CN102433267B - Method for preparing beta-mannase and special strain - Google Patents
Method for preparing beta-mannase and special strain Download PDFInfo
- Publication number
- CN102433267B CN102433267B CN 201010297135 CN201010297135A CN102433267B CN 102433267 B CN102433267 B CN 102433267B CN 201010297135 CN201010297135 CN 201010297135 CN 201010297135 A CN201010297135 A CN 201010297135A CN 102433267 B CN102433267 B CN 102433267B
- Authority
- CN
- China
- Prior art keywords
- methyl alcohol
- fermentation system
- glycerine
- solution
- stage
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a method for preparing beta-mannase and a special strain. The strain is Pichia pastoris GS4SMAN CGMCC NO.4095. The recombinant strain disclosed by the invention contains a plurality of copied mannase genes expressed under methanol induction. Experiments show that by means of a process, disclosed by the invention, for producing alkaline mannase through high-density fermentation by using the recombinant strain, the enzyme activity of the alkaline mannase can reach 6336u/ml finally in an induction period of 84 hours. The method disclosed by the invention has the advantages of low cost, simplicity for operation and high yield. Therefore, the method disclosed by the invention has a wide application prospect in the field of mannase preparation.
Description
Technical field
The present invention relates to a kind of method and special strain therefore for preparing 'beta '-mannase.
Background technology
'beta '-mannase (β-1,4-D-mannan mannohydrolase; EC31211178) be the main chain β-1 of class degraded mannosans, glucomannan, polygalactomannan and gala glucomannan, the enzyme of 4-D-mannopyranose, its various beta-mannase in the stem tuber of the nut, guar-bean, acacia, coffee tree and the konjaku that utilize the existing endosperm that is some plants such as copra, ivory palm has potential importance.The bleaching, the broken glue of oil well, the degrading plant glue that now are mainly used in both at home and abroad paper industry paper pulp are produced oligose as the bifidus bacillus somatomedin, in the protective foods that anti-disease, anti-aging is old and the fodder industry as antinutritional factor.
'beta '-mannase has the branch of acidity, neutrality, alkalescence by the difference of its optimum pH, wherein alkaline ' beta '-mannase refers to the highest 'beta '-mannase of catalysis activity under alkaline condition, its research is later relatively, find mainly to be produced by Alkaliphilic bacillus, some Bacillus licheniformis also produces alkaline ' beta '-mannase, reported that as Yang Wenbo etc. a bacillus licheniformis NK-27, its optimum pH are 9.0.Subtilis generally speaking, actinomycetes etc. produce neutral 'beta '-mannase, and mould produces acidic beta-mannase.First alkali mannanase is by discoveries such as Akino.Ma Yan and equal 1991 purifying and the zymologic properties of having reported the outer alkali mannanase of three born of the same parents of Alkaliphilic bacillus N16-5, and reported wherein a kind of gene order of having a liking for the alkali mannase in 2004.Takeda equals to find in 2004 that the bacterial strain JAMB-602 of bacillus produces alkali mannanase, and this enzyme belongs to GH family 5, and optimal pH is 9.The optimum pH of finding at present of having a liking for the alkali mannase is up to 10, equals report in 2004 by Takeda.
Alkaline ' beta '-mannase not only can produce as the bifidus bacillus somatomedin oligose, and be with a wide range of applications in the industrial aspect such as association with pulp bleaching of need alkaline environment.But up to the present, the preparation of alkaline ' beta '-mannase still is the bottleneck that limits its industrial application, no matter is to use the original bacterial strain of alkaline ' beta '-mannase also to be to use recombinant bacterial strain production in forefathers' the report, and its output is all lower.
Ma Yan and equal 1991 purifying and the zymologic properties of having reported the outer alkali mannanase of three born of the same parents of Alkaliphilic bacillus N16-5, and reported wherein a kind of gene order of having a liking for the alkali mannase in 2004, the coding region sequence of its gene is shown in 7-1407 position among the SEQ ID NO:1.
PTM
1Solution: with Cu SO
45H
2O 6g, KI 0.08g, MnSO
42.68g, H
3BO
30.02g, Na
2MoO
42H
2O 0.2g, ZnSO
47H
2O 20g, FeSO
47H
2O 65g, CoCl
26H
2O 0.916, H
2SO
45mL, vitamin H 0.2g mixes, and water is settled to 1 liter, obtains PTM
1Solution.
Per 1 liter of BMGY liquid nutrient medium is prepared as follows: with 8 grams-12 grams or 10 gram yeast extracts, 18 grams-22 grams or 20 gram peptones, 12 grams-15 grams or 13.4 gram YNB, 3 * 10
-4Gram-5 * 10
-4Gram or 4 * 10
-4Gram vitamin H and 8 grams-12 grams or 10 gram glycerine are soluble in water, and water is settled to 1 liter, obtains the BMGY liquid nutrient medium.
Summary of the invention
An object of the present invention is to provide a kind of reorganization bacterium.
Reorganization bacterium provided by the present invention is the encoding gene importing starting strain with 'beta '-mannase, the reorganization bacterium that obtains; The coding gene sequence of described 'beta '-mannase is shown in 7-1407 position Nucleotide among the SEQ ID NO:1.
In the above-mentioned reorganization bacterium, the encoding gene of described 'beta '-mannase imports starting strain by recombinant vectors; Described recombinant vectors is shown in following (1) or (2) or (3):
(1) dna fragmentation shown in the SEQ ID NO:1 is inserted between the XhoI and EcoRI restriction enzyme site of pAO815alpha, the recombinant vectors that obtains, note is made pAO α-1sman; Wherein, the XhoI restriction enzyme site is positioned at 5 of dna fragmentation shown in the SEQ ID NO:1 ' end upstream, and the EcoRI restriction enzyme site is positioned at 3 of dna fragmentation shown in the SEQ ID NO:1 ' end downstream;
(2) with BamHI/BglII double digestion pAO α-1sman, reclaim the 2932bp fragment; With BamHI single endonuclease digestion pAO α-1sman, reclaim the big fragment of carrier; Described 2932bp fragment is connected with the big fragment of described carrier, the recombinant vectors that obtains, note is made pAO α-2sman;
(3) with BamHI/BglII double digestion pAO α-2sman, reclaim the 5864bp fragment; With BamHI single endonuclease digestion pAO α-2sman, reclaim the big fragment of carrier; Described 5864bp fragment is connected with the big fragment of described carrier, the recombinant vectors that obtains, note is made pAO α-4sman;
Described pAO815alpha obtains as follows: with carrier pPICZ α SacI/EcoRI double digestion, collect the 1000bp fragment; With SacI/EcoRI double digestion carrier pAO815, reclaim the big fragment of carrier; Described 1000bp fragment is connected with the big fragment of described carrier, and the recombinant vectors that obtains is pAO815alpha;
Described starting strain is yeast, is preferably Pichia yeast, is preferably pichia pastoris phaff bacterial strain GSl15 again.
In the above-mentioned reorganization bacterium, described reorganization bacterium is pichia pastoris phaff (Pichia pastoris) GS4SMAN, and its deposit number is CGMCC NO.4095.
Another object of the present invention provides a kind of method for preparing 'beta '-mannase.
The method for preparing 'beta '-mannase provided by the present invention comprises the steps: above-mentioned arbitrary described reorganization bacterium is inoculated in the fermention medium, and fermentation culture obtains 'beta '-mannase; All substances in fermenting container note is made fermentation system.
In the aforesaid method, described fermention medium is the substratum for the cultivation Pichia yeast, and wherein contains glycerine;
Described fermentation culture is carried out according to following three phases successively:
Stage one: comprise the steps: to exhaust from the glycerine that inoculation begins to be cultured to the fermentation system;
Stage two: when comprising the steps: that glycerine in fermentation system exhausts, begin to flow glycerol adding or glycerine solution, be cultured to the OD of fermentation system
600Value reaches 200-350 or 200 or 250 or 320 or 350, stops to flow glycerol adding or glycerine solution;
Stage three: be following 1) or 2) shown in:
When 1) comprising the steps: that glycerine in fermentation system exhausts, add mixed aqueous solution or methyl alcohol or the methanol solution of sorbyl alcohol and methyl alcohol in the fermentation system, carry out abduction delivering;
When 2) comprising the steps: that glycerine in fermentation system exhausts, the temperature of fermentation system is transferred to 26 ℃~29 ℃ or 26 ℃ or 27 ℃ or 28 ℃ or 29 ℃, add mixed aqueous solution or methyl alcohol or the methanol solution of sorbyl alcohol and methyl alcohol in the fermentation system, carry out abduction delivering;
Described glycerine solution is by glycerine, PTM
1Solution and water are formed; Described methanol solution is by methyl alcohol, PTM
1Solution and water are formed.
In the aforesaid method, in the mixed aqueous solution of described sorbyl alcohol and methyl alcohol, the mass ratio of sorbyl alcohol and methyl alcohol is 1: 20~1: 5 or 1: 20 or 1: 10 or 1: 5.
In the aforesaid method, in the mixed aqueous solution of described sorbyl alcohol and methyl alcohol, the concentration of sorbyl alcohol is 36g/L-144g/L or 36g/L or 72g/L or 144g/L, and the concentration of methyl alcohol is 720g/L.
In the aforesaid method, the cultivation in described stage one and described stage two is 6.0 in the pH value, temperature is that 30 ℃, dissolved oxygen are to carry out under the condition more than 30%;
In the aforesaid method, 1 in described stage three) in, abduction delivering is 6.0 in the pH value, temperature is that 30 ℃, dissolved oxygen are to carry out under the condition more than 30%;
In the aforesaid method, 2 in described stage three) in, abduction delivering is 6.0 in the pH value, temperature is 26 ℃~29 ℃ or 26 ℃ or 27 ℃ or 28 ℃ or 29 ℃, dissolved oxygen are to carry out under the condition more than 30%.
In the aforesaid method, in the described stage three, the time of abduction delivering is 60h-160h, is specially 12h-84h or 36h-84h or 48h-84h or 60h-84h or 19h-134h or 43h-134h or 64h-134h or 86h-134h or 111h-134h; Be specially 12h, 36h, 48h, 60h, 72h, 84h or 19h, 43h, 64h, 86h, 111h or 134h again;
In the aforesaid method, in the described stage one, described inoculum size is 5%;
In the aforesaid method, in the described stage three, described glycerine in fermentation system exhausts when Shi Weicong stops to flow glycerol adding to be counted, behind 0.5~1h; (before adding methyl alcohol, cool the temperature to 26~29 ℃, thalline and hungry 0.5~1h to exhaust glycerine, reach the purpose that the AOX1 promotor derepresses).
In the aforesaid method, described dissolved oxygen is to be 30%-100% for dissolved oxygen more than 30%;
In the aforesaid method, described fermention medium is the BMGY liquid nutrient medium;
In the aforesaid method, described glycerine solution is prepared as follows: with 600g-650g or 625g glycerine, 10ml-14ml or 12mL PTM
1Solution mixes, and water is settled to 1 liter.
In the aforesaid method, in the described stage three, the described sorbyl alcohol that adds in the fermentation system with the mixed aqueous solution of methyl alcohol or the mode of methyl alcohol or methanol solution is: add methyl alcohol in fermentation system earlier, making the volumetric concentration of methyl alcohol in fermentation system is 3/1000-7/1000 or 5/1000,1.5 hours-2.5 hours or after 2 hours, stream added mixed aqueous solution or methyl alcohol or the methanol solution of sorbyl alcohol and methyl alcohol in the fermentation system again;
In the aforesaid method, in the described stage one, described dissolved oxygen is to be by bubbling air in fermentation system more than 30% and to regulate the speed of bubbling air and stir fermentation system and regulate the speed that stirs fermentation system and realize; Described stir speed (S.S.) is 200rpm-900rpm; The speed of described bubbling air is 0.5L/L fermention medium/min-1.5L/L fermention medium/min;
In the aforesaid method, in the described stage two, described dissolved oxygen be more than 30% be by bubbling air in fermentation system and regulate bubbling air speed, stir fermentation system and regulate the speed that stirs fermentation system and the stream rate of acceleration of regulating glycerine or glycerine solution realizes that described stir speed (S.S.) is 200rpm-900rpm; The speed of described bubbling air is 0.5L/L fermention medium/min-1.5L/L fermention medium/min; The speed of described stream glycerol adding or glycerine solution is 5ml glycerine or glycerine solution/L fermention medium/h-15ml glycerine or glycerine solution/L fermention medium/h;
In the aforesaid method, in the described stage three, described dissolved oxygen be more than 30% be by bubbling air in fermentation system and regulate bubbling air speed, stir fermentation system and regulate the speed that stirs fermentation system and regulate the mixed aqueous solution of sorbyl alcohol and methyl alcohol or the stream rate of acceleration realization of methyl alcohol or methanol solution, described stir speed (S.S.) is 200rpm-900rpm; The speed of described bubbling air is 0.5L/L fermention medium/min-1.5L/L fermention medium/min; Described stream adds the mixed aqueous solution of sorbyl alcohol and methyl alcohol or the speed of methyl alcohol or methanol solution is the mixed aqueous solution of 2ml sorbyl alcohol and methyl alcohol or mixed aqueous solution or methyl alcohol or the methanol solution/L fermention medium/h of methyl alcohol or methanol solution/L fermention medium/h-6ml sorbyl alcohol and methyl alcohol.
Reorganization disclosed by the invention bacterium contains mannase gene a plurality of copies, that expressed by methanol induction.Experiment showed, and of the present inventionly carry out the technology that high density fermentation is produced alkali mannanase with this reorganization bacterium that can make final alkali mannanase in the induction duration of 84h, enzyme work reaches 6336u/ml.The inventive method cost is low, simple to operate, productive rate is high.Therefore, the inventive method has broad application prospects in the preparation field of mannase.
Description of drawings
Fig. 1 is the structure synoptic diagram of secreted expression carrier pAO815alpha.
Fig. 2 is recombinant expression vector pAO α-1sman, pAO α-2sman, the structure synoptic diagram of pAO α-4sman.
Fig. 3 is that reorganization bacterium GS4SMAN is in methanol induction high density fermentation result.
Fig. 4 for reorganization bacterium GS4SMAN in sorbyl alcohol mixing feed supplement, 30 ℃ of results of high density fermentation when inducing
Fig. 5 for reorganization bacterium GS4SMAN in sorbyl alcohol mixing feed supplement, 26 ℃ of results of high density fermentation when inducing
Embodiment
Employed experimental technique is ordinary method if no special instructions among the following embodiment.
Used material, reagent etc. if no special instructions, all can obtain from commercial channels among the following embodiment.
The structure of embodiment 1, alkali mannanase secretion expression carrier
One, the clone of alkali mannanase gene
Design and synthetic primer
Primer 1 (Forward): 5 ' ATAT
CTCGAGAAAAGATCCCCATCAGAAGC 3 '
Primer 2 (Reverse): 5 ' CGGGC
GAATTCTATCTTAAAGTAACATTAT 3 '
In α-mating factor signal peptide-coding sequence downstream an XhoI restriction enzyme site (CTCGAG is arranged, corresponding amino acid is Leu-Glu), thereafter immediately following a Kex2 proteolytic enzyme recognition site (AAAAGA, corresponding aminoacid sequence Lys-Arg), therefore, the design of primer 1 is to introduce XhoI site and Kex2 proteolytic enzyme recognition site sequence before mannase gene.By this design, mannase gene directly can be connected after the signal peptide sequence, like this behind the protein translation, under the effect of pichia spp self Kex2 proteolytic enzyme, can cut and give expression to the constant target protein of amino acid (and can not introduce extra amino-acid residue because of the reason of restriction enzyme site).Primer 2 comprises terminator codon TAG, and introduces an EcoRI restriction enzyme site.
Be template (or be template with gene shown in the SEQ ID NO:1 of synthetic) with the total DNA of Alkaliphilic bacillus N16-5, add primer 1, primer 2, HiFi Taq archaeal dna polymerase and dNTP mixture, carry out touchdown PCR (touchdown PCR), reaction conditions is as follows: 94 ℃ of 5min; 94 ℃ of 30s, 60-50 ℃ of 30s, 72 ℃ of 90s, 1 ℃ of each cycle down, totally 10 circulations; 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 90s, totally 25 circulations.
Pcr amplification obtains the fragment of 1400bp, called after sman, behind Omega purification kit purifying, connect into pMD18-T carrier (available from TaKaRa company), obtain recombinant vectors pMD18-sman, send Beijing AudioCodes to check order pMD18-sman, sequencing result shows in the fragment that pcr amplification obtains and contains sequence shown in the SEQ ID NO:1.
Two, the structure of secretion expression carrier
Make up flow process as depicted in figs. 1 and 2.
The preparation of pAO815alpha: pPICZ α (available from Invitrogen company) is used the SacI/EcoRI double digestion, collect 1000bp fragment (fragment that namely contains α-mating factor signal dna encoding peptide); With SacI/EcoRI double digestion pAO815 carrier (available from Invitrogen company), reclaim the big fragment of carrier; Described 1000bp fragment is connected with the big fragment of described carrier, and the recombinant vectors that obtains is pAO815alpha;
1, the structure of single copy alkali mannanase secretion expression carrier
PMD18-sman XhoI and EcoRI double digestion with step 1 obtains are connected with same pAO815alpha plasmid through XhoI and EcoRI double digestion, form single copy alkali mannanase secretion expression carrier pAO α-1sman.
2, the acquisition of the bacterial strain of 2 copy sman
With the recombinant expression vector pAO α-1sman BamHI/BglII double digestion that obtains in the step 1, reclaim 2932bp fragment (being the BamHI-sman-BglII fragment); With BamHI single endonuclease digestion pAO α-1sman, reclaim the big fragment of carrier; Described 2932bp fragment is connected with the big fragment of described carrier, get final product 2 the copy sman expression vector pAO α-2sman;
3, the acquisition of the bacterial strain of 4 copy sman
With BamHI/BglII double digestion pAO α-2sman, reclaim 5864bp fragment (being the BamHI-sman-sman-BglII fragment); With BamHI single endonuclease digestion pAO α-2sman, reclaim the big fragment of carrier; Described 5864bp fragment is connected with the big fragment of described carrier, get final product 4 the copy sman expression vector pAO α-4sman.
Three, express the acquisition of the yeast strain of mannase
1, electricity transforms the preparation of pichia pastoris phaff cell
Inoculation pichia pastoris phaff bacterial strain GSl15 (Invitrogen, Ca.18100) in 500ml YPD substratum (10 grams per liter yeast extract pastes, 20 grams per liter peptones, 20 grams per liter glucose, 15 grams per liter agaroses), 30 ℃, 200r/min is cultured to OD600=1.3-1.5.4 ℃, the centrifugal 5min of 1,500g collects thalline, respectively washes once with the aqua sterilisa of 500ml, 250ml precooling and the 1mol/L sorbyl alcohol of 20ml precooling respectively.All at 4 ℃, centrifugal 5min collects thalline under 1, the 500g after washing at every turn, and the 1mol/L sorbyl alcohol with the 1ml precooling suspends at last, namely obtains the electric shock competent cell.
2, recombinant expression plasmid electricity transformed yeast cell
Use the SalI linearization for enzyme restriction respectively with making up correct recombinant expression plasmid pAO α-1sman, pAO α-2sman and each about 10ug of pAO α-4sman in the experiment two, ethanol sedimentation reclaims linear DNA and is dissolved in the 10ul sterilized water.Above-mentioned linearizing DNA is mixed with 80ul GS115 competent cell, change in the 0.2cm electricity revolving cup of precooling.Adopt U.S. BIO-RAD company electricity conversion instrument, the pichia spp parameter default according to making electricity consumption conversion instrument shocks by electricity.Add the 1M sorbyl alcohol of 1ml precooling after electric shock finishes immediately to the electric shock cup, the solution in the cup that will shock by electricity then all is transferred in the aseptic centrifuge tube, hatches 1-2h for 37 ℃, gets 500ul coating MD (2 grams per liter glucose, 13.4 grams per liter YNB, 4 * 10
-4Grams per liter vitamin H, 1.5 grams per liter agar) flat board, be inverted cultivation in 30 ℃ and occurred until bacterium colony in 2-4 days.So far, obtain containing the recombinant pichia yeast strain of 1,2,4 copy sman.
The molecular assay method of recombinant pichia yeast strain (namely changing the recombinant pichia yeast strain of pAO α-1sman over to) that contains 1 copy sman: be internal control gene with the GAP gene, the copy number of measuring this bacterial strain sman with fluorescence quantitative PCR method is 1 copy.Concrete measuring method is referring to Taicheng Zhu et al., Efficient generation of multi-copystrains for optimizing secretory expression of porcine insulin precursor in yeast Pichiapastoris, Journal of Applied Microbiology, 2009,107:954-963;
The molecular assay method of recombinant pichia yeast strain (namely changing the recombinant pichia yeast strain of pAO α-2sman over to) that contains 2 copy sman: be internal control gene with the GAP gene, the copy number of measuring this bacterial strain sman with fluorescence quantitative PCR method is 2 copies.
The molecular assay method of recombinant pichia yeast strain (namely changing the recombinant pichia yeast strain of pAO α-4sman over to) that contains 4 copy sman: be internal control gene with the GAP gene, the copy number of measuring this bacterial strain sman with fluorescence quantitative PCR method is 4 copies.
Four, the shake flask fermentation of recombinant bacterial strain
1, the fermentation culture of reorganization bacterium
Bacterial strain, the bacterial strain of 2 copy sman and the bacterial strains of 4 copy sman of single copy sman of the expression alkali mannanase that obtains in the step 3 are inoculated in (10 grams per liter yeast extracts, 20 grams per liter peptones in the 25ml BMGY liquid nutrient medium respectively, behind 121 ℃ of sterilization 20min, when being down to room temperature, temperature adds 13.4 grams per liter YNB, 4 * 10
-4Grams per liter vitamin H, 10 grams per liter glycerine), in 30 ℃, the 200r/min shaking table is cultivated 48h, OD
600Reach the centrifugal 5min of 20,3000r/min and collect thalline, abandon supernatant, wash thalline 1-2 time with sterile purified water.(10 grams per liter yeast extracts, 20 grams per liter peptones behind 121 ℃ of sterilization 20min, add 13.4 grams per liter YNB, 4 * 10 when temperature is down to room temperature with the BMMY inducing culture with thalline
-4Grams per liter vitamin H, 0.5% methyl alcohol), be diluted to OD
600=10, replace cotton plug with 4 layers of gauze, in 30 ℃, the 200r/min shaking table is cultivated.Adding methyl alcohol to final concentration every day is 0.5% (V/V)., get fermented liquid and carry out enzyme biopsy survey after 3 days 30 ℃ of cultivations.All substances in fermenting container note is made fermented liquid.
2, extracellular enzyme mensuration alive
Draw fermented liquid 1mL in centrifuge tube, with the centrifugal 10min of 10000r/min, draw supernatant liquor in test tube.The sample solution and the 0.19mL reaction solution that add the 0.01ml dilution, 72 ℃ of insulation 10min; Add 0.2ml DNS, boil 5min; Get supernatant liquor and measure light absorption value at the 540nm place.The enzyme liquid of making a living to go out is done blank, and the treatment process of blank is the same with the processing of sample.
The enzyme definition of living: be under 9.0 the condition at 37 ℃, pH value, per minute is degraded, and to discharge the needed enzyme amount of 1 μ mol reducing sugar be an enzyme activity unit u to mannosans.
The go out preparation method of the enzyme liquid of making a living: the supernatant liquor that step 1 is obtained boils 5min at 100 ℃, the enzyme liquid that obtains going out and make a living.
Locust bean gum is available from Sigma, and catalog number is G0753.The main component of locust bean gum is mannosans.
Reaction solution compound method: the 0.5g locust bean gum is put into the 250ml beaker, add 90ml at pH9.0,0.05M glycine-sodium hydrate buffer solution (50ml0.2M glycine+8.8ml0.2N sodium hydroxide of 70 ℃ of preheatings, thin up is to 200ml) the magnetic agitation mixing, the water constant volume obtains reaction solution to 500ml then.
DNS: take by weighing Seignette salt 182.0g, be dissolved in the 500mL distilled water, heating (being no more than 50 ℃) adds 3 successively in hot solution, 5-dinitrosalicylic acid 6.3g, NaOH 21.0g, phenol 5.0g, sodium sulphite anhydrous 99.3 5.0g, be stirred to dissolving fully, the cooling back is settled to 1000mL with distilled water, is stored in the brown bottle room temperature preservation.
Enzyme is lived and OD
540Reduction formula be:
Fermentation broth enzyme work=[(OD
540+ 0.187)/0.025/18] * the fermented liquid extension rate.
3 repetitions are established in experiment, and the result takes the mean.
After inducing fermentation 72h, the work of 1-4 copy bacterial strain shake flask fermentation liquid enzyme sees Table 1.Be contrast with the Pichi strain GSl15 that changes pAO815alpha over to simultaneously, result's contrast comes to the same thing with blank, detects less than enzyme and lives.
The enzyme of the different copy of table 1. bacterial strain is lived
With an enzyme the highest strain bacterium called after GS4SMAN alive, this bacterial strain is the recombinant pichia yeast strain that changes pAO α-4sman over to, this bacterial strain is preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center on August 18th, 2010 and (is called for short CGMCC, address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, postcode 100101), preserving number is CGMCC No.4095, classification called after pichia pastoris phaff (Pichia pastoris).
Embodiment 2, fermentation reorganization bacterium prepare mannase
In the following experiment, used reorganization bacterium is pichia pastoris phaff (Pichia pastoris) GS4SMANCGMCC NO.4095.
Yeast extract is available from OXOID company, and catalog number is LP0021.Peptone is available from BD company, and catalog number is 211677.YNB is available from BD company, and catalog number is 291940.Vitamin H is available from Beijing chemical reagents corporation, and catalog number is 67000294.
Fermention medium (BMGY liquid nutrient medium): 10 gram yeast extracts and 20 gram peptones are mixed, behind 121 ℃ of sterilization 20min, add 13.4 gram YNB, 4 * 10 when temperature is down to room temperature
-4Gram vitamin H and 10 gram glycerine, water is settled to 1 liter.
PTM
1(1L): with Cu SO
45H
2O 6g, KI 0.08g, MnSO
42.68g, H
3BO
30.02g, Na
2MoO
42H
2O 0.2g, ZnSO
47H
2O 20g, FeSO
47H
2O 65g, CoCl
26H
2O 0.916, H
2SO
45mL, vitamin H 0.2g mixes, and water is settled to 1 liter.
One, fermentation I:
(1) seed shake-flask culture: from the glycerine pipe, connect 200 microlitre bacterium liquid in 5 milliliters of YPD, cultivate that the inoculum size by 1% is inoculated among the 50mlBMGY behind the 12h, cultivate 24h in 30 ℃, 220r/min, to OD
600=20, obtain seed liquor.
(2) high density fermentation is cultivated:
Prepare: fermentation tank culture medium is pressed 50% liquid amount, and the demarcation of pH, dissolved oxygen electrode is carried out in 121 ℃ of sterilizations earlier before the sterilization, sterilized then 30 minutes, is cooled to 30 ℃, regulates the dissolved oxygen to 100% in the substratum.The method of regulating dissolved oxygen is: bubbling air and regulate Ventilation Rate and stir fermentation system and regulate stir speed (S.S.) in the fermentation system; Stir speed (S.S.) is 200rpm-900rpm; The speed of bubbling air is 0.5-1.5VVM (L air/L fermention medium/min); The method of regulating the pH value is: with the pH value of 50% ammonia aqueous solution regulation system so that the pH value of system remains on 6.0.
Stage one: seed liquor is inserted 1L automatic fermenter (the 0.7L fermention medium wherein is housed) by 5% inoculum size, be 6.0 in the pH value, temperature is that 30 ℃, dissolved oxygen are to cultivate under the condition of (being 30%-100%) more than 30%, the glycerine to substratum exhausts.
In this process, when thalline began to grow, oxygen-consumption increased, and caused dissolved oxygen to begin to reduce by 100%, still regulated dissolved oxygen by the mode of regulating stirring velocity and adjusting blowing air amount, to keep dissolved oxygen more than 30%.The method of regulating dissolved oxygen is: bubbling air and regulate the speed of bubbling air and stir fermentation system and regulate the speed that stirs fermentation system in the fermentation system; Stir speed (S.S.) is 200rpm-900rpm; The speed of bubbling air is 0.5-1.5VVM (L air/L fermention medium/min); The method of regulating the pH value is: with the pH value of 25% ammonia aqueous solution regulation system so that the pH value of system remains on 6.0.
Stage two: when the glycerine in fermentation system exhausts, begin to flow glycerol adding solution, fermentation culture is to the OD of fermentation system
600Value reaches 250, stops to flow glycerol adding solution; In this phase process, the pH value of fermentation system is 6.0, temperature is that 30 ℃, dissolved oxygen are (being 30%-100%) more than 30%; Described glycerine solution is prepared as follows: with 625g glycerine, 12mL PTM
1Solution mixes, and water is settled to 1 liter.
The method of regulating dissolved oxygen is: by bubbling air in fermentation system and regulate bubbling air speed, stir fermentation system and regulate the speed that stirs fermentation system and the stream rate of acceleration of regulating glycerine solution realize; When stir speed (S.S.) transfers to maximum and air flow when transferring to maximum, dissolved oxygen still is lower than at 30% o'clock, just begins to regulate the stream rate of acceleration of glycerine solution.Stir speed (S.S.) is 200rpm-900rpm; The speed of bubbling air is 0.5-1.5VVM; The speed of stream glycerol adding solution is 5ml glycerine solution/L fermention medium/h-15ml glycerine solution/L fermention medium/h;
The method of regulating the pH value is: identical with the stage one.
Stage three: when the glycerine in fermentation system exhausts (behind thalline hunger 0.5~1h), in fermentation system, add methyl alcohol, carry out abduction delivering; The pH value of the fermentation system in this stage is 6.0, temperature is that 30 ℃, dissolved oxygen are (being 30%-100%) more than 30%;
The mode that adds methyl alcohol in the fermentation system is: add methyl alcohol earlier in fermentation system, making the volumetric concentration of methyl alcohol in fermentation system is (purpose is to make bacterium adapt to methyl alcohol) after 5/1000,2 hour, and stream adds methyl alcohol in the fermentation system again.
The method of regulating dissolved oxygen is: be by bubbling air in fermentation system and regulate bubbling air speed, stir fermentation system and regulate the speed that stirs fermentation system and the stream rate of acceleration of regulating methyl alcohol realized; When stir speed (S.S.) transfers to maximum and air flow when transferring to maximum, dissolved oxygen still is lower than at 30% o'clock, just begins to regulate the stream rate of acceleration of methyl alcohol.Described stir speed (S.S.) is 200rpm-900rpm; The speed of described bubbling air is 0.5-1.5VVM; The speed that described stream adds methyl alcohol is 2ml methyl alcohol/L fermention medium/h-6ml methyl alcohol/L fermention medium/h.
The method of regulating the pH value is: identical with the stage one.
At the different time of inducing, get 10mL fermented liquid detection enzyme and live.All substances note in the fermentor tank is made fermented liquid.
Enzyme biopsy survey method: with identical described in the embodiment 1.
3 repetitions are established in experiment, and the result takes the mean.
The enzyme biopsy is surveyed the result as shown in Figure 3, and during abduction delivering 19h, enzyme is lived and is the 1355u/ml fermented liquid in the fermented liquid, during abduction delivering 43h, enzyme is lived and is the 1286u/ml fermented liquid in the fermented liquid, and during abduction delivering 64h, enzyme is lived and is the 1066u/ml fermented liquid in the fermented liquid, during abduction delivering 86h, enzyme is lived and is the 2063u/ml fermented liquid in the fermented liquid, and during abduction delivering 111h, enzyme is lived and is the 2921u/ml fermented liquid in the fermented liquid, during abduction delivering 134h, enzyme is lived and is the 3918u/ml fermented liquid in the fermented liquid.
Ferment with the following method: the OD that removes fermentation system when stopping to flow glycerol adding solution in the stage two
600Value is outside 200, and all the other conditions are all identical among the I with fermentation.And select the enzyme that detects in the fermented liquid at the induction time identical with fermentation I and live, the result does not have significant difference among result and the fermentation I.Work as OD
600Value is 320 or 350 o'clock, and the result does not all have significant difference yet.
Two, fermentation II:
Except in the stage three, the inducing solution of adding is outside the mixed aqueous solution (mass ratio of sorbyl alcohol and methyl alcohol is 1: 10, and the concentration of sorbyl alcohol is 72g/L, and the concentration of methyl alcohol is 720g/L) of sorbyl alcohol and methyl alcohol, and all the other are all identical with method described in the experiment one.
3 repetitions are established in experiment, and the result takes the mean.
The enzyme biopsy is surveyed the result shown in Fig. 4 A, and during abduction delivering 19h, enzyme is lived and is the 1076u/ml fermented liquid in the fermented liquid, during abduction delivering 43h, enzyme is lived and is the 1081u/ml fermented liquid in the fermented liquid, and during abduction delivering 64h, enzyme is lived and is the 1145u/ml fermented liquid in the fermented liquid, during abduction delivering 86h, enzyme is lived and is the 3258u/ml fermented liquid in the fermented liquid, and during abduction delivering 111h, enzyme is lived and is the 3485u/ml fermented liquid in the fermented liquid, during abduction delivering 134h, enzyme is lived and is the 4316u/ml fermented liquid in the fermented liquid.
Ferment with the following method: the OD that removes fermentation system when stopping to flow glycerol adding solution in the stage two
600Value is outside 200, and all the other conditions are all identical among the II with fermentation.And select the enzyme that detects in the fermented liquid at the induction time identical with fermentation II and live, the result does not have significant difference among result and the fermentation II.Work as OD
600Value is 320 or 350 o'clock, and the result does not all have significant difference yet.
Ferment with the following method: the sorbyl alcohol that adds in the stage three was different with the mixed aqueous solution of methyl alcohol, all the other were all identical with method described in the real fermentation II.In the mixed aqueous solution of sorbyl alcohol and methyl alcohol, the mass ratio of sorbyl alcohol and methyl alcohol is 1: 5 (concentration of sorbyl alcohol is 144g/L, and the concentration of methyl alcohol is 720g/L).And select the enzyme that detects in the fermented liquid at the induction time identical with fermentation II and live, the result does not have significant difference among result and the fermentation II.In the mixed aqueous solution of sorbyl alcohol and methyl alcohol, when the mass ratio of sorbyl alcohol and methyl alcohol was 1: 20 (concentration of sorbyl alcohol is 36g/L, and the concentration of methyl alcohol is 720g/L), the result did not all have significant difference yet.
Three, fermentation III:
Remove the OD of fermentation system when in the stage two, stopping to flow glycerol adding solution
600Value is outside 320, and all the other conditions are all identical in two with experiment.
3 repetitions are established in experiment, and the result takes the mean.
The enzyme biopsy is surveyed the result shown in Fig. 4 B, and during abduction delivering 12h, enzyme is lived and is the 1196u/ml fermented liquid in the fermented liquid, during abduction delivering 36h, enzyme is lived and is the 1742u/ml fermented liquid in the fermented liquid, and during abduction delivering 48h, enzyme is lived and is the 2382u/ml fermented liquid in the fermented liquid, during abduction delivering 60h, enzyme is lived and is the 2122u/ml fermented liquid in the fermented liquid, and during abduction delivering 72h, enzyme is lived and is the 2822u/ml fermented liquid in the fermented liquid, during abduction delivering 84h, enzyme is lived and is the 4364u/ml fermented liquid in the fermented liquid.
Ferment with the following method: the OD that removes fermentation system when stopping to flow glycerol adding solution in the stage two
600Value is outside 200, and all the other conditions are all identical among the III with fermentation.And select the enzyme that detects in the fermented liquid at the induction time identical with fermentation III and live, the result does not have significant difference among result and the fermentation III.Work as OD
600Value is 250 or 350 o'clock, and the result does not all have significant difference yet.
Ferment with the following method: the sorbyl alcohol that adds in the stage three was different with the mixed aqueous solution of methyl alcohol, all the other were all identical with method described in the real fermentation III.In the mixed aqueous solution of sorbyl alcohol and methyl alcohol, the mass ratio of sorbyl alcohol and methyl alcohol is 1: 5 (concentration of sorbyl alcohol is 144g/L, and the concentration of methyl alcohol is 720g/L).And select the enzyme that detects in the fermented liquid at the induction time identical with fermentation III and live, the result does not have significant difference among result and the fermentation III.In the mixed aqueous solution of sorbyl alcohol and methyl alcohol, when the mass ratio of sorbyl alcohol and methyl alcohol was 1: 20 (concentration of sorbyl alcohol is 36g/L, and the concentration of methyl alcohol is 720g/L), the result did not all have significant difference yet.
Four, fermentation IV:
Except in the stage three before the mixing solutions that adds sorbyl alcohol and methyl alcohol, the temperature with fermentation system transfers to 26 ℃ earlier, and all remains on outside 26 ℃ in the whole temperature of fermentation system in the process of inducing, all the other are all with to test method described in three identical.
3 repetitions are established in experiment, and the result takes the mean.
The enzyme biopsy is surveyed the result as shown in Figure 5, and during abduction delivering 12h, enzyme is lived and is the 1172u/ml fermented liquid in the fermented liquid, during abduction delivering 36h, enzyme is lived and is the 2078u/ml fermented liquid in the fermented liquid, and during abduction delivering 48h, enzyme is lived and is the 2402u/ml fermented liquid in the fermented liquid, during abduction delivering 60h, enzyme is lived and is the 3252u/ml fermented liquid in the fermented liquid, and during abduction delivering 72h, enzyme is lived and is the 6020u/ml fermented liquid in the fermented liquid, during abduction delivering 84h, enzyme is lived and is the 6336u/ml fermented liquid in the fermented liquid.
Ferment with the following method: the OD that removes fermentation system when stopping to flow glycerol adding in the stage two
600Value is outside 200, and all the other conditions are all identical among the IV with fermentation.The result does not have significant difference among result and the fermentation IV.Work as OD
600Value is 250 or 350 o'clock, and the result does not all have significant difference yet.
Ferment with the following method: the sorbyl alcohol that adds in the stage three was different with the mixed aqueous solution of methyl alcohol, all the other were all identical with method described in the real fermentation III.In the mixed aqueous solution of sorbyl alcohol and methyl alcohol, the mass ratio of sorbyl alcohol and methyl alcohol is 1: 5 (concentration of sorbyl alcohol is 144g/L, and the concentration of methyl alcohol is 720g/L).And select the enzyme that detects in the fermented liquid at the induction time identical with fermentation III and live, the result does not have significant difference among result and the fermentation III.In the mixed aqueous solution of sorbyl alcohol and methyl alcohol, when the mass ratio of sorbyl alcohol and methyl alcohol was 1: 20 (concentration of sorbyl alcohol is 36g/L, and the concentration of methyl alcohol is 720g/L), the result did not all have significant difference yet.
Claims (15)
1. a reorganization bacterium is the encoding gene importing starting strain with 'beta '-mannase, the reorganization bacterium that obtains; The coding gene sequence of described 'beta '-mannase is shown in 7-1407 position Nucleotide among the SEQ ID NO:1;
The encoding gene of described 'beta '-mannase imports starting strain by recombinant vectors; Described recombinant vectors is shown in following (1) or (2) or (3):
(1) dna fragmentation shown in the SEQ ID NO:1 is inserted between the XhoI and EcoRI restriction enzyme site of pAO815alpha, the recombinant vectors that obtains, note is made pAO α-1sman; Wherein, the XhoI restriction enzyme site is positioned at 5 of dna fragmentation shown in the SEQ ID NO:1 ' end upstream, and the EcoRI restriction enzyme site is positioned at 3 of dna fragmentation shown in the SEQ ID NO:1 ' end downstream;
(2) with BamHI/BglII double digestion pAO α-1sman, reclaim the 2932bp fragment; With BamHI single endonuclease digestion pAO α-1sman, reclaim the big fragment of carrier; Described 2932bp fragment is connected with the big fragment of described carrier, the recombinant vectors that obtains, note is made pAO α-2sman;
(3) with BamHI/BglII double digestion pAO α-2sman, reclaim the 5864bp fragment; With BamHI single endonuclease digestion pAO α-2sman, reclaim the big fragment of carrier; Described 5864bp fragment is connected with the big fragment of described carrier, the recombinant vectors that obtains, note is made pAO α-4sman;
Described pAO815alpha obtains as follows: with carrier pPICZ α SacI/EcoRI double digestion, collect the 1000bp fragment; With SacI/EcoRI double digestion carrier pAO815, reclaim the big fragment of carrier; Described 1000bp fragment is connected with the big fragment of described carrier, and the recombinant vectors that obtains is pAO815alpha;
Described starting strain is pichia pastoris phaff bacterial strain GS115.
2. reorganization bacterium according to claim 1, it is characterized in that: described reorganization bacterium is pichia pastoris phaff (Pichia pastoris) GS4SMAN, and its deposit number is CGMCC NO.4095.
3. a method for preparing 'beta '-mannase comprises the steps: claim 1 or 2 described reorganization bacterium are inoculated in the fermention medium, and fermentation culture obtains 'beta '-mannase; All substances in fermenting container note is made fermentation system;
Described fermention medium is the substratum for the cultivation Pichia yeast, and wherein contains glycerine;
Described fermentation culture is carried out according to following three phases successively:
Stage one: comprise the steps: to exhaust from the glycerine that inoculation begins to be cultured to the fermentation system;
Stage two: when comprising the steps: that glycerine in fermentation system exhausts, begin to flow glycerol adding or glycerine solution, be cultured to the OD of fermentation system
600Value reaches 200-350, stops to flow glycerol adding or glycerine solution;
Stage three: be following 1) or 2) shown in:
When 1) comprising the steps: that glycerine in fermentation system exhausts, add mixed aqueous solution or methyl alcohol or the methanol solution of sorbyl alcohol and methyl alcohol in the fermentation system, carry out abduction delivering;
When 2) comprising the steps: that glycerine in fermentation system exhausts, the temperature of fermentation system is transferred to 26 ℃~29 ℃, add mixed aqueous solution or methyl alcohol or the methanol solution of sorbyl alcohol and methyl alcohol in the fermentation system, carry out abduction delivering;
Described glycerine solution is by glycerine, PTM
1Solution and water are formed; Described methanol solution is by methyl alcohol, PTM
1Solution and water are formed.
4. method according to claim 3 is characterized in that:
In stage two, be cultured to the OD of fermentation system
600Value reaches 200 or 250 or 320 or 350, stops to flow glycerol adding or glycerine solution;
In the stage three 2) in, when the glycerine in fermentation system exhausts, the temperature of fermentation system is transferred to 26 ℃ or 27 ℃ or 28 ℃ or 29 ℃, add mixed aqueous solution or methyl alcohol or the methanol solution of sorbyl alcohol and methyl alcohol in the fermentation system, carry out abduction delivering.
5. method according to claim 3, it is characterized in that: in the mixed aqueous solution of described sorbyl alcohol and methyl alcohol, the mass ratio of sorbyl alcohol and methyl alcohol is 1: 20~1: 5.
6. method according to claim 5, it is characterized in that: in the mixed aqueous solution of described sorbyl alcohol and methyl alcohol, the mass ratio of sorbyl alcohol and methyl alcohol is 1: 20 or 1: 10 or 1: 5.
7. method according to claim 3, it is characterized in that: in the mixed aqueous solution of described sorbyl alcohol and methyl alcohol, the concentration of sorbyl alcohol is 36g/L-144g/L, and the concentration of methyl alcohol is 720g/L.
8. method according to claim 7, it is characterized in that: in the mixed aqueous solution of described sorbyl alcohol and methyl alcohol, the concentration of sorbyl alcohol is 36g/L or 72g/L or 144g/L.
9. method according to claim 3 is characterized in that: the cultivation in described stage one and described stage two is 6.0 in the pH value, temperature is that 30 ℃, dissolved oxygen are to carry out under the condition more than 30%;
In the described stage three 1) in, abduction delivering is 6.0 in the pH value, temperature is that 30 ℃, dissolved oxygen are to carry out under the condition more than 30%;
In the described stage three 2) in, abduction delivering is 6.0 in the pH value, temperature is that 26 ℃~29 ℃, dissolved oxygen are to carry out under the condition more than 30%.
10. method according to claim 9 is characterized in that:
In the described stage three 2) in, abduction delivering is 6.0 in the pH value, temperature is 26 ℃ or 27 ℃ or 28 ℃ or 29 ℃, dissolved oxygen are to carry out under the condition more than 30%.
11. method according to claim 9 is characterized in that: in the described stage three, the time of abduction delivering is 60h-160h;
In the described stage one, described inoculum size is 5%;
In the described stage three, described glycerine in fermentation system exhausts when Shi Weicong stops to flow glycerol adding to be counted, behind 0.5~1h;
Described dissolved oxygen is to be 30%-100% for dissolved oxygen more than 30%;
Described fermention medium is the BMGY liquid nutrient medium;
Described glycerine solution is prepared as follows: with 600g-650g glycerine, 10ml-14ml PTM
1Solution mixes, and water is settled to 1 liter.
12. method according to claim 11 is characterized in that: in the described stage three, the time of abduction delivering is 60h-84h or 86h-134h;
In the described stage three, described glycerine solution is prepared as follows: with 625g glycerine, 12mL PTM
1Solution mixes, and water is settled to 1 liter.
13. method according to claim 12 is characterized in that: in the described stage three, the time of abduction delivering is 60h, 72h, 84h, 64h, 86h, 111h or 134h.
14. method according to claim 9 is characterized in that:
In the described stage three, the described sorbyl alcohol that adds in the fermentation system with the mixed aqueous solution of methyl alcohol or the mode of methyl alcohol or methanol solution is: add methyl alcohol in fermentation system earlier, making the volumetric concentration of methyl alcohol in fermentation system is 3/1000-7/1000,1.5 hour after-2.5 hours, stream adds mixed aqueous solution or methyl alcohol or the methanol solution of sorbyl alcohol and methyl alcohol in the fermentation system again;
In the described stage one, described dissolved oxygen is to be by bubbling air in fermentation system more than 30% and to regulate the speed of bubbling air and stir fermentation system and regulate the speed that stirs fermentation system and realize; Described stir speed (S.S.) is 200rpm-900rpm; The speed of described bubbling air is every liter of fermention medium bubbling air 0.5L-1.5L in the per minute time;
In the described stage two, described dissolved oxygen be more than 30% be by bubbling air in fermentation system and regulate bubbling air speed, stir fermentation system and regulate the speed that stirs fermentation system and the stream rate of acceleration of regulating glycerine or glycerine solution realizes that described stir speed (S.S.) is 200rpm-900rpm; The speed of described bubbling air is every liter of fermention medium bubbling air 0.5L-1.5L in the per minute time; The speed of described stream glycerol adding or glycerine solution is every liter of fermentation culture base flow glycerol adding in time per hour or glycerine solution 5ml-15ml;
In the described stage three, described dissolved oxygen be more than 30% be by bubbling air in fermentation system and regulate bubbling air speed, stir fermentation system and regulate the speed that stirs fermentation system and regulate the mixed aqueous solution of sorbyl alcohol and methyl alcohol or the stream rate of acceleration realization of methyl alcohol or methanol solution, described stir speed (S.S.) is 200rpm-900rpm; The speed of described bubbling air is every liter of fermention medium bubbling air 0.5L-1.5L in the per minute time; Described stream adds the mixed aqueous solution of sorbyl alcohol and methyl alcohol or the speed of methyl alcohol per hour is mixed aqueous solution or the methyl alcohol 2ml-6ml that interior every liter of fermentation culture base flow of time adds sorbyl alcohol and methyl alcohol.
15. method according to claim 14 is characterized in that:
In the described stage three, the described sorbyl alcohol that adds in the fermentation system with the mixed aqueous solution of methyl alcohol or the mode of methyl alcohol or methanol solution is: add methyl alcohol in fermentation system earlier, making the volumetric concentration of methyl alcohol in fermentation system is 5/1000, after 2 hours, stream adds mixed aqueous solution or methyl alcohol or the methanol solution of sorbyl alcohol and methyl alcohol in the fermentation system again.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 201010297135 CN102433267B (en) | 2010-09-29 | 2010-09-29 | Method for preparing beta-mannase and special strain |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 201010297135 CN102433267B (en) | 2010-09-29 | 2010-09-29 | Method for preparing beta-mannase and special strain |
Publications (2)
Publication Number | Publication Date |
---|---|
CN102433267A CN102433267A (en) | 2012-05-02 |
CN102433267B true CN102433267B (en) | 2013-08-07 |
Family
ID=45981614
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN 201010297135 Expired - Fee Related CN102433267B (en) | 2010-09-29 | 2010-09-29 | Method for preparing beta-mannase and special strain |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN102433267B (en) |
Families Citing this family (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103146724B (en) * | 2012-12-29 | 2015-04-22 | 湖北大学 | Reorganized mannase, genetically-engineered bacteria of recombined mannose and hydrolyzing preparation mannan oligosaccharide method |
CN104099262B (en) * | 2013-04-09 | 2017-02-01 | 中国科学院微生物研究所 | Recombinant bacterium for constitutive expression of alkaline beta-mannanase |
CN104559994A (en) * | 2013-10-14 | 2015-04-29 | 中国石油集团川庆钻探工程有限公司长庆井下技术作业公司 | Biological gel breaker |
CN104762243A (en) * | 2014-01-08 | 2015-07-08 | 中国科学院微生物研究所 | Recombinant strain and method for preparing alkaline beta-mannanase |
CN105754970B (en) * | 2014-12-19 | 2019-07-12 | 中国科学院微生物研究所 | A kind of application of alkaline ' beta '-mannase and its encoding gene and they |
CN106282278B (en) * | 2015-06-29 | 2021-06-08 | 广东东阳光药业有限公司 | Fermentation method of human papilloma virus L1 protein |
CN106916911B (en) * | 2015-12-28 | 2021-06-29 | 丰益(上海)生物技术研发中心有限公司 | MutsFermentation control process of recombinant pichia pastoris |
CN108396017A (en) * | 2017-10-20 | 2018-08-14 | 山东奥博生物科技有限公司 | A kind of industrial fermentation process of mannase |
CN109536395A (en) * | 2018-02-07 | 2019-03-29 | 四川润格生物科技有限公司 | It is a kind of it is high expression 'beta '-mannase pichia pastoris engineered strain and application |
Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1351169A (en) * | 2000-10-26 | 2002-05-29 | 中国科学院微生物研究所 | Gene sequence of beta-mannase and process for preparing recombinant enzyme coded by it |
CN1699550A (en) * | 2005-05-17 | 2005-11-23 | 上海大学 | High density fermentation method for GS115/PFK-K5 |
CN100999738A (en) * | 2006-01-11 | 2007-07-18 | 广州伯凯生物技术有限公司 | Multi-copy gene carrier of high efficient expression mannanase |
CN101560476A (en) * | 2009-04-30 | 2009-10-21 | 中国农业大学 | Gene engineering bacterium of dual-copy beta-mannase and application thereof |
US20100126726A1 (en) * | 2008-11-21 | 2010-05-27 | Charles David Armstrong | ALKALINE BETA-MANNANASE CONTAINING COMPOSITIONS USEFUL FOR THE HYDROLYSIS OF GUAR IN HIGH pH ENVIRONMENTS AND METHODS RELATED THERETO |
-
2010
- 2010-09-29 CN CN 201010297135 patent/CN102433267B/en not_active Expired - Fee Related
Patent Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1351169A (en) * | 2000-10-26 | 2002-05-29 | 中国科学院微生物研究所 | Gene sequence of beta-mannase and process for preparing recombinant enzyme coded by it |
CN1699550A (en) * | 2005-05-17 | 2005-11-23 | 上海大学 | High density fermentation method for GS115/PFK-K5 |
CN100999738A (en) * | 2006-01-11 | 2007-07-18 | 广州伯凯生物技术有限公司 | Multi-copy gene carrier of high efficient expression mannanase |
US20100126726A1 (en) * | 2008-11-21 | 2010-05-27 | Charles David Armstrong | ALKALINE BETA-MANNANASE CONTAINING COMPOSITIONS USEFUL FOR THE HYDROLYSIS OF GUAR IN HIGH pH ENVIRONMENTS AND METHODS RELATED THERETO |
CN101560476A (en) * | 2009-04-30 | 2009-10-21 | 中国农业大学 | Gene engineering bacterium of dual-copy beta-mannase and application thereof |
Non-Patent Citations (3)
Title |
---|
Characterization and gene cloning of a novel ß-mannanase from alkaliphilic Bacillus sp. N16-5;Yanhe Ma et al;《Extremophiles》;20040814;第8卷;第448页左栏第1行至第450页右栏第5行 * |
Inducible and constitutive expression of a novel thermostable alkaline β-mannanase from alkaliphilic Bacillus sp. N16-5 in Pichia pastoris and characterization of the recombinant enzyme;Xiuping He et al;《Enzyme and Microbial Technology》;20080315;第43卷;第14页左栏第5行至第16页左栏第2行及图1-3 * |
碱性_甘露聚糖酶基因异源表达的研究;路志群 等;《微生物学杂志》;20060531;第26卷(第3期);第9页右栏第3行至第11页左栏第7行 * |
Also Published As
Publication number | Publication date |
---|---|
CN102433267A (en) | 2012-05-02 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN102433267B (en) | Method for preparing beta-mannase and special strain | |
Uçkun Kiran et al. | Enzyme production from food wastes using a biorefinery concept | |
CN104651383A (en) | Recombinant pichia pastoris engineering bacteria and production method thereof | |
CN106701606B (en) | Genetic engineering candida utilis capable of degrading and utilizing kitchen waste and construction method thereof | |
CN102660519B (en) | Method for preparing biological enzyme by utilizing fermentation waste liquid | |
CN111593036B (en) | Preparation of enzyme preparation mainly containing acid protease, strain and application thereof | |
CN106367409A (en) | Method for simultaneous high-yield production of cellulase and [beta]-glucosidase | |
CN103045566A (en) | Method for producing cellulase by using induction and regulation of substrate | |
CN105695439A (en) | Beta-glucosidase gene recombinant expression method | |
CN103013961A (en) | Method for producing neutral protease and feed additive by using fermentation of manioc wastes | |
CN104975039A (en) | Recombinant plasmid and application of recombinant plasmid to degrading cellulose raw material | |
CN101671645A (en) | Method for preparing beta-mannase and special strain thereof | |
CN101638678A (en) | Preparation method of konjac oligosaccharides | |
CN105713851B (en) | One plant of Clostridium beijerinckii and its application | |
CN103146629A (en) | Bacterial strain of bacillus licheniformis with vitreoscilla hemoglobin gene as well as construction method and application of bacterial strain | |
CN103173366B (en) | Pectinase producing bacterial strain and application in preparation of peeled citrous complex enzyme | |
CN101633897B (en) | Recombinant bacterium for expressing glutamine transaminage and application thereof | |
CN106884030A (en) | The method for improving the fermentation yield of the fusion protein of containing cellulose binding domain | |
CN102329785B (en) | Medium-temperature alkali-resistant mannase Man5XH9 and gene and application thereof | |
CN104560833A (en) | Basophilic micrococcus and alkaline xylanase produced from basophilic micrococcus and application | |
CN104357425A (en) | Novel alpha-galactosidase NGAL, and gene and application thereof | |
CN108517329A (en) | A kind of recombination Yarrowia lipolytica lipase and its expression bacterial strain and application | |
CN102517268A (en) | Method for producing alkaline protease | |
CN101544954B (en) | Recombinant pichia pastoris expressing non-starch polysaccharides complex enzymes and application thereof | |
CN101824401B (en) | Glucanase and coding nucleic acid and expression thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130807 Termination date: 20200929 |