CN102409095A - Congenital nystagmus gene detection kit - Google Patents

Abstract

The present invention discloses a congenital nystagmus gene detection kit. The PCR amplification primer pair of the kit consists of primer 1 and primer 2, wherein primer 1 is shown in SEQ ID NO: 1, and primer 2 is shown in SEQ ID NO: 2. The present invention overcomes the clinical manifestations and genetic heterogeneity of congenital idiopathic nystagmus, and uses the c.163-1G>T site to provide a kit that can quickly detect congenital nystagmus disease, which brings significant convenience to the genetic diagnosis of congenital nystagmus. It makes great contributions to preventing the next generation from getting sick and improving the quality of the whole population, and has a more far-reaching significance for social development.

Description

Congenital Nystagmus Gene Detection Kit

technical field

The invention relates to a reagent kit, in particular to a congenital nystagmus gene detection reagent kit, which belongs to the field of medical molecular biology.

Background technique

Congenital idiopathic nystagmus (CIN) is an involuntary, rhythmic nystagmus that is discovered early after birth, with an incidence of about 1/1000 to 1/1500. Because nystagmus seriously impairs visual function, the eyes constantly vibrate or accompanied by compensatory head position and head swing, which affects the appearance, causing great troubles to the lives of patients. For the treatment of congenital nystagmus, there is currently no curative method in China. Because most of the congenital nystagmus is accompanied by other eye diseases, which seriously affect vision, the associated eye diseases can only be solved by surgery.

At present, there is no unified standard and detection method for the detection of congenital nystagmus at home and abroad. Due to the failure of early detection, the patient will eventually become blind, which seriously affects the quality of life of the patient, and also brings a great burden to the family and society, and also affects the quality of the entire social population.

The kit of the present invention can diagnose congenital nystagmus (including during pregnancy) early, and guide doctors to make correct and timely judgments and give corresponding treatment, and can selectively terminate the diseased fetus according to the test results under the principle of informed consent. Pregnancy, but also help CIN family members to give birth to healthy offspring.

Contents of the invention

The technical problem to be solved by the present invention is to provide a kit capable of rapidly detecting congenital nystagmus.

The present invention overcomes the clinical manifestations and genetic heterogeneity of congenital essential nystagmus, and provides a rapid detection of congenital nystagmus disease by using the c.163-1G>T site, which is congenital nystagmus The work of genetic diagnosis has brought remarkable convenience. It has a far-reaching significance for social development to make a great contribution to preventing the next generation of morbidity and improving the quality of the whole society.

The technical problem to be solved by the present invention is achieved by the following technical means:

Combining with the clinical phenotype analysis of simple horizontal nystagmus in this research family, the present invention discloses a new susceptibility gene locus closely related to congenital essential nystagmus, namely a cut position c.163-1G >T changes, those carrying T bases are susceptible to congenital idiopathic nystagmus (as shown in Figure 5). This disease-causing locus is the first report in the world. It is determined that the splicing mutation of c.163-1G>T site leads to the onset of nystagmus in the family. The present invention utilizes this locus to design a nystagmus disease Detection kits.

A congenital nystagmus gene detection kit of the present invention, the kit includes: 10μM dNTPs, 10×PCR reaction buffer, DNA polymerase, PCR amplification primer pair and double distilled water, is characterized in that: the described The PCR amplification primer pair is composed of primer 1 and primer 2, wherein primer 1 is shown in SEQ ID NO: 1, and primer 2 is shown in SEQ ID NO: 2.

In a specific embodiment of the present invention, the PCR amplification reaction conditions are preferably as follows:

Reaction system: sample template 150ng, 10×PCR reaction buffer 5μl, 10μM dNTPs 0.5μl, 5U/μl DNA polymerase 0.5μl, 10pmol primer 12μl, 10pmol primer 22μl, make up to 40μl with double distilled water;

PCR amplification conditions: Denaturation at 95°C for 5 minutes, followed by the main cycle of denaturation at 94°C for 30s, 30s at 60°C, and extension at 72°C for 30s, a total of 30 cycles, then extension at 72°C for 10 minutes, and storage at 4°C.

Preferably, the DNA polymerase is Taq PlusI DNAase.

Various components in the PCR detection kit of the present invention can be purchased from commercial sources, and the primers used can be synthesized by an automatic DNA synthesizer.

The application method of a kind of congenital nystagmus gene detection kit of the present invention is as follows:

(1) Extract the DNA template of the sample to be tested according to conventional methods;

(2) Carry out PCR amplification reaction;

(3) Analyzing the PCR amplification product through 1% agarose electrophoresis;

(4) Perform sequencing analysis on the obtained PCR amplification products, and the sequencing map analysis software combines the NCBI gene bank sequence to analyze the mutation position, and compares the sequencing peak map with the sequencing peak map of the normal control (shown in Figure 4) and combines the sequencing peak map of the patient (shown in Fig. 2, Fig. 3) make the judgment whether is the patient of congenital nystagmus.

The c.163-1G>T of the present invention can be used for accurate prenatal diagnosis of CIN high-risk fetuses, and the mutation can be used as a potential candidate target for rapid detection of congenital nystagmus. Selective termination of pregnancy for sick fetuses under the principle of informed consent is a feasible way to help family members with CIN to give birth to healthy offspring.

Description of drawings

Figure 1 is the genetic family map of the nystagmus family;

Figure 2 is the sequencing profile of female patients in the family;

Figure 3 is the sequencing profile of male patients in the family;

Fig. 4 is the sequencing profile of normal controls in the crowd;

Figure 5 shows two different coding changes in the gene sequence caused by abnormal splicing before and after the mutation.

Detailed ways

The present invention is further described by the following examples. It should be understood that these examples are only for the purpose of illustration, and in no way limit the scope of the present invention.

Example 1. Preparation and assembly of a congenital nystagmus gene detection kit of the present invention

1. Design and synthesis of primer pairs

Primer 1 (FRMD7F): 5'cgtgctgcagtatcaggttag 3' (SEQ ID NO: 1)

Primer 2 (FRMD7R): 5' ccctacatacctagctgcaaac 3' (SEQ ID NO: 2)

It was synthesized by an automatic DNA synthesizer and diluted to 10 μmol/L.

2. Assembly of kit

10×PCR buffer, dNTPs, and Taq PlusI DNAase were purchased from Treasure Bioengineering (Dalian) Co., Ltd.

Example 2 Clinical application test of the congenital nystagmus gene detection kit of the present invention

(1) Test specimens and experimental materials:

Experimental materials: STE and proteinase K were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.

After obtaining the informed consent of the subjects, 5ml of peripheral blood was collected from the subjects. There were two subjects, one male and one female from the same family lineage. The genetic family map of the nystagmus family is shown in Figure 1.

(2) Detection method:

1. Extract DNA:

1.1 Add 1ml of cell lysate to 500μl of anticoagulated blood, mix well, and centrifuge at 3000rpm for 5min;

1.2 Repeat the above steps until all the red blood cells are broken; take the cell pellet for later use.

1.3 Add 300ul of STE and 20ul of 20% SDS to the precipitate, mix well, shake, add 15ul of proteinase K (10mg/rrd), and place in a water bath at 50°C for 12-16 hours overnight;

1.4 Take out the sample from the water bath, add 100ul saturated NaCl (6mol/L), oscillate, a white precipitate can be seen, centrifuge at 5000rpm for 5min;

1.5 Move the supernatant to another clean centrifuge tube, add an equal volume of phenol/chloroform/isoamyl alcohol mixture (phenol, chloroform, isoamyl alcohol volume ratio = 25:24:1), shake, 5000rpm Centrifuge for 8 minutes; take the supernatant, add 3 times the volume of cold absolute ethanol, and gently invert and shake;

1.6 Centrifuge the centrifuge tube at 8000rpm for 10min, pour out the cold ethanol, put the centrifuge tube upside down on the filter paper, and use a centrifugal concentrator to remove water;

1.7 Add 200ul ultrapure water and store at 4°C; if not in use for a short time, aliquot the DNA and freeze it at 20°C;

1.8 Take the extracted genome, and measure the content by ultraviolet spectrophotometer. (In addition, take the dissolved genome and load it on a 1.0% agarose gel for electrophoresis)

2. PCR amplification:

The coding region of the FRMD7 gene was amplified by PCR with primer 1 (shown in SEQ ID NO: 1) and primer 2 (shown in SEQ ID NO: 2).

The PCR reaction system is as follows:

Add the above reactants in sequence, mix well and centrifuge slightly, and perform PCR on a gene amplification instrument. The PCR conditions were denaturation at 95°C for 5 minutes, and then entered the main cycle of 94°C for 30s, 6030s, and 72°C for 30s, a total of 30 cycles; after the cycle was completed, it was extended at 72°C for 10 minutes. The resulting PCR amplification products were sequenced and analyzed, and the sequence map analysis software combined with NCBI gene bank sequence analysis to check the mutation position.

(3) Test results:

Utilize the detection result of the congenital nystagmus gene detection kit of the present invention. The test results are shown in Figure 2 and Figure 3 , and the sequencing profile of normal controls in the population is shown in Figure 4 . From the comparison of the sequencing peaks, both subjects had mutations at the c.163-1G>T site, so they could be confirmed as patients with congenital nystagmus.

The above description is only illustrative of the invention, rather than restrictive. Those of ordinary skill in the art understand that many modifications, changes or equivalents can be made without departing from the spirit and scope defined in the claims, but All will fall within the protection scope of the present invention.

sequence listing

<110> Harbin Medical University

<120> Congenital Nystagmus Gene Detection Kit

<130>KLPI110931

<170>PatentIn 3.5

<210>1

<211>21bp

<212>DNA

<213>primer 1

<400> SEQ ID NO: 1

cgtgctgcagtatcaggttag

<210>2

<211>22bp

<212>DNA

<213>primer 2

<400> SEQ ID NO: 2

ccctacatacctagctgcaaac

Claims (3)

1. a congenital nystagmus gene detection kit, the kit comprises: 10 μ M dNTPs, 10 × PCR reaction buffer, DNA polymerase, PCR amplification primer pair and double distilled water, it is characterized in that: described PCR The amplification primer pair is composed of primer 1 and primer 2, wherein primer 1 is shown in SEQ ID NO: 1, and primer 2 is shown in SEQ ID NO: 2. 2. according to the described test kit of claim 1, it is characterized in that: PCR amplification reaction condition is as follows: Reaction system: sample template 150ng, 10×PCR reaction buffer 5μl, 10μM dNTPs 0.5μl, 5U/μl DNA polymerase 0.5μl, 10pmol primer 12μl, 10pmol primer 22μl, make up to 40μl with double distilled water; PCR amplification conditions: PCR amplification conditions: Denaturation at 95°C for 5min, then enter the main cycle of denaturation at 94°C for 30s, 30s at 60°C, and extension at 72°C for 30s, a total of 30 cycles, then extend at 72°C for 10min, and store at 4°C. 3. according to the described test kit of claim 1 or 2, it is characterized in that described DNA polymerase is TaqPlusI DNAase.

Images