CN102409090A - Nucleic acid detection probe, primers and kit for inhibitor of apoptosis protein Survivin gene, and detection method thereof - Google Patents

Abstract

The invention discloses a nucleic acid detection probe, primers and a kit for an inhibitor of apoptosis protein Survivin gene, and a detection method thereof. The kit comprises: a reverse transcription reaction solution composed of Oligod (T)18Primers, a 5*AMV Buffer, a dNTP Mixture, and an AMV enzyme; an FQ-PCR (fluorescence quantitative-polymerase chain reaction) reaction solution composed of DEPC treatment water, a dNTP Mixture, a Taq enzyme, a 10*PCR Buffer, a Mg<2+> ion-containing solution, a Survivin gene forward primer, a Survivin gene reverse primer, and a Survivin gene probe, etc. The method of the invention conducts quantitative detection to the mRNA (messenger RNA) expression level of Survivin with a two-step reverse transcription real-time fluorescence quantitative PCR technology. And the method in the invention has the advantages of specificity, sensitivity, rapidity, as well as simple and convenient operation.

Description

Apoptosis Inhibitor Protein Survivin gene nucleic acid detection probes, primer, test kit and detection method thereof

Technical field

The present invention relates to technical field of biological, mainly is a kind of Apoptosis Inhibitor Protein Survivin gene nucleic acid detection probes, primer, test kit and detection method thereof.

Background technology

Tumour is a kind of common disease, frequently-occurring disease, is the disease that human health in serious threat.Though the oncotherapy of China has obtained remarkable progress; But development is also uneven; Overall treatment level is also very low; China's cancer curative ratio (5 years survival rates) is still paced up and down about 20%-30% at present, and external developed country cancer curative ratio has reached 50%-60%, and this is mainly relevant with early stage diagnosis rate height.It is thus clear that there be big gap in China with comparing also abroad aspect early diagnosis of tumor.The Survivin gene is (the Inhibitor of Apoptosis Family of Protein of IAP family; IAPs) the unique newcomer of structure in; Be the minimum member of relative molecular weight in the IAP family, but also be to find the strongest survivin so far.(Effector Cell Protease Receptor-1, EPR-1) cDNA at first separated in human genome storehouse's screening by hybridization this gene with effector cell's proteolytic enzyme acceptor 1 by Altieri of Yale University etc. in 1997.This assignment of genes gene mapping is in human chromosome 17q25, and total length 147kb is made up of 4 exons and 3 introns, 142 amino acid of encoding, and the albumen relative molecular weight is approximately 16.5kD.According to bibliographical information, Survivin gene wide expression is expressed or is not expressed but normal adult tissue is low in people's embryonic tissue and various tumor tissues.So the Survivin gene test is the important indicator of conduct and the early screening (comprising precancerous lesion) of tumour, and be expected to become a kind of diagnosing tumor mark of wide spectrum.In addition, the incidence and development of Survivin gene participation tumour, closely related with prognosis, this expression of gene can be used as the recurrence and the prognostic indicator of most tumors in the detection tumor specimen.

The method for quick of Survivin is following in the prior art:

1, immunological technique

Immunological detection method mainly is to detect the albumen that produces in the Survivin genetic expression process.Conventional immunological detection mainly is immunofluorescence technique (IFA), enzyme immunoassay (EIA) etc.Immunofluorescence technique is claimed fluorescent-antibody technique again, is the earliest a kind of of development in the immuno-labelling technique.Immunofluorescence technique is the principle according to antigen antibody reaction, earlier with resorcinolphthalein on known antigen or the antibody labeling, processes fluorescence antibody, uses this fluorescence antibody (or antigen) as probe in detecting tissue or intracellular corresponding antigens (or antibody) again.But this method unspecific staining problem solves as yet fully, and the objectivity that the result judges is not enough, and technical program also more complicated.The most frequently used method of enzyme immunoassay is EUSA (ELISA); Be that specific antigens or antibody are adsorbed on the solid phase carrier; It is combined with corresponding antibodies or antigen in the testing sample; The antigen or the antibody that add enzyme labelling then add the substrate colour developing again, calculate the content of determined antigen or antibody at last according to the color and luster depth.The ELISA high specificity, but if adopting single antigen to set up the ELISA method detects, loss is high, false positive possibly occur.In addition, when some nonspecific reactions occurring, often be difficult for explaining.

2, molecular biology method

1. nucleic probe method

DNA or the RNA fragment that has affinity tag be nucleic probe can with complementary nucleotide sequence specific combination.The mark of nucleic probe can be used nucleic P32, S35, I131 etc., and non-radioactive substance such as vitamin H, digoxin etc.The principal feature of nucleic probe method is that susceptibility, specificity are all stronger.

2. regular-PCR method

The PCR method is through two sections specificity oligonucleotide primers, and through archaeal dna polymerase catalysis, whether the section between amplification and the two primer complementary dna sequence dnas has this sequence in the test sample external.PCR is more responsive than serological method; But specificity and repeatability are lower; If methods such as nucleic acid hybridization such as nexus dot blot, micropore plate hybridization, filter membrane nucleic acid probe hybridization and enzyme linked immunological are analyzed the PCR product, sensitivity and specificity all can improve greatly.

Development along with modern nucleic acid technology; Be based upon the nucleic acid amplification technologies on the gene level---PCR and correlation technique; Because its hypersensitivity and high specific can be used widely in the clinical detection of Survivin gene, become the main method of laboratory diagnosis.These are the detection method on basis with PCR; All need spended time that pcr amplification product is carried out aftertreatment; The target dna molecule of pcr amplification product middle and high concentration can pollute whole lab space with aerocolloidal form; Because the high sensitivity of PCR, even can detect the template concentrations of 10 copies in the reaction system, thereby bring serious false positive possibly for PCR experiment from now on; Conventional PCR method is the end point determination method, because the PCR reaction has plateau, can't carry out accurate quantification to starting template according to end product and detect.

Summary of the invention

The object of the invention will overcome the deficiency of above-mentioned technology just; And a kind of Apoptosis Inhibitor Protein Survivin gene nucleic acid detection probes, primer, test kit and detection method thereof are provided; Overcome pcr amplification product end point determination existing " platform effect " to the quantitative influence of product; Specificity, sensitivity and accuracy with height, and the Survivin gene nucleic acid detection kit that technological operation is easy, level of automation is high.

The present invention solves the technical scheme that its technical problem adopts: this Apoptosis Inhibitor Protein Survivin gene nucleic acid detects primer, comprises following sequence set:

Comprise following forward primer, one group of sequence of reverse primer:

Forward primer is shown in SEQ ID NO.1 in the sequence table: 5 '-TGTGATTAGACAGGCCCAGTGA-3 ',

Reverse primer is shown in SEQ ID NO.2 in the sequence table: 5 '-CACAGCATCGAGCCAAGTCA-3 ',

One group of sequence of perhaps holding the nucleotide fragments that prolongation is arranged at the 5 ' end and/or 3 ' of above-mentioned sequence;

Perhaps with the homology of above-mentioned sequence greater than one group of sequence of 85%;

Perhaps with one group of sequence of the base complementrity of above-mentioned sequence.

The probe that this Apoptosis Inhibitor Protein Survivin gene nucleic acid of the present invention detects is following sequence:

Fluorescent probe is shown in SEQ ID NO.3 in the sequence table: 5 '-CACATGCTGGCCGCT-3 ';

One group of sequence of perhaps holding the nucleotide fragments that prolongation is arranged at the 5 ' end and/or 3 ' of above-mentioned sequence;

Perhaps with the homology of above-mentioned sequence greater than one group of sequence of 85%;

Perhaps with one group of sequence of the base complementrity of above-mentioned sequence;

Wherein, 5 ' of said fluorescent probe end and 3 ' end are modified with FAM, MGB fluorophor respectively.

As preferably, wherein 5 ' of the fluorescent probe terminal modified optical dye is selected from: FAM, HEX, TET, JOE, VIC, ROX, Cy3 or Cy5; 3 ' the terminal modified optical dye is selected from: TAMRA, Eclipse, BHQ1, BHQ2, BHQ3 or DABCYL.

The test kit that Apoptosis Inhibitor Protein Survivin gene nucleic acid of the present invention detects, this test kit contains:

(1) reverse transcription reaction liquid, the proportioning of each component concentration is: concentration is the Oligo d (T) of 50pmol/ μ l ₁₈Primers consumption 2 μ L, 5 * AMV Buffer consumption, 4 μ L, concentration are the dNTP Mixture consumption 1 μ L of 10mmol/L; Concentration is that the Ribonuclease Inhibitor consumption of 40U/ μ L is 0.5 μ L; Concentration is that the AMV enzyme dosage of 5U/ μ L is 1 μ L; The AMV enzyme is to have the mRNA rt is become cDNA, and continue synthetic cDNA second chain function have an active polysaccharase of rt.

(2) FQ-PCR nucleic acid amplification reaction liquid is comprising DEPC treating water, dNTP Mixture, Taq enzyme, 10 * PCRBuffer, contain Mg ²⁺Ion solution, Survivin gene forward primer, Survivin gene reverse primer, Survivin gene probe; Wherein the Taq enzyme is for having 5 ' → 3 ' circumscribed active archaeal dna polymerase;

Survivin gene forward primer is shown in SEQ ID NO.1 in the sequence table:

5′-TGTGATTAGACAGGCCCAGTGA-3′，

Survivin gene reverse primer is shown in SEQ ID NO.2 in the sequence table:

5′-CACAGCATCGAGCCAAGTCA-3′，

The Survivin gene probe is shown in SEQ ID NO.3 in the sequence table:

5′-CACATGCTGGCCGCT-3′；

Wherein, 5 ' of said fluorescent probe end and 3 ' end are modified with FAM, MGB fluorophor respectively; Probe 5 ' end flag F AM fluorescence report group, 3 ' end mark MGB fluorescent quenching group;

(3) RNA extracting solution, staple are Trizol reagents, comprising phenol, oxine, beta-mercaptoethanol, guanidinium isothiocyanate composition;

(4) Hank ' s liquid; Comprising: NaCl, KCl, NaHCO ₃, Na ₂HPO ₄12H ₂O, KH ₂PO ₄, glucose, phenol red.

(5) negative quality control product is not for containing the aseptic DEPC purified water of Survivin gene;

(6) positive quality control product is 1.0 * 10 ⁶Copy/mL contains the positive plasmid standard substance of Survivin gene;

(7) critical positive quality control product is 1.0 * 10 ⁴Copy/mL contains the positive plasmid standard substance of Survivin gene;

(8) positive quantitatively quality control product, for containing the positive plasmid standard substance of Survivin gene, working concentration is 1.0 * 10 ⁷Copy/ml, 1.0 * 10 ⁶Copy/ml, 1.0 * 10 ⁵Copy/ml and 1.0 * 10 ⁴Copy/ml; Positive plasmid changes intestinal bacteria TOP10 over to and breeds.

As preferably, wherein 5 ' of the fluorescent probe terminal modified optical dye is selected from: FAM, HEX, TET, JOE, VIC, ROX, Cy3 or Cy5; 3 ' the terminal modified optical dye is selected from: TAMRA, Eclipse, BHQ1, BHQ2, BHQ3 or DABCYL.

As preferably, described Hank ' s liquid is made up of plurality of inorganic salt, comprises in wherein every 1000mL Hank ' s liquid:

As preferably, the proportioning of said each component concentration of FQ-PCR nucleic acid amplification reaction liquid is: DEPC treating water consumption 27.5 μ L; Concentration is the warm start Taq enzyme dosage 0.5 μ L of 5U/ μ L; Concentration is the dNTP Mixture consumption 1 μ L of 10mmol/L; 10 * PCR Buffer consumption, 5 μ L; Concentration is the MgCl of 25mmol/L ₂Solution usage 7 μ L; Concentration is the Survivin gene forward primer consumption 1.5 μ L of 10 μ mol/L; Concentration is the Survivin gene reverse primer consumption 1.5 μ L of 10 μ mol/L; Concentration is the Survivin probe consumption 1 μ L of 10 μ mol/L.

The detection method of this Apoptosis Inhibitor Protein Survivin gene nucleic acid of the present invention comprises the following steps:

(1) collected specimens: gather tumour patient fresh whole blood or tumour flesh tissue;

A, tumour fresh whole blood: extract person under inspection 3-5 milliliter with asepsis injector, inject Na ₂In EDTA or the Sodium Citrate anticoagulant tube, fully mixing censorship;

Tumour flesh tissue: get biopsy or operation patients tumor tissues 500mg, be put in the EP pipe of 2ml DEPC water treatment airtight censorship;

B, sample storage and transport:, avoid multigelation and the haemolysis that causes if test immediately of sample should be stored in room temperature; Long-distance the transporting of sample should be adopted 4 ℃ of curling stones;

(2) sample preparation:

A, fresh whole blood: the mixing anticoagulation, get 500 μ l-1000 μ l and go in the clean 2ml centrifuge tube numbering mark; The centrifugal 10min of 4000r/min; Abandon serum, add 600 μ l Hank ' s liquid, mixing is resuspended; Other gets a new 2ml centrifuge tube and adds 800 μ l human lymphocyte parting liquids, with the resuspended liquid of red corpuscle slowly be added in parting liquid upper strata, the centrifugal 20min of 2000r/min; Draw the middle suspended layer of white in another new 1.5ml centrifuge tube with capillary pipet or 1ml disposable syringe; Add 800 μ l Hank ' s liquid; Mixing, the centrifugal 2min of 12000r/min, white precipitate is resuspended with 50 μ l DEPC purified water; Add 150 μ l RNA extracting solutions and fully shake, room temperature is placed 5min;

B, flesh tissue: get the 500mg tumor tissues, add 1ml saline water, fully grind to form tissue homogenate or use liquid nitrogen grinding, get 100 μ l homogenates and add 500 μ l RNA extracting solutions and fully shake room temperature placement 5min;

(3) RNA extracts: add 30 μ l chloroforms, firmly shake 15s-30s, ice bath 10min, 4 ℃ 12, the centrifugal 15min of 000rpm; Carefully water 100 μ l in upper strata are transferred in the clean 0.5ml centrifuge tube, add 100 μ l Virahol mixings, ice bath 15min, the centrifugal 15min of 12000rpm; Abandon supernatant, add the DEPC ethanol of 300 μ l 75%, fully put upside down mixing, 13, the centrifugal 10min of 000rpm, the careful suction removed most of ethanol; With extraction tube uncovered in air at room temperature dry 5-10min treat that ethanol volatilization is clean, with 11 μ l DEPC H ₂The O dissolution precipitation;

(3) rt: in the PCR reaction tubes that 8.5 μ L reverse transcription reaction liquid are housed, add the water-soluble RNA sample of 11 μ LDEPC respectively, 5, centrifugal 10 seconds of 000rpm; Reaction times: 42 ℃, 60 minutes;

(4) application of sample: in the PCR reaction tubes that 45 μ L FQ-PCR nucleic acid amplification liquid are housed, add the rt product respectively, negative quality control product, positive quality control product, critical positive quality control product, positive each 5 μ L of quantitatively quality control product build the pipe lid, and 5, centrifugal 10 seconds of 000rpm;

(5) FQ-PCR amplification: each reaction tubes is put into the reactive tank of quantitative fluorescent PCR instrument, mark fluorescent radical species, sample title and type are set, carry out pcr amplification by following condition;

94 ℃ 5 minutes;

94 ℃ 30 seconds, 58 ℃ 45 seconds, 5 circulations;

94 ℃ 30 seconds, 58 ℃ 45 seconds, fluorescent signal is collected in 35 circulations, reads fluorescent value in the end of a period in the 3rd step of response procedures;

(6) analysis and judgement: the Ct value less than 28 positive; The Ct value greater than 32 negative; The Ct value more than or equal to 28 and be less than or equal to 32 for the critical positive.

Further, when needs drawing standard curve, other gets 4 reaction tubess, directly adds the positive quantitatively quality control product 5 μ L of different concns gradient, and 5, centrifugal 10 seconds of 000rpm puts into the reactive tank of quantitative fluorescent PCR instrument.

The effect that the present invention is useful is: test kit of the present invention utilizes specific probe to detect Survivin genetic expression, and detection need not the electrophoresis of uncapping after accomplishing, and has avoided product pollution to reach the injury to lab assistant.The present invention can use the LNA probe, and the AllgloTM probe is realized.The present invention has realized the leap of PCR from qualitative to quantitative, and compares with conventional PCR, detects in real time to have overcome amplified production end point determination existing " platform effect " to the quantitative influence of product; It has specificity, sensitivity and the accuracy of height; And technological operation is easy, level of automation is high, owing to adopt the stopped pipe operation, does not need the PCR product postprocessing; Effectively solve characteristics such as PCR pollution problem, reliable results.

Description of drawings

Fig. 1 is the experimental result picture that provides in the embodiment of the invention 1;

Fig. 2 is the experimental result picture that provides in the embodiment of the invention 2;

Fig. 3 is the experimental result picture that provides in the embodiment of the invention 3;

Fig. 4 is the experimental result picture that provides in the embodiment of the invention 4;

Fig. 5 is the experimental result picture that provides in the embodiment of the invention 5;

Fig. 6 is the typical curve that provides in the embodiment of the invention 5.

Among the figure: the X-coordinate of Fig. 1, Fig. 2, Fig. 3, Fig. 4 and Fig. 5 is represented: expression cycle number (Cycle number), and ordinate zou is represented: fluorescent value (Delta Rn);

The X-coordinate of Fig. 6 is represented: LogC (logarithmic value of Survivin gene reverse transcription product cDNA initial concentration), ordinate zou is represented: the Ct value.

Embodiment

In order to make the object of the invention, technical scheme and advantage clearer,, the present invention is further elaborated below in conjunction with for example.Should be appreciated that described hereinly, and be not used in qualification the present invention for example only in order to explaining the present invention.

The invention provides a kind of Survivin gene nucleic acid detection kit, this test kit comprises reverse transcription reaction liquid, comprises Oligod (T) ₁₈Primers, 5 * AMV Buffer, dNTP Mixture, Ribonuclease Inhibitor, AMV enzyme; The FQ-PCR reaction solution comprises DEPC treating water, dNTP Mixture, Taq enzyme, 10 * PCR Buffer, contains Mg ²⁺Ion solution, Survivin gene forward primer, Survivin gene reverse primer, Survivin gene probe; The RNA extracting solution is that Trizol Reagents is comprising compositions such as phenol, oxine, beta-mercaptoethanol, guanidinium isothiocyanates; Hanks liquid is comprising NaCl, KCl, NaHCO ₃, Na ₂HPO ₄12H ₂O, KH ₂PO ₄, glucose, phenol red; Negative quality control product is not for containing the aseptic DEPC purified water of Survivin gene; Positive quality control product contains the plasmid standard of Survivin gene for high density; Critical positive quality control product contains the plasmid standard of Survivin gene for lower concentration; Positive quantitatively quality control product is the pUCm-T recombinant plasmid of the nucleotide fragments of 263 base pairs of the high conservative that contains Survivin, and this plasmid is bred in intestinal bacteria TOP10;

The manufacturing of test kit:

1. reagent

Reagent used in this test kit manufacturing processed is mainly available from precious biotechnology (Dalian) ltd.

2.FQ-PCR nucleic acid amplification reaction liquid preparation

(1) primer and probe design and synthetic:

Select the Survivin gene as the target detect gene; Retrieve through American National biotechnology information center (NCBI) (http://www.ncbi.nlm.nih.gov); Acquisition all can detected wild-type survivin gene in the kinds of tumors patient (the NCBI searching number: BC065497.1) with and splicing variants survivin-Δ Ex3 (NCBI searching number: NM_001012270.1) and survivin-2B (NCBI searching number: sequence NM_001012271.1); And 3 sequences are compared with MEGA4.0 software; Select wherein one section conserved sequence; This sequence is shown in SEQ ID NO.4 in the sequence table: 5 '-TGTGATTAGACAGGCCCAGTGAGCCGCGGGGCACATGCTGGCCGCTCCTCCCTCAG AAAAAGGCAGTGGCCTAAATCCTTTTTAAATGACTTGGCTCGATGCTGTG-3 '; Utilize Specialty Design software Primer Express 3.0 design primers, the probe sequence of real-time TaqMan quantitative fluorescent PCR; Primer, probe sequence not only will satisfy each item index in the software, and will guarantee that Survivin primer, probe sequence can detect Survivin gene and varient sequence thereof.In the present invention, 5 ' the terminal modified optical dye of Survivin probe can be selected from: FAM, HEX, TET, JOE, VIC, ROX, Cy3 or Cy5; 3 ' the terminal modified optical dye can be selected from: TAMRA, Eclipse, BHQ1, BHQ2, BHQ3 or DABCYL.The fluorescence report group is designed to FAM in the present embodiment, and the excitation wavelength of FAM is 485nm, and the reception wavelength is 527nm, and quenching group is designed to MGB.

Design result is as shown in the table:

The primer title	Base	The purifying mode	Primer sequence (5 '-3 ')
				Survivin-F	22bp	PAGE	TGTGATTAGACAGGCCCAGTGA
Survivin-R	20bp	PAGE	CACAGCATCGAGCCAAGTCA
				The probe title	Reporter group	Quenching group	Composition sequence
Survivin-P	FAM	MGB	CACATGCTGGCCGCT

In the table: F:forward, forward; Survivin-F representes Survivin gene forward primer.

R:reverse, reverse; Survivin-R representes Survivin gene reverse primer.

P:probe, probe; Survivin-P representes the Survivin gene probe, and probe both can be the TaqMan-MGB probe and also can be the LNA probe.

FAM: fluorescence report group.

MGB: fluorescent quenching group.

According to the design result of last table, entrust the English Weihe River prompt base (Shanghai) trade Co., Ltd (Invitrogen Corporation Shanghai Representative Office) synthetic primer and probe.

(2) FQ-PCR nucleic acid amplification reaction liquid preparation: DEPC treating water consumption 27.5 μ L; Concentration is the warm start Taq enzyme dosage 0.5 μ L of 5U/ μ L; Concentration is the dNTP Mixture consumption 1 μ L of 10mmol/L; 10 * PCR Buffer consumption, 5 μ L; Concentration is the MgCl of 25mmol/L ₂Solution usage 7 μ L, concentration are the Survivin gene forward primer consumption 1.5 μ L of 10 μ mol/L, the Survivin gene reverse primer consumption 1.5 μ L that concentration is 10 μ mol/L, the Survivin probe consumption 1 μ L that concentration is 10 μ mol/L.

3. the preparation of reverse transcription reaction liquid: concentration is the Oligo d (T) of 50pmol/ μ l ₁₈ Primers consumption 2 μ L, 5 * AMVBuffer consumption, 4 μ L, concentration are the dNTP Mixture consumption 1 μ L of 10mmol/L; Concentration is that the Ribonuclease Inhibitor consumption of 40U/ μ L is 0.5 μ L; Concentration is that the AMV enzyme dosage of 5U/ μ L is 1 μ L.

4. negative quality control product preparation: for not containing the aseptic DEPC purified water of Survivin gene

The negative quality control product that is up to the standards of learning from else's experience is a purified water, directly draws 5 μ L and makes template.

5. positive quality control product preparation: high density contains the positive plasmid of Survivin gene

Get the recombinant plasmid that contains the Survivin gene, change intestinal bacteria TOP10 propagation over to, plasmid is synthetic to be provided by Shanghai Sani's bio tech ltd with bacterial strain.Earlier,, extract the recombinant plasmid that contains the Survivin gene, utilize micro-spectrophotometer to survey A with the plasmid extraction kit of giving birth to the biological (Shanghai) Co., Ltd. of worker at multiplication by culture 4～5h through the 12h activation of spending the night ₂₆₀Quantitatively, convert according to formula then and be diluted to 1.0 * 10 ⁶Copy/ml promptly can be used as the positive quality control product template.

6. critical positive quality control product preparation: lower concentration contains the positive plasmid of Survivin gene

Get the recombinant plasmid that contains the Survivin gene, change intestinal bacteria TOP10 propagation over to, plasmid is synthetic to be provided by Shanghai Sani's bio tech ltd with bacterial strain.Earlier,, extract the recombinant plasmid that contains the Survivin gene, utilize micro-spectrophotometer to survey A with the plasmid extraction kit of giving birth to the biological (Shanghai) Co., Ltd. of worker at multiplication by culture 4～5h through the 12h activation of spending the night ₂₆₀Quantitatively, convert according to formula then and be diluted to 1.0 * 10 ⁴Copy/ml promptly can be used as critical positive quality control product template.

7.RNA extracting solution is Trzizol Reagents, comprising: compositions such as phenol, oxine, beta-mercaptoethanol, guanidinium isothiocyanate.

8.Hanks liquid is comprising NaCl, KCl, NaHCO ₃, Na ₂HPO ₄12H ₂O, KH ₂PO ₄, glucose, phenol red.

9. positive quantitatively quality control product 1 contains and has an appointment 1.0 * 10 ⁷The positive plasmid that contains the Survivin gene of copy/ml;

10. positive quantitatively quality control product 2 contains and has an appointment 1.0 * 10 ⁶The positive plasmid that contains the Survivin gene of copy/ml;

11. positive quantitatively quality control product 3 contains and has an appointment 1.0 * 10 ⁵The positive plasmid that contains the Survivin gene of copy/ml;

12. positive quantitatively quality control product 4 contains and has an appointment 1.0 * 10 ⁴The positive plasmid that contains the Survivin gene of copy/ml;

Positive quantitatively quality control product; PUCm-T recombinant plasmid for the nucleotide fragments of 263 base pairs of the highly conserved sequence that contains Survivin; Alkaline lysis method of extracting is used in these recombinant plasmid transformed intestinal bacteria TOP 10 propagation backs, through DNA purification kit purifying, with spectrophotometric instrumentation A ₂₆₀Quantitatively, convert according to formula then and be diluted to 1.0 * 10 ⁹Copy/ml ,-20 ℃ of preservations.Storing concentration is 1.0 * 10 ⁹Copy/ml uses the preceding serial dilution that carries out 10 times of gradients with SPSS or 0.01mol/L PBS.Working concentration is followed successively by 1.0 * 10 ⁷Copy/ml, 1.0 * 10 ⁶Copy/ml, 1.0 * 10 ⁵Copy/ml and 1.0 * 10 ⁴Copy/ml, before the use, centrifugal 1 minute of 12000rmp gets 5 μ L and makes template.

Test kit of the present invention can be configured (24 person-portions/box) according to following table:

Test kit of the present invention stores-20 ℃ ± 5 ℃ lucifuges, avoids multigelation; Validity period 6 months suitable instruments (ABI7500, ABI7300, Bio-Rad iQ5 ^TM, Stratagene Mx3000P, Stratagene Mx3005P reach peace 7000) etc.

Embodiment 1

On ABI 7300 quantitative real time PCR Instruments, detect the method for Survivin nucleic acid amplification with test kit of the present invention

(1) collected specimens: gather tumour patient fresh whole blood or tumour flesh tissue;

A, tumour fresh whole blood: extract person under inspection 3-5 milliliter with asepsis injector, inject Na ₂In EDTA or the Sodium Citrate anticoagulant tube, fully mixing censorship.

Tumour flesh tissue: get biopsy or the about 500mg of operation patients tumor tissues, be put in the EP pipe of 2ml DEPC water treatment airtight censorship.

B, sample storage and transport:, avoid multigelation and the haemolysis that causes if test immediately of sample should be stored in room temperature.Long-distance the transporting of sample should be adopted 4 ℃ of curling stones.

(2) sample preparation:

A, fresh whole blood: the mixing anticoagulation, get 500 μ l-1000 μ l and go in the clean 2ml centrifuge tube numbering mark.The centrifugal 10min of 4000r/min.Abandon serum, add 600 μ l Hank ' s liquid, mixing is resuspended.Other gets a new 2ml centrifuge tube and adds 800 μ l human lymphocyte parting liquids (providing for oneself), with the resuspended liquid of red corpuscle slowly be added in parting liquid upper strata, the centrifugal 20min of 2000r/min.Draw the middle suspended layer of white in another new 1.5ml centrifuge tube with capillary pipet or 1ml disposable syringe; Add 800 μ l Hank ' s liquid; Mixing, the centrifugal 2min of 12000r/min, white precipitate is resuspended with 50 μ l DEPC purified water; Add 150 μ lRNA extracting solutions and fully shake, room temperature is placed 5min.

B, flesh tissue: get the 500mg tumor tissues, add 1ml saline water, fully grind to form tissue homogenate (or use liquid nitrogen grinding), get 100 μ l homogenates and add 500 μ l RNA extracting solutions and fully shake room temperature placement 5min.

(3) RNA extracts: add 30 μ l chloroforms, firmly shake 15s-30s, ice bath 10min, 4 ℃ 12, the centrifugal 15min of 000rpm.Carefully water 100 μ l in upper strata are transferred in the clean 0.5ml centrifuge tube, add 100 μ l Virahol mixings, ice bath 15min, the centrifugal 15min of 12000rpm.Abandon supernatant, add the DEPC ethanol of 300 μ l 75%, fully put upside down mixing, 13, the centrifugal 10min of 000rpm, the careful suction removed most of ethanol.With extraction tube uncovered in air at room temperature dry 5-10min treat that ethanol volatilization is clean, with 11 μ l DEPC H ₂The O dissolution precipitation.

(4) reverse transcription: take out reverse transcription reaction liquid chamber temperature dissolving (needing the instantaneous centrifugal 30s of 12000rpm before using), every pipe adds 11 μ l DEPC H in reaction tubes ₂O dissolved RNA.Then each reaction tubes is carried out following circulation in the PCR instrument: 42 ℃ 60 minutes.

(5) FQ-PCR reaction application of sample: in the PCR reaction tubes that 45 μ L FQ-PCR reaction solutions are housed, add sample, negative quality control product, positive quality control product, critical positive quality control product 5 μ L after handling respectively, build the pipe lid, 5, centrifugal 10 seconds of 000rpm;

Survivin FQ-PCR reaction system such as following table:

Reagent name and concentration	Add-on/person-portion (μ L)	Final concentration
			10×PCR?buffer	5.0	1×PCR?buffer
MgCl 2(25mmol/L)	7.0	3.5mmol/L
			dNTP?Mixture(10mmol/L)	1	0.2mmol/L
Survivin?FP(10μmol/L)	1.5	0.30μmol/L
			Survivin?RP(10μmol/L)	1.5	0.30μmol/L
Survivin?Probe(10μmol/L)	1	0.20μmol/L
			Taq enzyme (5U/ μ L)	0.5	2.5U/ part
Template
		5
Add water				27.5
	TV	50

(4) pcr amplification: the reactive tank of each reaction tubes being put into the quantitative fluorescent PCR instrument; Mark fluorescent radical species, sample title and type are set; (this product fluorescence report group is FAM to the Taqman probe that selection will be used; The fluorescent quenching group is MGB), the definition sample well: negative quality control product selects NTC; Sample to be checked, positive quality control product choosing and critical positive quality control product Unknown.

According to the form below carries out pcr amplification;

Finally read fluorescent value in the 3rd step of response procedures;

(5) analysis and judgement:

The Ct value less than 28 positive; The Ct value greater than 32 negative; The Ct value greater than with equal 28 and less than with equal 32 for the critical positive.The test-results of the embodiment of the invention 1 is as shown in Figure 1, and concrete detected result sees the following form:

Sequence number	Ct
			1	28.94
2	Undet
		3	21.18
4	22.37
		5	27.98
6	28.55
		7	28.97
8	27.40
		9	Undet
10	24.23

Wherein, sample 3,4,5,8,10 in positive scope, positive sample; Sample 1,6,7 in critical positive scope, is critical positive sample; Sample 2,9 in negative scope, negative sample.

Embodiment 2

Detect the Survivin gene nucleic acid of unknown sample according to the method for embodiment 1 with test kit of the present invention.The unknown sample source oncology patient of institute of traditional Chinese medicine of Hubei Province sample to be determined, the test-results of the embodiment of the invention 2 is as shown in Figure 2, and detected result sees the following form:

Sequence number	Ct
			1	26.90
2	21.62
		3	20.94
4	10.99
		5	13.56
6	17.07
		7	17.15
8	18.54

Wherein, sample standard deviation in positive scope, positive sample.

Embodiment 3

Detect the Survivin gene nucleic acid of unknown sample with test kit of the present invention, except that the RNA process for extracting, the method for all the other and embodiment 1 is basic identical, and the sample processing method of present embodiment is following:

The RNA process for extracting: add 30 μ l chloroforms, firmly shake 15s-30s, 4 ℃ 12, the centrifugal 15min of 000rpm.Carefully water 100 μ l in upper strata are transferred in the clean 0.5ml centrifuge tube, add 100 μ l Virahol mixings, the centrifugal 15min of 12000rpm.Abandon supernatant, add the DEPC ethanol of 300 μ l 75%, fully put upside down mixing, 13, the centrifugal 10min of 000rpm, the careful suction removed most of ethanol.With extraction tube uncovered in air at room temperature dry 5-10min treat that ethanol volatilization is clean, with 11 μ l DEPCH ₂The O dissolution precipitation.

The test-results of the embodiment of the invention 3 is as shown in Figure 3, and detected result sees the following form:

Sequence number	Ct
			1	21.40
2	23.84
		3	27.12
4	15.91
		5	16.16
6	21.73
		7	23.03
8	26.89

Wherein, sample standard deviation in positive scope, positive sample.

Embodiment 4

Detect the Survivin nucleic acid of unknown sample with test kit of the present invention, except that the RNA process for extracting, the method for all the other and embodiment 1 is basic identical, and the sample processing method of present embodiment is following:

RNA process for extracting: add 50 μ l chloroforms, firmly shake 15s-30s, ice bath 10min, 4 ℃ 12, the centrifugal 15min of 000rpm.Carefully water 100 μ l in upper strata are transferred in the clean 0.5ml centrifuge tube, add 100 μ l Virahol mixings, ice bath 15min, the centrifugal 15min of 12000rpm.Abandon supernatant, add the DEPC ethanol of 300 μ l 75%, fully put upside down mixing, 13, the centrifugal 10min of 000rpm, the careful suction removed most of ethanol.With extraction tube uncovered in air at room temperature dry 5-10min treat that ethanol volatilization is clean, with 11 μ l DEPC H ₂The O dissolution precipitation.

The test-results of the embodiment of the invention 4 is as shown in Figure 4, and detected result sees the following form:

Sequence number	Ct
			1	22.04
2	23.12
		3	26.37
4	19.15
		5	21.41
6	23.09
		7	24.12
8	26.61

Wherein, sample standard deviation in positive scope, positive sample.

Analyze:

Embodiment 2,3,4 has detected the positive of same Survivin genetic expression respectively, and other are identical except that the RNA process for extracting in its experimental technique, as relatively:

In conjunction with Fig. 2,3,4 and the experimental result of embodiment 2,3,4 can find out that the Ct value is littler among the result of embodiment 2, detect the positive rate height, curve is S-type and be higher than the experimental result of embodiment 3,4, and more level and smooth.Embodiment 2 adopts the experimental technique of embodiment 1, so the foregoing description 1 is a preferred version of the present invention, embodiment 3,4 is alternative,

Embodiment 5

When utilizing test kit of the present invention to carry out detection by quantitative; Need the drawing standard curve, except that 8 sample reaction tubess, other gets 3 reaction tubess and is respectively negative quality control product, positive quality control product, critical positive quality control product; Also have 4 reaction tubess; Give the corresponding positive quantitatively quality control product 5 μ l that add different concns gradient in the test kit in each reaction tubes, centrifugal 10 seconds of 5000rpm is a template with the quantitative quality control product of the positive; According to the method preparation reaction system of embodiment 1, put into the instrument sample cell then and carry out pcr amplification.Positive quantitatively quality control product selects Standard.For Standard, need in the Quantity hurdle, import 1.0 * 10 respectively ⁷Copy/mL, 1.0 * 10 ⁶Copy/mL, 1.0 * 10 ⁵Copy/mL, 1.0 * 10 ⁴Copy/mL.

Use instrument ABI 7300 reference results:

If a. not S-type or Ct value＞32 of amplification curve judge that Survivin genetic expression content is less than detecting lower limit in the sample;

If not obvious or 28≤Ct value≤32 of amplification curve S type b., then Survivin genetic expression content is in critical positive scope in the sample;

If S-type and Ct value＜28 of amplification curve are c. then undertaken quantitatively by following method:

If the C of sample (" C " expression concentration of specimens or content)＜5.0000E+01, then Survivin genetic expression total content＜50 gene copies of this sample;

If the 5.0000E+01≤C≤5.0000E+07 of sample, then the Survivin genetic expression total content=C gene copy of this sample;

If the C＞5.0000E+07 of sample, the Survivin genetic expression total content＞5.0000E+07 gene copy of this sample then is with detecting in diluted sample to the linearity range again;

Typical curve according to following table is drawn is as shown in Figure 6, and ■ is standard substance, * be sample.

Positive quantitatively quality control product	?Ct	C (starting point concentration)
			1.0e+007	?14.40	1.0e+007
1.0e+006	?17.37	1.0e+006
			1.0e+005	?20.78	1.0e+005
1.0e+004	?24.29	1.0e+004
			Slope	?-3.37	-
Intercept	?37.71	-
			R 2	?0.99	-
Standard equation	?y＝-3.37x+37.71	-

The amplification curve of the embodiment of the invention 5 is as shown in Figure 5, and the positive quantitatively quality control product of present embodiment and 8 samples detect together, according to the Ct value that obtains after the amplification, look into the typical curve of Fig. 6, again through conversion, finally obtain 8 samples starting point concentration such as following table.

Detected result sees the following form: data of the present invention are accurate to 0.01.

Sequence number	Ct	C (starting point concentration)
			Positive quality control product	17.08	1.33e+006
Critical positive quality control product	28.90	0.94e+004
			Negative quality control product	Undet	-
1	17.15	1.26e+006
			2	Undet	-
3	22.01	3.46e+004
			4	Undet	-
5	18.54	4.87e+005
			6	21.61	5.97e+004
7	20.94	9.48e+004
			8	Undet	-

Amplification curve all is smooth " S " type, and typical curve is a straight line, and the Ct value is between 14-28, and the Ct value difference of each concentration gradient is about 3.3.

The above is merely preferred embodiment of the present invention, and is in order to restriction the present invention, not all within spirit of the present invention and principle, any modification of being done, is equal to replacement, improvement etc., all should be included within protection scope of the present invention.

< 110>Hangzhou Ai Li Kang Pharmaceutical Technology Co., Ltd

< 120>Apoptosis Inhibitor Protein Survivin gene nucleic acid detection probes, primer, test kit and detection method thereof

<130>

<160> 4

<170> PatentIn?version?3.4

 

<210> 1

<211> 22

<212> DNA

< 213>artificial sequence

 

<220>

< 221>primer

<222> (1)..(22)

 

<400> 1

tgtgattaga?caggcccagt?ga 22

 

<210> 2

<211> 20

<212> DNA

< 213>artificial sequence

 

<220>

< 221>primer

<222> (1)..(20)

 

<400> 2

cacagcatcg?agccaagtca 20

 

<210> 3

<211> 15

<212> DNA

< 213>artificial sequence

 

<220>

< 221>probe

<222> (1)..(15)

 

<400> 3

cacatgctgg ccgct 15

 

<210> 4

<211> 106

<212> DNA

< 213>people

 

<220>

< 221>gene

<222> (1)..(106)

 

<400> 4

tgtgattaga?caggcccagt?gagccgcggg?gcacatgctg?gccgctcctc?cctcagaaaa 60

aggcagtggc?ctaaatcctt?tttaaatgac?ttggctcgat?gctgtg 106

 

 

 

Claims (6)

1. an Apoptosis Inhibitor Protein Survivin gene nucleic acid detects primer, it is characterized in that: comprise following sequence set:

Comprise following forward primer, one group of sequence of reverse primer:

Forward primer is shown in SEQ ID NO.1 in the sequence table: 5'-TGTGATTAGACAGGCCCAGTGA-3',

Reverse primer is shown in SEQ ID NO.2 in the sequence table: 5'-CACAGCATCGAGCCAAGTCA-3',

One group of sequence of perhaps holding the nucleotide fragments that prolongation is arranged at the 5 ' end and/or 3 ' of above-mentioned sequence;

Perhaps with the homology of above-mentioned sequence greater than one group of sequence of 85%;

Perhaps with one group of sequence of the base complementrity of above-mentioned sequence.

2. the probe that detects of an Apoptosis Inhibitor Protein Survivin gene nucleic acid is characterized in that: be following sequence:

Fluorescent probe is shown in SEQ ID NO.3 in the sequence table: 5'-CACATGCTGGCCGCT-3';

One group of sequence of perhaps holding the nucleotide fragments that prolongation is arranged at the 5 ' end and/or 3 ' of above-mentioned sequence;

Perhaps with the homology of above-mentioned sequence greater than one group of sequence of 85%;

Perhaps with one group of sequence of the base complementrity of above-mentioned sequence;

Wherein, 5 ' of said fluorescent probe end and 3 ' end are modified with FAM, MGB fluorophor respectively.

3. the probe that Apoptosis Inhibitor Protein Survivin gene nucleic acid according to claim 2 detects is characterized in that wherein 5 ' of the fluorescent probe terminal modified optical dye is selected from: FAM, HEX, TET, JOE, VIC, ROX, Cy3 or Cy5; 3 ' the terminal modified optical dye is selected from: TAMRA, Eclipse, BHQ1, BHQ2, BHQ3 or DABCYL.

4. the test kit that detects of an Apoptosis Inhibitor Protein Survivin gene nucleic acid is characterized in that this test kit contains:

(1) reverse transcription reaction liquid, the proportioning of each component concentration is: concentration is the Oligo d (T) of 50 pmol/ μ l ₁₈Primers consumption 2 L, 5 * AMV Buffer consumption, 4 L, concentration are dNTP Mixture consumption 1 L of 10mmol/L; Concentration is that the Ribonuclease Inhibitor consumption of 40U/ L is 0.5 L; Concentration is that the AMV enzyme dosage of 5 U/ L is 1 L;

(2) FQ-PCR nucleic acid amplification reaction liquid is comprising DEPC treating water, dNTP Mixture, Taq enzyme, 10 * PCR Buffer, contain Mg ²⁺Ion solution, Survivin gene forward primer, Survivin gene reverse primer, Survivin gene probe;

Survivin gene forward primer is shown in SEQ ID NO.1 in the sequence table:

5'-?TGTGATTAGACAGGCCCAGTGA?-3'，

Survivin gene reverse primer is shown in SEQ ID NO.2 in the sequence table:

5'-?CACAGCATCGAGCCAAGTCA?-3'，

The Survivin gene probe is shown in SEQ ID NO.3 in the sequence table:

5'-?CACATGCTGGCCGCT?-3'；

Wherein, 5 ' of said fluorescent probe end and 3 ' end are modified with FAM, MGB fluorophor respectively;

(3) RNA extracting solution, Trizol reagents is comprising phenol, oxine, beta-mercaptoethanol, guanidinium isothiocyanate composition;

(4) Hank ' s liquid;

(5) negative quality control product is not for containing the aseptic DEPC purified water of Survivin gene;

(6) positive quality control product is 1.0 * 10 ⁶Copy/mL contains the positive plasmid standard substance of Survivin gene;

(7) critical positive quality control product is 1.0 * 10 ⁴Copy/mL contains the positive plasmid standard substance of Survivin gene;

(8) positive quantitatively quality control product, for containing the positive plasmid standard substance of Survivin gene, working concentration is 1.0 * 10 ⁷Copy/ml, 1.0 * 10 ⁶Copy/ml, 1.0 * 10 ⁵Copy/ml and 1.0 * 10 ⁴Copy/ml; Positive plasmid changes intestinal bacteria TOP10 over to and breeds.

5. the test kit that Apoptosis Inhibitor Protein Survivin gene nucleic acid according to claim 4 detects is characterized in that wherein 5 ' of the fluorescent probe terminal modified optical dye is selected from: FAM, HEX, TET, JOE, VIC, ROX, Cy3 or Cy5; 3 ' the terminal modified optical dye is selected from: TAMRA, Eclipse, BHQ1, BHQ2, BHQ3 or DABCYL.

6. the test kit that Apoptosis Inhibitor Protein Survivin gene nucleic acid according to claim 4 detects is characterized in that described Hank ' s liquid is made up of plurality of inorganic salt, comprises in wherein every 1000mL Hank ' s liquid:

NaCl 8g

KCl 0.4g

NaHCO ₃ 0.35g

Na ₂HPO ₄·12H ₂O 0.12g

KH ₂PO ₄ 0.06g

Glucose 1g

Phenol red 0.02g.

The test kit that Apoptosis Inhibitor Protein Survivin gene nucleic acid according to claim 4 detects is characterized in that the proportioning of said each component concentration of FQ-PCR nucleic acid amplification reaction liquid is: DEPC treating water consumption 27.5 L; Concentration is warm start Taq enzyme dosage 0.5 L of 5U/ L; Concentration is dNTP Mixture consumption 1 L of 10mmol/L; 10 * PCR Buffer consumption, 5 L; Concentration is the MgCl of 25mmol/L ₂Solution usage 7 L; Concentration is Survivin gene forward primer consumption 1.5 L of 10 μ mol/L; Concentration is Survivin gene reverse primer consumption 1.5 L of 10 μ mol/L; Concentration is Survivin probe consumption 1 L of 10 μ mol/L.

A kind of detection method of Apoptosis Inhibitor Protein Survivin gene nucleic acid is characterized in that, comprises the following steps:

(1) collected specimens: gather tumour patient fresh whole blood or tumour flesh tissue;

A, tumour fresh whole blood: extract person under inspection 3-5 milliliter with asepsis injector, inject Na ₂In EDTA or the Sodium Citrate anticoagulant tube, fully mixing censorship;

Tumour flesh tissue: get biopsy or operation patients tumor tissues 500mg, be put in the EP pipe of 2ml DEPC water treatment airtight censorship;

B, sample storage and transport:, avoid multigelation and the haemolysis that causes if test immediately of sample should be stored in room temperature; Long-distance the transporting of sample should be adopted 4 ℃ of curling stones;

(2) sample preparation:

A, fresh whole blood: the mixing anticoagulation, get 500 μ l-1000 μ l and go in the clean 2 ml centrifuge tubes numbering mark; The centrifugal 10min of 4000r/min; Abandon serum, add 600 μ l Hank ' s liquid, mixing is resuspended; Other gets a new 2ml centrifuge tube and adds 800 μ l human lymphocyte parting liquids, with the resuspended liquid of red corpuscle slowly be added in parting liquid upper strata, the centrifugal 20min of 2000r/min; Draw the middle suspended layer of white in another new 1.5ml centrifuge tube with capillary pipet or 1ml disposable syringe; Add 800 μ l Hank ' s liquid; Mixing, the centrifugal 2min of 12000r/min, white precipitate is resuspended with 50 μ l DEPC purified water; Add 150 μ l RNA extracting solutions and fully shake, room temperature is placed 5min;

B, flesh tissue: get the 500mg tumor tissues, add 1ml saline water, fully grind to form tissue homogenate or use liquid nitrogen grinding, get 100 μ l homogenates and add 500 μ l RNA extracting solutions and fully shake room temperature placement 5min;

(3) RNA extracts: add 30 μ l chloroforms, firmly shake 15s-30s, ice bath 10min, 4 ℃ 12, the centrifugal 15min of 000rpm; Carefully water 100 μ l in upper strata are transferred in the clean 0.5ml centrifuge tube, add 100 μ l Virahol mixings, ice bath 15min, the centrifugal 15min of 12000rpm; Abandon supernatant, add the DEPC ethanol of 300 μ l 75%, fully put upside down mixing, 13, the centrifugal 10min of 000rpm, the careful suction removed most of ethanol; With extraction tube uncovered in air at room temperature dry 5-10min treat that ethanol volatilization is clean, with 11 μ l DEPC H ₂The O dissolution precipitation;

(3) rt: in the PCR reaction tubes that 8.5 L reverse transcription reaction liquid are housed, add the water-soluble RNA sample of 11 LDEPC respectively, 5, centrifugal 10 seconds of 000rpm; Reaction times: 42 ℃, 60 minutes;

(4) application of sample: in the PCR reaction tubes that 45 L FQ-PCR nucleic acid amplification liquid are housed, add the rt product respectively, negative quality control product, positive quality control product, critical positive quality control product, positive each 5 L of quantitatively quality control product build the pipe lid, and 5, centrifugal 10 seconds of 000rpm;

(5) FQ-PCR amplification: each reaction tubes is put into the reactive tank of quantitative fluorescent PCR instrument, mark fluorescent radical species, sample title and type are set, carry out pcr amplification by following condition;

94 ℃ 5 minutes;

94 ℃ 30 seconds, 58 ℃ 45 seconds, 5 circulations;

94 ℃ 30 seconds, 58 ℃ 45 seconds, fluorescent signal is collected in 35 circulations, reads fluorescent value in the end of a period in the 3rd step of response procedures;

(6) analysis and judgement: the Ct value less than 28 positive; The Ct value greater than 32 negative; The Ct value more than or equal to 28 and be less than or equal to 32 for the critical positive.

Images