCl, pH 8.0) and dialyses, and repeatedly changes dialyzate.Dialysis is at last gone in the Tris-Cl damping fluid (20mM Tris, 20mM NaCl, pH 8.0).
The mensuration of embodiment 4 recombination expression product EC-proHep3 anti-microbial activities
1) Application of B radford method is measured the concentration of recombination expression product EC-proHep3
Get the BSA liquid storage with 10 times of 1 * PBS dilutions, final concentration is 0.5mg/ml; 0.5mg/ml BSA standard substance are added in the 96 porocyte culture plates by 0,1,2,4,8,12,16,20 μ l gradients, complement to 20 μ l respectively with 1 * PBS, each concentration gradient is provided with 3 parallel appearance; Every hole adds 200 μ l G250 staining fluids, and room temperature is placed 3min; Measure the absorbancy of 595nm wavelength with ELIASA; Obtain the protein concentration typical curve.
Application of B radford method is measured the protein concentration typical curve that the BSA standard substance obtain, and can calculate the concentration of recombinant expression protein according to formula.Use the sterilization ultrapure water with protein solution doubling dilution to 1.5～96 μ M.
2) mensuration of recombination expression product EC-proHep3 anti-microbial activity
The mensuration of MIC (Minimum Inhibitory Concentration, minimal inhibitory concentration) is with reference to method (5.Bulet P, the Dimarcq J L of Bulet etc.; Hetru C, Lagueux M, Charlet M; Hegy G, Van Dorsselaer A, Hoffmann J A.A novel inducible antibacterial peptide of Drosophila carries an O-glycosylated substitution [J] .J.Biol.Chem.; 1993,268:14893-14897; 6.Ke-Jian Wang, Jing-Jing Cai, Ling Cai; Hai-Dong Qu; Ming Yang, Min Zhang.Cloning and expression of a hepcidin gene from a marine fish (Pseudosciaena crocea) and the antimicrobial activity of its synthetic peptide [J] .Peptides., 2009; 30 (4): 638-646), on 96 porocyte culture plates, carry out.
(1) preparation of bacteria suspension: get tested bacterium, line the nutrient broth flat board, under the optimal temperature, cultivate 12～16h; 2～3 clones of picking are inoculated in the MH inclined-plane, continue to cultivate 12～16h, reach the logarithmic phase of bacterium; The MH bacterium slant culture of 10mM sodium phosphate salt damping fluid (pH 72) flushing prepared fresh, the bacteria suspension adjustment is diluted to OD
600=0.1, get 18 μ lOD
600=0.1 bacteria suspension add the MH diluted medium that final volume is 1ml (PBS: MH=3: 2, V/V) in, this bacteria suspension is the MIC working concentration.
(2) every kind of tested bacterium is according to following operation setting blank group, negative control group and testing sample experimental group, and every group is provided with 2 parallel appearance, and every kind of bacterium is repeated 3 times:
1. positive controls: add 50 μ L sterilization ultrapure water and 50 μ L bacteria suspensions;
2. blank group: add 50 μ L testing protein samples and 50 μ L sodium phosphate salt damping fluids;
3. sample experimental group: add 50 μ L testing protein samples and 50 μ L bacteria suspensions;
(3) behind the righttest cultivation 24～48h of bacterium, observe MIC result, as shown in table 5.
Table 5
| Strain name | CGMCC?No | MIC(μM) |
| Gram-positive | ||
| Corynebacterium glutamicum | 1.1886 | 48～96 |
| Micrococcus lysodeikticus | 1.0634 | 24～48 |
| Streptococcus aureus | 1.0363 | 1.5～3 |
| Gram-negative | ||
| Pseudomonas fluorescens | 1.0032 | 24～48 |
| Pseudomonas stutzeri | 1.1803 | ＜1.5 |
CGMCC No.: China Committee for Culture Collection of Microorganisms's common micro-organisms center bacterium numbering;
MIC: minimal inhibitory concentration, with (a)～(b) expression, (a) maximum concentration of the visible thalli growth of expression naked eyes, (b) expression loses the Cmin of thalli growth.
Claims (7)
1.EC-hepcidin3 the gene order of precursor peptide is shown in sequence table the 1st sequence.
2.EC-hepcidin3 the aminoacid sequence of precursor peptide is shown in sequence table the 2nd sequence.
3. the preparation method of recombinant protein EC-proHep3 is characterized in that may further comprise the steps:
1) makes up recombinant expression vector;
2) step 1) gained recombinant expression vector is imported host cell, acquisition can be expressed the genetically engineered bacteria strain of EC-proHep3;
3) the genetically engineered bacteria strain that obtained of fermentation culture and carry out abduction delivering obtains expression product;
4) purification procedures 3) expression product of gained, obtain recombinant protein EC-proHep3.
4. the preparation method of recombinant protein EC-proHep3 as claimed in claim 3 is characterized in that in step 1), and said expression vector is pET-28a
+
5. the preparation method of recombinant protein EC-proHep3 as claimed in claim 3 is characterized in that in step 2) in, said host cell is intestinal bacteria E.coli Rosette.
6. the preparation method of recombinant protein EC-proHep3 as claimed in claim 3 is characterized in that in step 3), and said expression product is earlier to express thalline through centrifugal collection, the supernatant that centrifugal again collection obtains after the resuspended and ultrasonication with the expression thalline.
7. the preparation method of recombinant protein EC-proHep3 as claimed in claim 3 is characterized in that in step 4), and the affinity chromatography purifying is adopted in said separation and purification.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110386427.6A CN102433341B (en) | 2011-11-28 | 2011-11-28 | Prokaryotic expression product of epinephelus coioides antibacterial peptide and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110386427.6A CN102433341B (en) | 2011-11-28 | 2011-11-28 | Prokaryotic expression product of epinephelus coioides antibacterial peptide and preparation method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102433341A true CN102433341A (en) | 2012-05-02 |
| CN102433341B CN102433341B (en) | 2014-02-26 |
Family
ID=45981687
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110386427.6A Active CN102433341B (en) | 2011-11-28 | 2011-11-28 | Prokaryotic expression product of epinephelus coioides antibacterial peptide and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102433341B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108504615A (en) * | 2018-03-30 | 2018-09-07 | 江南大学 | It is a kind of production acid protease recombinant bacterium and its application |
-
2011
- 2011-11-28 CN CN201110386427.6A patent/CN102433341B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| JING-GENG ZHOU等: "Molecular cloning and characterization of two novel hepcidins from orange-spotted grouper, Epinephelus coioides", 《FISH & SHELLFISH IMMUNOLOGY》 * |
| ZHOU,J.G.等: "Epinephelus coioides hepcidin 1 mRNA, complete cds", 《GENBANK-GU391241.1》 * |
| 陈大玮: "斜带石斑鱼抗茵肽hepcidin基因克隆及其成熟肽的原核融合表达", 《南方水产科学》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108504615A (en) * | 2018-03-30 | 2018-09-07 | 江南大学 | It is a kind of production acid protease recombinant bacterium and its application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102433341B (en) | 2014-02-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105175518B (en) | The bacteriocin and preparation method thereof that bacillus coagulans FM603 is generated | |
| CN111205359B (en) | Scyreproxcin as antibacterial peptide of scylla paramamosain and application thereof | |
| CN104694559A (en) | DNA segment for efficient expression of egg white lysozyme by employing recombinant pichia pastoris and expression method thereof | |
| CN104151414A (en) | Preparation method of green mud crab antibacterial peptide SpHyastatin and application thereof | |
| CN101906165B (en) | Expression product in series of two fish antibacterial peptide genes and expression method thereof | |
| CN103789317A (en) | Scylla paramamosain antibacterial peptide hyastatin gene clone, encoding protein recombination and application | |
| CN111420037B (en) | Application of phage lyase Lysep3 in preparation of broad-spectrum antibacterial drugs | |
| CN105779346B (en) | A kind of enterococcus faecium and its application of bacteriocinogeny | |
| CN103319586A (en) | Antimicrobial peptide MP1102 of anti-drug resistance staphylococcus aureus and preparation method and application thereof | |
| CN101880676A (en) | Constructing method of nifA gene-introduced rhizobium japonicum genetic engineering bacterial strain HD-SFH-01 | |
| CN101423840B (en) | Method for producing recombinant sea cucumber antalzyme and recombinant sea cucumber antalzyme produced thereby | |
| CN104263709A (en) | Egg-white lysozyme and preparation method thereof | |
| CN102304536A (en) | Eukaryotic fused expression product of two marine animal antibacterial peptide genes, and preparation method thereof | |
| CN108148123B (en) | Natural antibacterial peptide of burned soil hypha fungi and application thereof | |
| CN102061303B (en) | Fusion expression product of antimicrobial peptide genes of two marine animals and preparation method of fusion expression product | |
| CN110669114B (en) | Lanthionine precursor peptide amyA6, and preparation method and application thereof | |
| CN103724412A (en) | Fenneropenaeus chinensiss anti-lipopolysaccharide factor as well as preparation and application thereof | |
| CN102433341B (en) | Prokaryotic expression product of epinephelus coioides antibacterial peptide and preparation method thereof | |
| CN101875940B (en) | Salt-tolerant sinorhizobium meliloti NSM18 and special gene cluster thereof | |
| CN102241756B (en) | High expression of tenebrio molitor antibacterial peptide TmAMP3m in escherichia coli and application of TmAMP3m | |
| CN110669113A (en) | Lanthionine precursor peptide amyA2, and preparation method and application thereof | |
| CN102276729A (en) | Antibacterial peptide bovine lactoferricin-thanatin (LF-TH) and Escherichia coli recombination preparation method thereof | |
| CN113599497B (en) | Application of garrupa piscidin1 and synthetic polypeptide thereof in preparation of antiviral or antibacterial drugs | |
| CN102120760B (en) | Antibacterial peptide derived from phage and application thereof | |
| CN107602686A (en) | A kind of polypeptide resistant to gram-positive bacteria |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |