CN104762243A - Recombinant strain and method for preparing alkaline beta-mannanase - Google Patents

Recombinant strain and method for preparing alkaline beta-mannanase Download PDF

Info

Publication number
CN104762243A
CN104762243A CN201410008696.2A CN201410008696A CN104762243A CN 104762243 A CN104762243 A CN 104762243A CN 201410008696 A CN201410008696 A CN 201410008696A CN 104762243 A CN104762243 A CN 104762243A
Authority
CN
China
Prior art keywords
bacterial strain
recombinant bacterial
beta
alkaline
mannase
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201410008696.2A
Other languages
Chinese (zh)
Inventor
薛燕芬
陶勇
马延和
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Microbiology of CAS
Original Assignee
Institute of Microbiology of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Microbiology of CAS filed Critical Institute of Microbiology of CAS
Priority to CN201410008696.2A priority Critical patent/CN104762243A/en
Publication of CN104762243A publication Critical patent/CN104762243A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2477—Hemicellulases not provided in a preceding group
    • C12N9/2488—Mannanases
    • C12N9/2494—Mannan endo-1,4-beta-mannosidase (3.2.1.78), i.e. endo-beta-mannanase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01078—Mannan endo-1,4-beta-mannosidase (3.2.1.78), i.e. endo-beta-mannanase

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The present invention discloses a recombinant strain, which is recombinant escherichia coli containing a gene encoding alkaline beta-mannanase, and the base sequence of the gene is represented by SEQ ID NO:1. The present invention further discloses a method for preparing the alkaline beta-mannanase, wherein the method comprises: inoculating the recombinant strain into a liquid fermentation culture medium to ferment to obtain the fermentation broth containing the alkaline beta-mannanase. With the technical scheme, the recombinant strain of the present invention can highly express the alkaline beta-mannanase, and the required fermentation time is short. With the application of the method of the present invention to prepare the alkaline beta-mannanase, the enzyme content of the finally-obtained fermentation broth can achieve 6000 U/ml.

Description

A kind of recombinant bacterial strain and the method preparing alkaline ' beta '-mannase
Technical field
The invention belongs to genetically engineered field, particularly, relate to a kind of recombinant bacterial strain and utilize this recombinant bacterial strain to prepare the method for alkaline ' beta '-mannase.
Background technology
'beta '-mannase (β-mannanase, EC3.2.1.78) be a kind of hemicellulase, can the vegetable polysaccharides such as hydrolyzing mannan, glucomannan, polygalactomannan and gala glucomannan (see Tipdon, R.S.et al.:Advances in Carbohydrate Chemistry andBiochemistry, 32:299-316, Academic Press, New York, 1976.).Mannosans is a kind of hemicellulose resource compared with horn of plenty that occurring in nature exists, next in number only to Mierocrystalline cellulose.Seeds of leguminous plant, wood of coniferous tree, green coffee bean etc. all contain a large amount of mannosanss, some vegetable jelly, the mannosans that as blue or green in field glue, carob bean gum, konjaku powder etc. are almost made up of semi-lactosi or glucose and seminose completely.'beta '-mannase is utilized to carry out deep processing and fully utilize to have very large application potential to above-mentioned vegetable material.Now be mainly used in both at home and abroad the bleaching of paper industry paper pulp, the broken glue of oil well, degrading plant glue produces oligose and be used as bifidus bacillus somatomedin, as antinutritional factor in the protective foods that anti-disease, anti-aging is old and fodder industry.
'beta '-mannase has dividing of acidity, neutrality, alkalescence by the difference of its optimum pH, wherein the research of alkaline ' beta '-mannase is relatively late, find to produce primarily of Alkaliphilic bacillus (alkaliphilicBacillus), some Bacillus licheniformis (Bacillus licheniformis) also produces alkaline ' beta '-mannase, as Yang Wenbo etc. reports a bacillus licheniformis NK-27, its optimum pH is 9.0.Generally subtilis, actinomycetes etc. produce neutral β-Mannannase, and mould produces acidic beta-mannase.First alkaline ' beta '-mannase is by discoveries such as Akino.Ma Yan reported purifying and the zymologic property of the outer alkaline ' beta '-mannase of three born of the same parents of Alkaliphilic bacillus N16-5 with equaling 199l, and reported the gene order of wherein a kind of basophilic mannase in 2004.Takeda equals to have found for 2004 that a bacterial strain JAMB-602 of bacillus produces alkaline ' beta '-mannase, and this enzyme belongs to GH family 5, and optimal pH is 9.The optimum pH of the basophilic mannase found at present is up to 10, equals report in 2004 by Takeda.
Alkaline ' beta '-mannase not only can produce as bifidus bacillus somatomedin oligose, and to be with a wide range of applications in industrial aspect such as needing the association with pulp bleaching of alkaline environment.But up to the present, the preparation of alkaline ' beta '-mannase is still the bottleneck limiting its industrial application, no matter be use the original bacterial strain of alkaline ' beta '-mannase or use recombinant bacterial strain to produce in the report of forefathers, its output is all lower, or the time needing fermentation longer.As Ma Yan and reporting by Alkaliphilic bacillus N16-5 bacterial strain after culture optimization, output reaches 500U/ml(see CN1266096A).Zhu Taicheng etc. are with Pichia anomala expression from Alkaliphilic bacillus N16-5 gene, and the enzyme content of the 120 hours alkaline ' beta '-mannases that ferment reaches 6000U/ml(see CN102433267A).
Summary of the invention
The object of the invention is to overcome the deficiencies in the prior art, provide a kind of can higher level expression alkaline ' beta '-mannase recombinant bacterial strain and utilize this bacterial strain to prepare the method for alkaline ' beta '-mannase.
To achieve these goals, first aspect, the invention provides a kind of recombinant bacterial strain, and this recombinant bacterial strain is the recombination bacillus coli of the gene containing encodes alkaline 'beta '-mannase, and the base sequence of described gene is as shown in SEQ ID NO:1.
Second aspect, the invention provides a kind of method preparing alkaline ' beta '-mannase, and the method comprises the recombinant bacterial strain described in first aspect to be seeded in liquid fermentation medium ferments, and obtains the fermented liquid containing alkaline ' beta '-mannase.
By technique scheme, recombinant bacterial strain of the present invention can express alkaline ' beta '-mannase at a high level, and the time of required fermentation is shorter.Adopt method of the present invention to prepare alkaline ' beta '-mannase, the enzyme content in the fermented liquid finally obtained can reach 6000U/ml.
Other features and advantages of the present invention are described in detail in embodiment part subsequently.
Accompanying drawing explanation
Accompanying drawing is used to provide a further understanding of the present invention, and forms a part for specification sheets, is used from explanation the present invention, but is not construed as limiting the invention with embodiment one below.In the accompanying drawings:
Fig. 1 be in fermented liquid enzyme content and protein concentration with the change curve of fermentation time.
Embodiment
Below in conjunction with accompanying drawing, the specific embodiment of the present invention is described in detail.Should be understood that, embodiment described herein, only for instruction and explanation of the present invention, is not limited to the present invention.
In the present invention, when not doing contrary explanation, " enzyme content " represents with enzyme activity unit (U) number contained in every ml fermented liquid, unit is U/ml, and 37 DEG C, under pH value is the condition of 9.0, the per minute degraded mannosans enzyme amount discharged required for 1 μm of ol reducing sugar is an enzyme activity unit U; " dissolved oxygen amount " represents by the result that dissolved oxygen electrode records, and dissolved oxygen amount when definition fermentation starts is 100%.
The invention provides a kind of recombinant bacterial strain, this recombinant bacterial strain is the recombination bacillus coli of the gene containing encodes alkaline 'beta '-mannase, and the base sequence of described gene is as shown in SEQ ID NO:1.Recombinant bacterial strain of the present invention can adopt conventional genetic engineering technique to obtain, such as, obtain the gene of base sequence as shown in SEQ ID NO:1, build the expression vector containing the gene of base sequence as shown in SEQ ID NO:1, then this expression vector is proceeded in intestinal bacteria and can obtain.Can increase from the STb gene of Alkaliphilic bacillus N16-5 and obtain the gene of base sequence as shown in SEQ ID NO:1, and the primer of " upstream primer sequence as shown in SEQ ID NO:2 and downstream primer sequence as shown in SEQ ID NO:3 " can be adopted to increase.
agttcaggcttttatgttgatggcaatacgttatatgacgcaaacgggcaaccatttgtcatgaaaggcattaaccatggacatgcttggtataaagacaccgcttcaacagctattcctgccattgcagagcaaggcgcgaacacgatacgtattgttttatcagatggcggtcaatgggaaaaagacgacattgacaccgttcgtgaagttattgagcttgcggagcaaaataaaatggtggctgtcgttgaagttcatgatgccacgggccgtgattcacgcagtgatttagatcgggcagtcgattattggatagagatgaaagatgcacttatcggcaaagaggatactgtcattattaacattgcaaacgaatggtatggcagttgggatggcgccgcttgggctgatggctacattgatgtcattccgaagcttcgcgatgccggcttaacacacaccttaatggttgatgcagcaggatgggggcaatatccgcaatctattcatgattacggacaagatgtgtttaatgcagatccgttaaaaaatacgatattctccatccatatgtatgagtatgctggtggtgatgctaacactgttagatcaaatattgatagagtcatagatcaagaccttgctctcgtaataggtgagttcggtcatagacacactgatggcgatgttgatgaagatacaatccttagttattctgaagaaactggcacaggatggctcgcttggtcttggaaaggcaacagtgccgaatgggattatttagacctttcagaagattgggctggtaaccatttaactgattggggaaataggattgtccacggggcaaatggcttgcaggaaacctccaaaccatccaccgtatttacagatgataacggtggtgcccctgaaccgccaactactactaccttgtatgactttgaaggaagcacacaagggtggcatggaagcaacgtgatgggtggcccttggtccgtaacagaatggggtgcgtcaggcaactactctttaaagggcgatgtcaatttaagctcaaattcttcacatgaactgtatagtgaacaaagtcgtaatctacacggatactctcagctaaatgcaaccgttcgccatgccaattggggaaatcccggtaatggcatgaatgcaagactttacgtgaaaacgggctctgattatacatggtatagcggtccttttacacgtatcaatagctccaactcaggtacaacgttatcttttgatttaaacaacatcgaaaatagtcatcatgttagggaaataggtgtgcaattttcagctgcagataatagcagcggtcaaactgctctatacgttgataatgttactttaaga（SEQ IDNO:1）
According to the present invention, described recombinant bacterial strain can be the intestinal bacteria for building genetic engineering bacterium of various routine, and preferably, the starting strain of described recombinant bacterial strain is intestinal bacteria BW25113(and pectinose synthesis defect bacterial strain, can pass through commercially available).
According to the present invention, preferably, described recombinant bacterial strain contains expression vector, and described expression vector for inserting the gene of base sequence as shown in SEQ ID NO:1 and the expression vector obtained between the NcoI restriction enzyme site and XhoI restriction enzyme site of pBAD carrier (as pBAD-HisB carrier).That is, the gene of encodes alkaline 'beta '-mannase is present on expression vector, can self-replicating and expression.Promotor in described expression vector is preferably arabinose inducible promoter.
The method preparing alkaline ' beta '-mannase provided by the invention comprises above-mentioned recombinant bacterial strain to be seeded in liquid fermentation medium ferments, and obtains the fermented liquid containing alkaline ' beta '-mannase.
According to the present invention, usual manner can be adopted to ferment, under preferable case, the mode of described fermentation is: at 35-38 DEG C, described recombinant bacterial strain is cultured to the OD of fermented liquid 600value reaches 45-55, then, at 28-32 DEG C, in fermented liquid, adds pectinose, continues the preferred 10-30h of fermentation 8-35h().In fermenting process (comprise and continue fermentation), can control air flow is 1.5-2.5vvm.Wherein, OD 600value refers to the light absorption value of fermented liquid at 600nm wavelength place, can react the concentration of bacterial strain in fermented liquid (namely bacterium is dense).
Wherein, described liquid fermentation medium can be LB liquid medium, and under preferable case, the formula of described liquid fermentation medium is: the KH of 8-10g/L 2pO 4, (the NH of 3-5g/L 4) 2hPO 4, the yeast extract of 4-6g/L.The pH value of liquid fermentation medium can be 6.6-6.7.
In the present invention, at the OD of fermented liquid 600before value reaches 45-55, if the total glucose of fermented liquid exhausts, suitably can add glucose by stream, to impel the OD of fermented liquid 600value reaches 45-55.To the special requirement of the fed-batch mode of glucose, such as, the glucose of 0.6-1.2g/L fermented liquid can be added by per minute stream.
According to the present invention, in order to the growth maintaining recombinant bacterial strain better more preferably expresses alkaline ' beta '-mannase to make it, preferably, in continuation fermenting process, the dissolved oxygen amount controlled in fermentation system is 30-50%.Dissolved oxygen amount can be controlled by regulating air flow or stirring velocity.
In the present invention, to the not special requirement of the addition of described pectinose, under preferable case, the addition of described pectinose is 1.5-2.5g/L fermented liquid.After interpolation pectinose, can add glucose with limiting to maintain the growth of bacterial strain, such as per minute adds the glucose of 0.1-0.3g/L fermented liquid.
In the present invention, before fermentation, seed culture can also be carried out to recombinant bacterial strain, the mode of seed culture is had no particular limits, such as, recombinant bacterial strain can be seeded in LB substratum, at 36-38 DEG C, cultivate 12-16h, thus obtain OD 600value is the seed liquor of 1.5-2.
Below will be described the present invention by embodiment.In following examples, dissolved oxygen amount adopts dissolved oxygen amount electrode (Mettler) to measure; Alkaliphilic bacillus N16-5 STb gene adopts DNA of bacteria to extract test kit (OMEGA-D3350) extraction and obtains; OD 600value adopts 722N visible spectrophotometer to record; The content of glucose adopts HPLC method to record.
Embodiment 1
The present embodiment is used for illustrating the preparation of recombinant bacterial strain of the present invention.
(1) clone of alkaline ' beta '-mannase gene
Primer 1(upstream): 5 '-ACCATGGTTCAGGCTTTTATG-3 ' (SEQ ID NO:2)
Primer 2 (downstream): 5 '-CGAGCTCTTAACGCAGCGTAACGTT-3 ' (SEQ ID NO:3).
With Alkaliphilic bacillus N16-5(preserving number for CGMCC NO.0369, announce in CN1266096A) STb gene is template, add primer 1, primer 2, HiFi Taq archaeal dna polymerase and dNTP mixture, carry out touchdown PCR (touchdown PCR), reaction conditions is as follows: 94 DEG C of 5min; 94 DEG C of 30s, 60-50 DEG C of 30s, 72 DEG C of 90s, each cycle down 1 DEG C, totally 10 circulations; 94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 90s, totally 25 circulations.
Pcr amplification obtains the fragment of 1400bp, called after manA, carries out purifying with Omega purification kit (model is D6493).
(2) structure of alkaline ' beta '-mannase expression vector and recombinant bacterial strain
PBAD-HisB carrier (purchased from Invitrogen company) is used NcoI/XhoI double digestion, obtains small segment, small segment is connected with the manA that NcoI/XhoI digested with same, namely obtains the expression vector pBAD-manA based on pBAD-HisB.Entrusted to by expression vector pBAD-manA Beijing Qing Kexin industry Bioisystech Co., Ltd to check order, sequencing result shows that the fragment that pcr amplification obtains has the base sequence shown in SEQ ID NO:1.
With the electroporated intestinal bacteria BW25113(of expression vector pBAD-manA purchased from CGSC, CGSC#:7636) coat on the LB flat board containing 50 μ g/mL penbritins after, cultivate 15h, obtain the recombinant bacterial strain BW25113-pBAD-manA of the expression vector containing manA for 37 DEG C.
Embodiment 2
The present embodiment is used for illustrating the method utilizing recombinant bacterial strain high level expression alkaline ' beta '-mannase of the present invention.
Seed culture: be inoculated in by recombinant bacterial strain BW25113-pBAD-manA in 25 milliliters of LB substratum, cultivate 15h at 37 DEG C, obtains OD 600value is the seed liquor of 2.0.
Fermentation: in fermentor tank, substratum press 50%(v/v) liquid amount (substratum composition: the KH of 9g/L 2pO 4, (the NH of 4g/L 4) 2hPO 4, the yeast extract of 5g/L, 121 DEG C of sterilizings, first carry out the demarcation of pH value, dissolved oxygen amount electrode before sterilizing, then sterilizing 30 minutes, is cooled to 37 DEG C), 210rpm(air flow 2vvm), with 50%(v/v) ammoniacal liquor adjust pH to 6.7.Inoculum size is 2%(v/v), before inoculation, regulate dissolved oxygen amount to 100%.When thalline starts growth, oxygen-consumption increases, and causes dissolved oxygen amount to reduce, and regulates mixing speed, to maintain dissolved oxygen amount more than 30%.
When glucose exhausts (dissolved oxygen amount rises rapidly), start stream and add glucose, the stream dosage of glucose is per minute 1.0g/L fermented liquid.
Work as OD 600value reaches 50(and to have fermented 24h) time, stop stream adding glucose, after temperature is down to 30 DEG C, add pectinose (addition is 2g/L fermented liquid).Add glucose (per minute 0.3g/L fermented liquid) to maintain the growth of bacterial strain with limit, adjustment air flow or stirring velocity make the dissolved oxygen amount of whole process control at 30-50%.Continue fermentation 11h, enzyme content can reach 4000U/ml, and continue fermentation 30h, enzyme content can reach 6000U/ml, the enzyme content in fermented liquid with the change of fermentation time see Fig. 1.As can be seen from Figure 1, when adopting method of the present invention to prepare alkaline ' beta '-mannase, the enzyme content in fermented liquid is higher, and particularly when having fermented 55 hours, the enzyme content in fermented liquid can up to 6500U/ml.
Embodiment 3
The present embodiment is used for illustrating the method utilizing recombinant bacterial strain high level expression alkaline ' beta '-mannase of the present invention.
Seed culture: be inoculated in by recombinant bacterial strain BW25113-pBAD-manA in 25 milliliters of LB substratum, cultivate 15h at 37 DEG C, obtains OD 600value is the seed liquor of 2.0.
Fermentation: in fermentor tank, substratum press 50%(v/v) liquid amount (substratum composition: the KH of 9g/L 2pO 4, (the NH of 4g/L 4) 2hPO 4, the yeast extract of 5g/L, 121 DEG C of sterilizings, first carry out the demarcation of pH value, dissolved oxygen amount electrode before sterilizing, then sterilizing 30 minutes, is cooled to 36 DEG C), 210rpm(air flow 2vvm), with the ammoniacal liquor adjust pH to 6.7 of 50 % by weight.Inoculum size is 2%(v/v), before inoculation, regulate dissolved oxygen amount to 100%.When thalline starts growth, oxygen-consumption increases, and causes dissolved oxygen amount to reduce, and regulates mixing speed, to maintain dissolved oxygen amount more than 30%.
When glucose exhausts (dissolved oxygen amount rises rapidly), start stream and add glucose, the stream dosage of glucose is per minute 0.6g/L fermented liquid.
Work as OD 600value reaches 45(and to have fermented 20h) time, stop stream adding glucose, after temperature is down to 28 DEG C, add pectinose (addition is 2.0g/L fermented liquid).Add glucose (per minute 0.3g/L fermented liquid) to maintain the growth of bacterial strain with limit, adjustment air flow or stirring velocity make the dissolved oxygen amount of whole process control at 30-50%.Continue fermentation 15h, enzyme content can reach 4015U/ml.
Embodiment 4
The present embodiment is used for illustrating the method utilizing recombinant bacterial strain high level expression alkaline ' beta '-mannase of the present invention.
Seed culture: be inoculated in by recombinant bacterial strain BW25113-pBAD-manA in 25 milliliters of LB substratum, cultivate 15h at 37 DEG C, obtains OD 600value is the seed liquor of 2.0.
Fermentation: in fermentor tank, substratum press 50%(v/v) liquid amount (substratum composition: the KH of 9g/L 2pO 4, (the NH of 4g/L 4) 2hPO 4, the yeast extract of 5g/L, 121 DEG C of sterilizings, first carry out the demarcation of pH value, dissolved oxygen amount electrode before sterilizing, then sterilizing 30 minutes, is cooled to 38 DEG C), 210rpm(air flow 2vvm), with the ammoniacal liquor adjust pH to 6.7 of 50 % by weight.Inoculum size is 2%(v/v), before inoculation, regulate dissolved oxygen amount to 100%.When thalline starts growth, oxygen-consumption increases, and causes dissolved oxygen amount to reduce, and regulates mixing speed, to maintain dissolved oxygen amount more than 30%.
When glucose exhausts (dissolved oxygen amount rises rapidly), start stream and add glucose, the stream dosage of glucose is per minute 1.2g/L fermented liquid.
Work as OD 600value reaches 55(and to have fermented 22h) time, stop stream adding glucose, after temperature is down to 32 DEG C, add pectinose (addition is 2.0g/L fermented liquid).Add glucose (per minute 0.3g/L fermented liquid) to maintain the growth of bacterial strain with limit, adjustment air flow or stirring velocity make the dissolved oxygen amount of whole process control at 30-50%.Continue fermentation 14h, enzyme content can reach 4280U/ml.
As can be seen from the above embodiments, recombinant bacterial strain of the present invention can express alkaline ' beta '-mannase in higher levels, and required fermentation time is shorter.
Below the preferred embodiment of the present invention is described in detail by reference to the accompanying drawings; but; the present invention is not limited to the detail in above-mentioned embodiment; within the scope of technical conceive of the present invention; can carry out multiple simple variant to technical scheme of the present invention, these simple variant all belong to protection scope of the present invention.
It should be noted that in addition, each concrete technical characteristic described in above-mentioned embodiment, in reconcilable situation, can be combined by any suitable mode, in order to avoid unnecessary repetition, the present invention illustrates no longer separately to various possible array mode.
In addition, also can carry out arbitrary combination between various different embodiment of the present invention, as long as it is without prejudice to thought of the present invention, it should be considered as content disclosed in this invention equally.

Claims (8)

1. a recombinant bacterial strain, is characterized in that, this recombinant bacterial strain is the recombination bacillus coli of the gene containing encodes alkaline 'beta '-mannase, and the base sequence of described gene is as shown in SEQ ID NO:1.
2. recombinant bacterial strain according to claim 1, wherein, the starting strain of described recombinant bacterial strain is intestinal bacteria BW25113.
3. recombinant bacterial strain according to claim 1 and 2, wherein, described recombinant bacterial strain contains expression vector, and described expression vector for inserting the gene of base sequence as shown in SEQ ID NO:1 and the expression vector obtained between the NcoI restriction enzyme site and XhoI restriction enzyme site of pBAD carrier.
4. recombinant bacterial strain according to claim 3, wherein, the promotor in described expression vector is arabinose inducible promoter.
5. prepare a method for alkaline ' beta '-mannase, it is characterized in that, the method comprises the recombinant bacterial strain in claim 1-4 described in any one to be seeded in liquid fermentation medium ferments, and obtains the fermented liquid containing alkaline ' beta '-mannase.
6. method according to claim 5, wherein, the mode of described fermentation is: at 35-38 DEG C, described recombinant bacterial strain is cultured to the OD of fermented liquid 600value reaches 45-55, then, at 28-32 DEG C, in fermented liquid, adds pectinose, continues fermentation 8-35h.
7. method according to claim 6, wherein, in continuation fermenting process, the dissolved oxygen amount controlled in fermentation system is 30-50%.
8. method according to claim 6, wherein, the addition of described pectinose is 1.5-2.5g/L fermented liquid.
CN201410008696.2A 2014-01-08 2014-01-08 Recombinant strain and method for preparing alkaline beta-mannanase Pending CN104762243A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410008696.2A CN104762243A (en) 2014-01-08 2014-01-08 Recombinant strain and method for preparing alkaline beta-mannanase

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410008696.2A CN104762243A (en) 2014-01-08 2014-01-08 Recombinant strain and method for preparing alkaline beta-mannanase

Publications (1)

Publication Number Publication Date
CN104762243A true CN104762243A (en) 2015-07-08

Family

ID=53644338

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410008696.2A Pending CN104762243A (en) 2014-01-08 2014-01-08 Recombinant strain and method for preparing alkaline beta-mannanase

Country Status (1)

Country Link
CN (1) CN104762243A (en)

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1351169A (en) * 2000-10-26 2002-05-29 中国科学院微生物研究所 Gene sequence of beta-mannase and process for preparing recombinant enzyme coded by it
CN101089185A (en) * 2006-06-16 2007-12-19 罗科 Beta-mannosan enzyme gene and production method of its recombination enzyme
CN101392241A (en) * 2007-09-18 2009-03-25 中国科学院微生物研究所 Beta-mannanase, gene, preparation method, vector and host cell
KR20110051132A (en) * 2009-11-09 2011-05-17 주식회사한국야쿠르트 Novel gene encoding multifunctional glycosyl hydrolase from cow rumen metagenome
CN102433267A (en) * 2010-09-29 2012-05-02 中国科学院微生物研究所 Method for preparing beta-mannase and special strain
CN102732494A (en) * 2011-04-11 2012-10-17 中国农业大学 Beta-mannanase and preparation method thereof

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1351169A (en) * 2000-10-26 2002-05-29 中国科学院微生物研究所 Gene sequence of beta-mannase and process for preparing recombinant enzyme coded by it
CN101089185A (en) * 2006-06-16 2007-12-19 罗科 Beta-mannosan enzyme gene and production method of its recombination enzyme
CN101392241A (en) * 2007-09-18 2009-03-25 中国科学院微生物研究所 Beta-mannanase, gene, preparation method, vector and host cell
KR20110051132A (en) * 2009-11-09 2011-05-17 주식회사한국야쿠르트 Novel gene encoding multifunctional glycosyl hydrolase from cow rumen metagenome
CN102433267A (en) * 2010-09-29 2012-05-02 中国科学院微生物研究所 Method for preparing beta-mannase and special strain
CN102732494A (en) * 2011-04-11 2012-10-17 中国农业大学 Beta-mannanase and preparation method thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Y. MA等: "登录号：AY534912.1", 《GENBANK》 *

Similar Documents

Publication Publication Date Title
US10428362B2 (en) Enzymatic hydrolysis of disaccharides and oligosaccharides using alpha-glucosidase enzymes
AU2015223027B2 (en) Enzymatic hydrolysis of disaccharides and oligosaccharides using alpha-glucosidase enzymes
Liu et al. Molecular characterization and expression of microbial inulinase genes
CN107142225B (en) A kind of pichia yeast recombinant bacterium of the source overexpression Streptomyces sp.FA1 zytase
CN103571812B (en) Pullulanase mutant with improved secretion efficiency and heat stability and preparation method of pullulanase mutant
CN105722989A (en) Trehalase in fermentations
CN105255925A (en) Efficient preparation method and gene engineering bacteria of sucrose isomerase
JP4998991B2 (en) Method for producing cellulase
CN112795569B (en) Novel constitutive promoter, recombinant bacillus licheniformis and application thereof
CN106754610A (en) The recombination engineering of surface display expression glutamate decarboxylase and its construction method and application
CN104911160B (en) A kind of neutral phytase mutant and its application
CN105039371A (en) Trehalose synthase-trehalose hydrolase fusion enzyme, expression gene thereof and application
CN105316306A (en) Fermentation method for efficiently producing keratinase through recombinant escherichia coli
CN113106112A (en) Genetically engineered bacterium for heterologous expression of xanthan gum endonuclease and application thereof
CN111041013B (en) Algin lyase or pectinase and application thereof in cooperative degradation of brown algae
CN102851266B (en) Heat-resistant alpha-amylase and construction method of gene engineering bacteria thereof
CN103031290B (en) High-sugar-tolerant beta-glucosaccharase Bg14, and expressed gene and application thereof
CN110331122B (en) Escherichia coli for secretory expression of alginate lyase and application thereof
CN108410903B (en) The endo-xylanase and its encoding gene of a kind of resistance to low ph value and application
CN103695383B (en) Aspergillus niger strain for efficiently expressing alpha-transglucosidase
CN104762243A (en) Recombinant strain and method for preparing alkaline beta-mannanase
CN105112348B (en) A kind of recombination bacillus pumilus of high yield Pullulanase and its application
CN103014097A (en) Maltotriose preparation method with starch as raw material and special fungal alpha-amylase thereof
CN107916268B (en) Polygalacturonate lyase gene, recombinant expression vector, strain, polygalacturonate lyase and preparation method thereof
CN102168059A (en) Method for efficiently preparing beta-glucanase

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
EXSB Decision made by sipo to initiate substantive examination
SE01 Entry into force of request for substantive examination
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20150708

WD01 Invention patent application deemed withdrawn after publication