CN102409087B - Primer, probe and detection kit for determining beta-tubulin III gene expression - Google Patents
Primer, probe and detection kit for determining beta-tubulin III gene expression Download PDFInfo
- Publication number
- CN102409087B CN102409087B CN201110230606.0A CN201110230606A CN102409087B CN 102409087 B CN102409087 B CN 102409087B CN 201110230606 A CN201110230606 A CN 201110230606A CN 102409087 B CN102409087 B CN 102409087B
- Authority
- CN
- China
- Prior art keywords
- tubulin iii
- tubulin
- taxanes
- vinca
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a primer, probe and detection kit for determining beta-tubulin III expression. The primers and probes for determining beta-tubulin III gene expression include TUBB3-F TCTACTACAACGAGGCCTCTTCT, TUBB3-R CAAAGATGAAATTGTCAGGCCTGAA, TUBB3-P AGCCACACCAGAATGGCTCGAGGCACGTACCTCG and TUBB3-reverse transcription-TTGCCGGCCCCACTCTGACCAAA. The detection kit can measure the expression level of beta-tubulin III mRNA and provide a method for predicting possible resistance to treatment based on paclitaxels or vinblastines for the subjects.
Description
Invention field
The present invention relates to biological technical field.Be specifically related to use quantitative fluorescence PCR to determine genetic expression and a kind of primer, probe, test kit and the detection method for detection of 'beta '-tubulin III expressed of 'beta '-tubulin III (β-tubulin III) at tumour cell.
Background of invention
Tumour be the normal cell of body under various carcinogenic factors, some cells of local organization lose the normal regulation to its growth on gene level, cause its clonal abnormality hyperplasia to form.When tumour cell continues high-speed rapid growth and division, growth, in runaway condition, can be invaded healthy tissues, and usually transfers to the position growth away from its origin, and will form malignant tumour is cancer.When tumour forms, clinical target is to wish optionally kill tumor cell, alleviates in therapeutic process, to the infringement of organism normal cell simultaneously.
Chemotherapy refers to the method for applied chemistry pharmacological agent cancer.Chemotherapeutics can kill cancer cell, the Growth and reproduction of anticancer, thereby the purpose that arrives treatment or cure, and chemotherapy, when killing and wounding cancer cells, also can be killed and wounded normal cell, produces toxic side effect.Chemotherapy of tumors, as a kind of systemic treatment, is one of Main Means of current clinical treating malignant tumor.But tumors destroyed primary tumor and the remote cancer cells shifted therefore occupy very consequence in oncotherapy.In the chemotherapeutics of developing at present, mainly comprise anti-microtubule class medicine, as taxol, Docetaxel, vinealeucoblastine(VLB) and vinorelbine etc., its Main Function is in the cell microtubule, by affecting spindle body, form, thus a class wide spectrum chemotherapeutics of inhibition cell mitogen.The another kind of DNA for the infringement cell, as cis-platinum and carboplatin class medicine, these medicines are commonly referred to as the genotoxicity medicine.The chemotherapeutics of other class is the interfere RNA biosynthesizing, protein synthesis and function, and as 5 FU 5 fluorouracil, gemcitabine, methotrexate class medicine, these are commonly referred to as antimetabolite.Yet, the curative effect of chemotherapeutics is relevant with the patient individual difference, these differences comprise that patient is to the sensitivity of chemotherapeutics and to the tolerance degree difference of medicine, same patient, some chemotherapeutics has good curative effect, other medicines are weak curative effect, and even some medicine can produce serious toxic side effect.
Existing research shows, in tumour cell, some genetic expression and chemotherapeutics have certain relation to the susceptibility of function of tumor and the tolerance degree of medicine.The susceptibility difference of different tumour cells to the same medicine, same tumour cell also there are differences the reaction of different pharmaceutical.Thereby, in chemotherapy administration process, the susceptibility of every kind of medicine or the Identification and detection of resistance determinative are become to the effective tool that designs individual chemotherapy.
The anti-cell microtubule class had been found that and widely used chemotherapeutics are taxanes and vinca, and taxanes and vinca chemotherapeutics Main Function form the micro-tubular structure of cytoskeleton in tumour cell.Cell microtubule (Microtubule) is important cytoskeleton in eukaryotic cells, is to consist of the cylindrical-shaped structure body of hollow 13 protofibril longitudinal arrangements, and every protofibril is that the dimer that tubulin α and β form forms.Tubulin α and β are serving as and are maintaining the cellular form function, and the transfer cell signal information participates in the critical functions such as mitotic division.(Giannakakou P, Sackett DL, Fojo T.Tubulin/Microtubules:still a promising target for new chemotherapeutic agents.J Natl Cancer Inst, 2000; 92; 3182-3.) exist 6 kinds of beta tubulin phenogens in the human cell, wherein 3 type 'beta '-tubulins and the chemotherapy drug susceptibility that acts on microtubule have close relationship.
The taxanes chemotherapeutics acts on the tumour cell G2/M phase, mainly, by being combined with β-tubulin III the 31st amino acids residue and 217-231 amino acids residue, lures tubulin polymerization into, suppresses it and separates collecting process.Vascular bundle can not be interconnected with microtubule organizing center, will block in G2/M the phase cell cycle, cause tumour cell mitotic division extremely or stop, making tumour cell can't continue division and death.(Seve P, Dumontet C.Is class III beta-tubulin a predictive factor in patient receiving tubulin-binding agents? Lancet Oncol 2008, 9:168-75) similar with Japanese yew based chemotherapy medicine, the vinca chemotherapeutics is the 175-213 amino-acid residue that acts on β-tubulin III, affect microtubule and form the dimeric formation of stylish tubulin, make the precursor bending of the new dimer protein formed, can not extend, thereby the blocking-up microtubule polymerization becomes spindle body, tumoricidal mitotic division, make microtubule and spindle body lose normal function and cause necrocytosis (Gan P, Pasquier E, Kavallris M.Class III-tubulin mediates sensitivity to chemotherapeutic drugs in non-small cell lung cancer.Cancer Res 2007, 67:9356-63.).
Existing research report, there are close ties in the expression level of β-tubulinIII and taxanes chemotherapeutics and vinca chemotherapeutical medicine curative effect.(the Seve P such as Seve, Mackey J, Isaac S, Tredan O, Souquet PJ, PerolM, et al.Class III-Tubulin expression intumor cells predicts response and outcome inpatients with non-small cell lung cancer receiving paclitaxel.Mol Cancer Ther 2005; 4:2001-7.) to take 47 routine Patients with Non-small-cell Lungs be research object, the treated effect of discovery taxanes chemotherapeutics in β-tubulin III high expression level person is 12.5%, and its treated effect is 61.9% in the low expresser of β-tubulin III, β-tubulin III is low express the patient without recurrence lifetime and the Overall survival person that all obviously is longer than the high expression level.The people such as Rosell (Rosell R, Scagliotti G, Danenberg KD, Lord RV, Bepler G, Novell O, et al.Transcripts in pretreatment biopsies from a three-arm randomized trial in metastatic non-small-cell lungcancer.Oncogene 2003; 22:3548-52.) research detected the mrna expression level of β-tubulin III gene in the Patients with Non-small-cell Lung, found that in the patient who accepts vinealeucoblastine(VLB)/cisplatin chemotherapy scheme, the low patient who expresses β-tubulin III mRNA has higher chemotherapy efficient, have the trend of obvious prolongation its lifetime, indicated that the expression level of β-tubulin III can be used as the important indicator of prediction Patients with Non-small-cell Lung to the vinealeucoblastine(VLB) chemotherapeutic efficacy.Therefore, the level that β-tubulin III expresses in tumour can be used for determining whether taxanes chemotherapeutics and vinca chemotherapeutics can effectively treat the main Prognostic Factors of cancer.
Clinical cost benefit (Cost effectiveness) analysis and research show (A Clegg, DA Scott, P Hewitson, M Sidhu, N Waugh.Clinical and cost effectiveness of paclitaxel, docetaxel, gemcitabine, and vinorelbine in non-small cell lung cancer:a systematic review.Thorax 2002; 57:20-8.), adopt taxanes or vinca chemotherapeutics to treat the lifetime that lung cancer can obviously increase tumour patient, and the prolongation of this lifetime does not show the decline of life quality (Quality of Life) and the increase of medical expense expenditure.Research finds, patients with lung cancer accepted take taxanes or vinca and taxanes or vinca associating platinum-based chemotherapy medicine and be benefited very much as the scheme for the treatment of.β-tubulin III gene as with taxanes and the closely related gene of vinca chemotherapy drug susceptibility, therefore, before implementing chemotherapy, for β-tubulin III genetic expression, detect for increasing the survival of patients phase, improve the treatment quality of life, reduce the patient treatment cost, tool has very important significance.
At present, the measuring method that comprises the detection by quantitative genetic expression that β-tubulin III expresses is one of focus of molecular biosciences field of medicaments research, the sensitivity of its detection by quantitative gene expression method, the method of calculation of accuracy and measurement genetic expression height, enjoy molecular biosciences medical research personnel to pay close attention to.Up to now, still there is no larger progress in this technical field.Therefore, need especially a kind of can be efficiently quick, high-accuracy, the detection method that highly sensitive quantitate gene is expressed and a kind of easy, can intuitively weigh the method for calculation of genetic expression height, in order to the early prognosis of oncotherapy is provided.
The invention provides a kind of detection method that detects β in the patient tumors cell-tubulin III mrna expression amount, thereby assess β in various paraffin embeddings and flesh tissue-tubulin III expression level, the possible resistance with the predicting tumors patient to taxanes or vinca and taxanes or the treatment of vinca associating platinum medicine.It is a kind of efficient that the present invention provides simultaneously, high-accuracy, highly sensitive real-time quantitative fluorescence PCR test method and detection kit and a kind of new method of calculation of weighing the genetic expression height.
Summary of the invention
One aspect of the present invention provides the method for β in assess and determine paraffin embedding and flesh tissue cell-tubulin III mrna expression level.
The present invention provides the method for a kind of definite patient's chemotherapy regimen on the other hand, comprises isolation of RNA from neoplasmic tissue sample; The expression level of β in working sample-tubulin III gene; The reference group of the expression level of β-tubulinIII gene and β-tubulin III gene compares; Expression based on β-tubulin III gene and reference group expression level compare definite chemotherapy regimen.If described β-tubulin III expresses 25% tantile that is less than or equal to β-tubulin III expression level, select so the chemotherapeutics that comprises taxanes or vinca and taxanes or vinca associating platinum class to be treated, and if β-tubulin III expression level is selected not to be advisable containing the chemotherapy of taxanes or vinca and taxanes or vinca associating platinum class higher than 75% tantile so.
The present invention in embodiments, is provided for measuring the β-primer of tubulin genetic expression and the sequence of probe in Table 1.
Table 1 primer and probe sequence
| The upper primer of TUBB3- | TCTACTACAACGAGGCCTCTTCT |
| Primer under TUBB3- | CAAAGATGAAATTGTCAGGCCTGAA |
| TUBB3-P | FAM-5-AGCCACACCAGAATGGCTCGAGGCACGTACCTCG-3-BHQ1 |
| The TUBB3-reverse transcription | TTGCCGGCCCCACTCTGACCAAA |
The present invention provides on the other hand for measuring the test kit of tissue sample β from the patient-tubulin III genetic expression.In embodiments, describedly for measuring β-tubulin III, express test kit and comprise: Oligonucleolide primers, with the forward primer of β-tubulin III hybridization, reversed transcriptive enzyme, archaeal dna polymerase, damping fluid and Nucleotide, wherein the Fluorescence PCR amplification system is as follows:
The present invention on the other hand, is provided as the experimenter and estimates suitable embolic chemotherapy.The method comprises and adopts real-time quantitative fluorescence PCR to measure β in tumor sample-tubulin III gene expression dose and, based on β-definite chemotherapy regimen of tubulin III gene expression dose, the method comprises the following steps:
(1) collect cancer patients's serum sample, extract its mRNA;
(2) design of PCR primer and probe is with synthetic, and primer and probe sequence are in Table 1;
(3) separation of total mRNA preparation;
(4) total cDNA's is synthetic;
(5) carry out the real-time fluorescence quantitative PCR amplification;
(6) calculate the formula of gene expression amount according to the Ct value.Comprise: record the numerical value C1 on β-tubulin III gene typical curve, detect the numerical value C2 of sample on reference gene β-actin typical curve, ask again relative ratio=C1/C2, then relative ratio is taken to right logarithm, that is: gene expression amount=ln (C1/C2).
The anti-cell Microtubule proteins chemotherapeutics taxanes and the vinca that in the present invention, use, comprise Taxan (taxanes), taxol (paclitaxel), Taxotere (docetaxel), reach vinealeucoblastine(VLB) (vinblastine), vincristine(VCR) (vincristine), vinorelbine (vinorelbine), vinca alkaloids (vinca alkaloids), vindesine (vindesine) and Vinflunine (vinflunine).
Platiniferous chemotherapeutics used in the present invention, comprise cis-platinum (cisplatin), carboplatin (carboplatin), and oxaliplatin (oxaliplatin).
Test kit beneficial effect of the present invention is: adopt based on Auele Specific Primer and novel bicyclic probe technique, set up PCR in real time and detected the detection method that β-tubulin III expresses, this method: (1) is highly sensitive, can detect the mutant DNA that is low to moderate 15 copies; (2) high specificity, 10
4the copy genomic dna does not have non-specific signal; (3) detection speed is fast, and whole testing process only needs to complete in 90 minutes.(4) provide a kind of new genetic expression method of calculation, record the numerical value C1 on β-tubulin III gene typical curve, detect the numerical value C2 of sample on reference gene β-actin typical curve, ask relative ratio=C1/C2, then relative ratio is taken to right logarithm, gene expression amount=ln (C1/C2).The method calculating is easy, methodological science is directly perceived.
The accompanying drawing explanation
Fig. 1 includes the process flow diagram flow chart of including in that Meta analyzes relevant β-random involving clinical study of tubulin III in.
Fig. 2 is the low expresser of β-tubulinIII and the high expression level person Meta parse forest analysis chart to the chemotherapeutic efficacy of taxanes or vinca/taxanes or vinca associating platinum class.
Fig. 3 is that the low expresser of β-tubulinIII and high expression level person analyze the funnel analysis chart to the Meta that accepts taxanes or vinca/taxanes or vinca associating platinum-based chemotherapy curative effect.
Fig. 4 forest analysis chart to taxanes or vinca/taxanes and the contrast of vinca associating platinum-based chemotherapy that is the low expresser of β-tubulinIII and high expression level person Aisa people and European.
Fig. 5 is β in reference group-tubulinIII gene expression amount height and low distribution plan.
Detailed Description Of The Invention
The invention provides a kind of highly sensitive, the real-time quantitative fluorescence PCR method of high-accuracy is measured method and the test kit of β-tubulin III genetic expression, and adopts the Meta-analysis analytical procedure to carry out determining of chemotherapy regimen.
With " Class III β-tubulin/ β-tubulin ", " Cancer " and " Chemotherapy ", by computer, PubMed, EMBASE, CBMdisc (CBM), CJFD (CNKI) and all places database database are retrieved.
Retrieve altogether 543 pieces of relevant articles, after reading exercise question and summary, got rid of 430 pieces and expressed and the chemotherapy document that it doesn't matter with β-tubulin III.Preliminary screening 113 pieces of pertinent literatures, through readable text, wherein have 26 pieces to express to β-tubulin III and clinical chemotherapy is studied relevant.Through reading screening, find that there is 11 pieces and meet inclusive criteria with β-tubulin III expression and clinical chemotherapy document again, in these 11 pieces of documents, have 7 pieces from Asia, 4 pieces from Europe.In the document screening process, document inclusive criteria (1) research and design: original research type is the Prospective Clinical comparative study; (2) research object: through tissue or cytopathology is made a definite diagnosis and without the cancer patients of operative treatment; (3) research contents: the relation of platinum-based chemotherapy curative effect is combined in the low expression of research β-tubulin III high expression level and β-tubulin III to taxanes or vinca/taxanes or vinca; (4) therapeutic evaluation adopts WHO standard, take objective remission rate fully alleviation+partial rcsponse (CR+PR) be treated effect.With Publication about Document, be not included into: (1) summary Journal of Sex Research and non-clinical study; (2) research object and intervening measure do not meet inclusion criteria; (3) do not provide enough detailed means of subsistence information, document is included process in as shown in Figure 1.
The collection of documents and materials, analyze and quality evalution: by two researchists, in strict accordance with inclusive criteria, screened, the Evaluation of Quality of Literature of including research in adopts Newcastle-Ottawa Scale (NOS) standard to carry out the quality evalution method.(Wells GA, Shea B, O ' Connell D, Peterson J, Welch V, Losos M, et al.The Newcastle-Ottawa Scale (NOS) for assessing the quality of non randomised studies in meta-analyses; 2003) evaluation system is by the selection of research object, and the comparability of research and result of study form: the high group of (1) expression amount and the low group of expression amount research object are selected (full marks 4 minutes); (2) comparability (full marks 2 minutes) of the high group of expression amount and the low group of expression amount research object; (3) evaluation of result (full marks 3 minutes).Through screening, finally there are 11 prospective clinical studyes to include Meta in and analyze (in Table 2), add up altogether case 534 people, comprise the low patient of expression of 256 routine β-tubulin III high expression level patient and 278 routine β-tubulin III, β-tubulin III high expression level patient to be associated with the efficiency that is associated with that efficiency is the low patient of expression of 20.7%, β-tubulinIII be 50.7%.Include 11 Prospective Clinical research essential characteristics of research in Table 3.
It is the effect statistic to the objective remission rate of solid tumor criterion that the present invention adopts the World Health Organization (WHO), adopt and merge odds ratio (Odds Ration, OR) and 95% credibility interval (Confidence internal, CI) as chemotherapeutic efficacy analytic statistics amount, to heterogeneity, if homogeneity is preferably arranged between result of study, adopt fixed-effect model (Fix effect); Otherwise adopt random-effect model analysis (Random effects); Above the data two-tailed test.
Meta analytical results: 11 pieces of documents including in are carried out to the Heterogeneity, heterogeneity: Chi
2=7.48, P=0.68, I
2=0% adopts fixed-effect model; Merging the OR value is 0.25,95% credibility interval 0.17-0.37, Z=6.93, P<0.00001, show that the low patient of expression of β-tubulin III and high expression level patient have very significant difference to the chemotherapeutic efficacy of taxanes or vinca/taxanes or vinca associating platinum class.Analytical results shows that the low patient of expression of β-tubulin III is more responsive to the chemotherapy of taxanes or vinca and taxanes and vinca associating platinum class, β-tubulin III high expression level patient has strong resistance to the chemotherapy of taxol or vinealeucoblastine(VLB)/taxol and vinealeucoblastine(VLB) associating platinum class, the forest analysis chart is shown in Fig. 2 as a result, and funnel figure as shown in Figure 3.
Adopt the Meta analytical procedure simultaneously, contrasted β-tubulin III gene high expression patient and the low expresser difference to taxanes or vinca/taxanes or vinca associating platinum-based chemotherapy susceptibility in Aisa people and European, the subgroup analytical results shows, Chi
2=0.04, P=0.83, I
2=0%, show that β-tubulinIII high expression level has identical susceptibility with low express in Aisa people and European to taxanes or vinca and taxanes or vinca associating platinum-based chemotherapy, two crowds do not have significant difference to the susceptibility of accepting taxanes or vinca and taxanes or vinca associating platinum-based chemotherapy.The comparative analysis forest map is as shown in 4.
Therefore, express the tumour of low-level β-tubulin III mRNA and can determine the chemotherapy of selecting based on taxanes or vinca/taxanes or vinca associating platinum class, tumour patient has longer lifetime.Can determine that without taxanes or vinca/taxanes or vinca associating platinum-based chemotherapy be suitable if express the tumour of high-level β-tubulin III mRNA.
Comprise that in mensuration β-tubulin III gene expression method is to implement chemotherapy early prognosis important foundation, the method sensitivity of current mensuration genetic expression is low, and poor specificity has affected the accuracy rate of measuring.The invention provides the measurement and calculation method of a kind of real-time quantitative fluorescence PCR technology for detection β based on special primer and probe-tubulin III genetic expression.The accuracy rate of applying this detection method mensuration can reach 99%, detects the susceptibility of sample and can hang down to 1%, and its whole mensuration process only needs to complete in 90 minutes.This detection method has that sensitivity is good, accuracy rate is high, high specificity, the characteristics such as convenient and swift, and its complete mensuration process is as embodiment.
Sample is tissue-derived: that takes from that 2010-2011 gives that my company detects does not pass through chemotherapy cancer patient tissue totally 65 examples, male 39 examples in 65 routine patients, female's 21 examples, gland cancer 54 examples wherein, squama cancer 11 examples.
Design of primers is with synthetic: according to the sequence β of GeneBank-tubulin III and house-keeping gene β-actin, carry out design of primers.Apply Premier 5.0 software design primer and the probes of Canadian Premier company, primer and probe sequence are as shown in table 1.
Pathological tissue RNA preparation: for fresh pathological tissue, under liquid nitrogen environment, the about 1g of clip left and right, smash rear use RNA to pieces and extract test kit (Qiagen, Blood & Tissue Kit) extract RNA.Concrete steps are pressed the operation instructions of test kit.For the paraffin-embedded tissue sample, adopt RNA to extract test kit (Qiagen, RNeasy FFPE kit) and extract RNA, concrete steps are pressed the operation instructions of test kit.Above-mentioned carried RNA is dissolved in Tris-HCl (10mmol/L, PH=8.0), and the RNA that uses UV spectrophotometer measuring to extract, require D
260nm/ D
280nmbetween 1.9-2.1, and read rna content.
CDNA is synthetic: adopt the synthetic cDNA of Xiamen Amoydx Bio-Pharmaceutical Technology Co., Ltd.'s test kit, get the RNA 1 μ g of extraction as reaction template; Add 0.04 μ L primer (50 μ mol/L) in reaction system; 0.04mM each dNTP; 5 μ L Buffer (PH=8.3); 3.75mM MgCL
2; 12.5mM DTT; 1 μ L RNase Inhibitor (40U/ μ L), supply 16 μ L with DEPC water.Then carry out according to the following steps reverse transcription reaction:
(1) get above-mentioned reverse transcription reaction mixed solution 16 μ L, M-MLV reversed transcriptive enzyme 1 μ l (200U/ μ L), add in aseptic centrifuge tube, mixes.
(2) add the RNA 3 μ l of testing sample, the RNA total amount is in 10ng-2 μ g scope.
(3) 42 ℃ are incubated 1 hour.
(4) 95 ℃ of insulations are placed on ice after 5 minutes immediately, centrifugal collection product, and the cDNA solution obtained is for pcr amplification, and it is standby that synthetic cDNA is placed on-70 ℃ of Refrigerator stores.
β-tubulin III cDNA is become to 4 concentration with house-keeping gene β-actin standard substance proportional diluted, take real-time quantitative fluorescence PCR to be increased, real-time quantitative fluorescence PCR 25 μ L reaction amplification systems are as follows:
Real-time PCR reactions condition: first stage: 1 circulation of 94 ℃ of 5min; Subordinate phase: 94 ℃ of 15S; 60 ℃ of 20S; 72 ℃ of 20S; 10 circulations; Phase III: 94 ℃ of 15S; 58 ℃ of 35S; 72 ℃ of 15S; 30 circulations; Carry out quantitative analysis according to the Ct value of amplification curve.
In the real-time quantitative fluorescence PCR reaction process, the probe that the present embodiment adopts be a kind of " fluorescence dicyclo probe " (Pat.No.200910300518.6), the double-stranded land of its circular part and probe interior can be with target sequence in conjunction with forming the more stable duplex of a kind of thermodynamics.The disappearance of dicyclo probe ring structure causes the generation of fluorescence, the dicyclo probe can be in this reaction, the target sequence mated is fully detected, and the power of its fluorescent signal can reflect the copy number of target sequence, thereby the detection sensitivity of making and accuracy rate are greatly enhanced.
Result is calculated and statistics: with β-tubulin III cDNA and house-keeping gene β-actin separately 4 gradient standard substance make respectively typical curve, require β-tubulin III and house-keeping gene β-actin relation conefficient between 0.97-1.00, between the logarithmic value of resulting Ct value and different concns standard substance, there is good linear relationship.
Record detects the numerical value C1 of sample on β-tubulin III gene typical curve respectively, detect the numerical value C2 of sample on reference gene β-actin typical curve, ask again relative ratio=C1/C2, then relative ratio is taken to right logarithm, be i.e. Y=ln (C1/C2).
Adopt SPSS 13.0 statistical softwares to carry out the cumulative frequency statistics to calculation result, adopt dichotomy that β-tubulin III genetic expression is divided into to low and high expression threshold value, if show as low the expression when expression level is less than or equal to 25% tantile, show as high expression level if express while being more than or equal to 75% tantile, calculation result is as in Table 4, and statistical distribution as shown in Figure 5.
In determining based on taxanes or vinca and taxanes or the scheme of vinca associating platinum-based chemotherapy medicine for treatment, low and the height of β-tubulin III gene expression dose be relative value be by the value with reference group relatively (as, Lord et al., Clin Cancer Res; 2002,2286-2291), if expression level is equal to or less than 25% tantile β in reference group-tubulin III expression level, show as that β-tubulin III is low to express; If expression level, higher than 75% tantile β in the reference group-tubulin III expression level, shows as β-tubulin III high expression level.The sample of reference group should be from the patient of the tumour of same type, and does not pass through any chemotherapy, and the analytical data of reference group should at least be greater than 20 experimenters' tumor sample.
Get and give in May, 2011 my company to detect gland cancer patient paraffin-embedded tissue sample 2 examples, be designated as patient A and patient B.Detection kit and the method described according to embodiment 1 are carried out β-tubulin III mRNA extraction, synthetic cDNA and real-time fluorescence PCR quantitative assay (experimental procedure is operated according to test kit specification sheets operation steps).With β-tubulin IIIcDNA and house-keeping gene β-actin separately 4 gradient standard substance make respectively typical curve, β-tubulin III and house-keeping gene β-actin relation conefficient are 0.98.Record detects the numerical value C1 of sample on β-tubulin III gene typical curve respectively, detects the numerical value C2 of sample on reference gene β-actin typical curve.
Using formula: Y=ln (C1/C2)
Calculate respectively two patients' β-tubulin III gene expression amount, calculation result is in Table 5.
The reference group of institute's calculated value and embodiment 1 is contrasted, the β of result demonstration patient A-tubulin III genetic expression is higher than reference group 75% tantile, and it is suitable therefore adopting the chemotherapy that does not contain taxanes or vinca and taxanes or vinca associating platinum class.The β of patient B-tubulin III genetic expression, lower than reference group 25% tantile, therefore adopts the chemotherapy regimen that comprises taxanes or vinca and taxanes or vinca associating platinum medicine to be advisable.
Above are only specific embodiments of the invention, but design concept of the present invention is not limited to this, allly utilizes this design to carry out the change of unsubstantiality to the present invention, all should belong to the behavior of invading protection domain of the present invention.
Table 2 is included the quality evalution table of Newcastle-Ottawa Scale (NOS) standard of 11 clinical studyes that Meta analyzes in
β in table 4 reference group when 25%, 50% and 75% minute position-tubulinIII genetic expression value and relative expression's value.
Table 5 pair wish is implemented the calculation result of the patient A of chemotherapy and the β that patient B carries out-tubulinIII determination of gene expression
Specification sheets Nucleotide and aminoacid sequence table
<110 > Xiamen Amoydx Bio-Pharmaceutical Technology Co., Ltd.
<120 > express for 'beta '-tubulin III primer, probe and the detection kit of measuring
<160>4
<210>1
<211>23
<212>DNA
<213 > artificial sequence
<400>1
tctactacaa?cgaggcctct?tct 23
<210>2
<211>25
<212>DNA
<213 > artificial sequence
<400>2
caaagatgaa?attgtcaggc?ctgaa 25
<210>3
<211>34
<212>DNA
<213 > artificial sequence
<400>3
agccacacca?gaatggctcg?aggcacgtac?ctcg 34
<210>4
<211>23
<212>DNA
<213 > artificial sequence
<400>4
ttgccggccc?cactctgacc?aaa 23
Claims (3)
1. for detection of primer and the probe of β-tubulin III genetic expression, comprising:
TUBB3-F TCTACTACAACGAGGCCTCTTCT
TUBB3-R CAAAGATGAAATTGTCAGGCCTGAA
TUBB3-P AGCCACACCAGAATGGCTCGAGGCACGTACCTCG
TUBB3-reverse transcription-TTGCCGGCCCCACTCTGACCAAA.
2. a test kit of measuring for measuring β-tubulin III mRNA, is characterized in that, this test kit comprises primer claimed in claim 1 and probe.
3. as claimed in claim 2 a kind ofly also comprise for the test kit of measuring β-tubulin III mRNA amount: reversed transcriptive enzyme, archaeal dna polymerase, damping fluid, wherein the Fluorescence PCR amplification system is as follows:
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110230606.0A CN102409087B (en) | 2011-08-11 | 2011-08-11 | Primer, probe and detection kit for determining beta-tubulin III gene expression |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110230606.0A CN102409087B (en) | 2011-08-11 | 2011-08-11 | Primer, probe and detection kit for determining beta-tubulin III gene expression |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102409087A CN102409087A (en) | 2012-04-11 |
| CN102409087B true CN102409087B (en) | 2014-01-01 |
Family
ID=45911426
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110230606.0A Active CN102409087B (en) | 2011-08-11 | 2011-08-11 | Primer, probe and detection kit for determining beta-tubulin III gene expression |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102409087B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103088124A (en) * | 2012-12-07 | 2013-05-08 | 周宏灏 | Kit and method for detecting expression level of TUBB3 (Tubulin B3) mRNA (messenger Ribonucleic Acid) |
| CN107385104B (en) * | 2017-09-21 | 2020-09-11 | 福建省农业科学院果树研究所 | Primer pair for screening reference genes in development process of wax apple fruits and application of primer pair |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2623445A1 (en) * | 2005-09-21 | 2007-03-29 | Ccc Diagnostics, Llc | Comprehensive diagnostic testing procedures for personalized anticancer chemotherapy (pac) |
| CN101424638A (en) * | 2006-09-27 | 2009-05-06 | 广东省人民医院 | Paclitaxel medicament curative effect predicting kit and application thereof |
| CN101671744A (en) * | 2009-02-24 | 2010-03-17 | 厦门艾德生物医药科技有限公司 | Probe for real-time detection of nucleic acid |
-
2011
- 2011-08-11 CN CN201110230606.0A patent/CN102409087B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN102409087A (en) | 2012-04-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Alluri et al. | Basal-like and triple-negative breast cancers: searching for positives among many negatives | |
| Wu et al. | Effectiveness of treatments for advanced non–small-cell lung cancer with exon 20 insertion epidermal growth factor receptor mutations | |
| Jiang et al. | Pathway alterations during glioma progression revealed by reverse phase protein lysate arrays | |
| Li et al. | Molecular prognostic factors of anaplastic oligodendroglial tumors and its relationship: a single institutional review of 77 patients from China | |
| Wei et al. | MicroRNAs as potential biomarkers for diagnosing cancers of central nervous system: a meta-analysis | |
| Vinall et al. | Expression of microRNAs in urinary bladder samples obtained from dogs with grossly normal bladders, inflammatory bladder disease, or transitional cell carcinoma | |
| Hou et al. | Expression of MECOM is associated with unfavorable prognosis in glioblastoma multiforme | |
| Ha et al. | Glioblastoma with oligodendroglial component represents a subgroup of glioblastoma with high prevalence of IDH1 mutation and association with younger age | |
| Zhou et al. | Over-expression of TOP2A as a prognostic biomarker in patients with glioma | |
| Zeng et al. | miR-17-5p-CXCL14 axis related transcriptome profile and clinical outcome in diffuse gliomas | |
| CN109679957A (en) | IncRNALNC_004208 and its detection reagent are preparing the application in glioma prognostic agent | |
| Larocca et al. | Overview of cutaneous T-cell lymphomas | |
| CN114075604A (en) | Glioblastoma prognosis prediction scoring model and application thereof in guiding clinical accurate diagnosis and treatment | |
| CN102409087B (en) | Primer, probe and detection kit for determining beta-tubulin III gene expression | |
| Lin et al. | Oxypalmatine regulates proliferation and apoptosis of breast cancer cells by inhibiting PI3K/AKT signaling and its efficacy against breast cancer organoids | |
| CN105256036A (en) | Kit for detecting lncARSR in serum and application of kit in detection of kidney cancer sunitinib drug resistance | |
| CN109576366A (en) | Purposes of the lnc-TALC as molecular marker in assessment glioblastoma TMZ chemotherapeutic efficacy and prognosis | |
| Kim et al. | Risk stratification of triple-negative breast cancer with core gene signatures associated with chemoresponse and prognosis | |
| CN108728533A (en) | The purposes of gene group and SNCA genes as the biomarker of 4 type medulloblastomas for medulloblastoma molecule parting | |
| CN107287345A (en) | Detection kit and TSEN34 clinical practices for the accurate diagnosis and treatment of acute myeloid leukemia | |
| Wang et al. | Identification of CD20, ECM, and ITGA as biomarkers for osteosarcoma by integrating transcriptome analysis | |
| Oh et al. | Lrrc17 is linked to prognosis of ovarian cancer through a p53-dependent anti-apoptotic function | |
| Yang et al. | Identification of gene markers associated with metastasis in clear cell renal cell carcinoma | |
| CN106244675A (en) | Adult's AML risk factor layering and clinical prognosis assess test kit and the application of CPNE3 | |
| Zhang et al. | A novel miR-7156-3p-HOXD13 axis modulates glioma progression by regulating tumor cell stemness |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C56 | Change in the name or address of the patentee | ||
| CP03 | Change of name, title or address |
Address after: 361000, No. 39, Ding Shan Road, Haicang District, Fujian, Xiamen Patentee after: AMOY DIAGNOSTICS CO., LTD. Address before: 361000 Fujian Province, Xiamen City Haicang Xinyang Industrial Zone Weng Kok Road No. 289 Chong Building 5 floor Patentee before: Amoy Diagnostics Co., Ltd. |
|
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20201214 Address after: Room 202, building 3, 138 xinjunhuan Road, Minhang District, Shanghai Patentee after: Shanghai Xiawei medical laboratory Co.,Ltd. Address before: No. 39, Haicang Ding Shan Road, Haicang District, Xiamen, Fujian Patentee before: Xiamen Aide Biomedical Technology Co.,Ltd. |