CN102409087A - Primer, probe and detection kit for determining beta-tubulin III gene expression - Google Patents
Primer, probe and detection kit for determining beta-tubulin III gene expression Download PDFInfo
- Publication number
- CN102409087A CN102409087A CN2011102306060A CN201110230606A CN102409087A CN 102409087 A CN102409087 A CN 102409087A CN 2011102306060 A CN2011102306060 A CN 2011102306060A CN 201110230606 A CN201110230606 A CN 201110230606A CN 102409087 A CN102409087 A CN 102409087A
- Authority
- CN
- China
- Prior art keywords
- tubulin iii
- tubulin
- primer
- taxanes
- vinca
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a primer, probe and detection kit for determining beta-tubulin III expression. The primers and probes for determining beta-tubulin III gene expression include TUBB3-F TCTACTACAACGAGGCCTCTTCT, TUBB3-R CAAAGATGAAATTGTCAGGCCTGAA, TUBB3-P AGCCACACCAGAATGGCTCGAGGCACGTACCTCG and TUBB3-reverse transcription-TTGCCGGCCCCACTCTGACCAAA. The detection kit can measure the expression level of beta-tubulin III mRNA and provide a method for predicting possible resistance to treatment based on paclitaxels or vinblastines for the subjects.
Description
Invention field
The present invention relates to biological technical field.Be specifically related to use quantitative fluorescence PCR to confirm genetic expression and a kind of primer, probe, test kit and the detection method that are used to detect 'beta '-tubulin III expression of 'beta '-tubulin III (β-tubulin III) at tumour cell.
Background of invention
Tumour be the normal cell of body under various carcinogenic factors, some cells of local organization lose the normal regulation to its growth on gene level, cause its clonal abnormality hyperplasia to form.When tumour cell continues high-speed rapid growth and division, grow and be in runaway condition, can invade healthy tissues, and usually transfer to position growth away from its origin, will form malignant tumour is cancer.When tumour formed, clinical target was to hope optionally kill tumor cell, alleviates simultaneously in therapeutic process, to the infringement of organism normal cell.
Chemotherapy is meant applied chemistry pharmacological agent method for cancer.Chemotherapeutics can kill cancer cell, the growth of anticancer and breeding, thereby the purpose that arrives treatment or cure, and chemotherapy also can be killed and wounded normal cell when killing and wounding cancer cells, produce toxic side effect.Chemotherapy of tumors is one of main means of present clinical treating malignant tumor as a kind of systemic treatment.Can eliminate primary tumors and the remote cancer cells that shifts, therefore in oncotherapy, occupy very consequence.In the chemotherapeutics of developing at present; Mainly comprise anti-microtubule class medicine, like taxol, Docetaxel, vinealeucoblastine(VLB) and vinorelbine etc., it mainly acts on the cell microtubule; Form through influencing spindle body, thus one type of wide spectrum chemotherapeutics of inhibition cell mitogen.Another kind of DNA for the infringement cell, like cis-platinum and carboplatin class medicine, these medicines are commonly referred to as the genotoxicity medicine.The chemotherapeutics of other type is the RNA biosynthesizing, protein synthesis and function, and like 5 FU 5 fluorouracil, gemcitabine, methotrexate class medicine, these are commonly referred to as antimetabolite.Yet; The curative effect of chemotherapeutics is relevant with the patient individual difference; These differences comprise patient to the sensitivity of chemotherapeutics and different to the tolerance degree of medicine, same patient, and some chemotherapeutics has better curative effect; Other medicines are weak curative effect then, even some medicine can produce serious toxic side effect.
Existing research shows that some genetic expression and chemotherapeutics have certain relation to the susceptibility of function of tumor and the tolerance degree of medicine in the tumour cell.Different tumour cells are different to the susceptibility with a kind of medicine, and same tumour cell also there are differences the reaction of different pharmaceutical.Thereby, in chemotherapy administration process, to susceptibility or the evaluation of resistance determinative and the effective tool that detection becomes the individual chemotherapy of design of every kind of medicine.
Anti-cell microtubule class that has been found that and widely used chemotherapeutics are taxanes and vinca, and taxanes and vinca chemotherapeutics mainly act on the micro-tubular structure that constitutes cytoskeleton in the tumour cell.Cell microtubule (Microtubule) is a cytoskeleton important in the eukaryotic cells, is vertically to arrange the cylindrical-shaped structure body that constitutes hollow by 13 protofibrils, and every protofibril is that the dimer that tubulin α and β form is formed.Tubulin α and β are serving as and are keeping the cellular form function, and the transfer cell signal information is participated in critical functions such as mitotic division.(Giannakakou P, Sackett DL, Fojo T.Tubulin/Microtubules:still a promising target for new chemotherapeutic agents.J Natl Cancer Inst, 2000; 92; 3182-3.) exist 6 kinds of beta tubulin phenogens among the human cell, wherein 3 type 'beta '-tubulins and the chemotherapy drug susceptibility that acts on microtubule have confidential relation.
The taxanes chemotherapeutics acts on the tumour cell G2/M phase, mainly through combining with β-tubulin III the 31st amino acids residue and 217-231 amino acids residue, lures tubulin polymerization into, suppresses it and separates collecting process.Vascular bundle can not be interconnected with microtubule organizing center, will block in G2/M the phase cell cycle, cause tumour cell mitotic division unusual or stop, making tumour cell can't continue division and dead.(Seve P, Dumontet C.Is class III beta-tubulin a predictive factor in patient receiving tubulin-binding agents? Lancet Oncol 2008; 9:168-75) similar with Japanese yew based chemotherapy medicine; The vinca chemotherapeutics is the 175-213 amino-acid residue that acts on β-tubulin III; Influence microtubule and form the dimeric formation of stylish tubulin; Make the precursor bending of the dimer protein of new formation, can not prolong, thereby the blocking-up microtubule polymerization becomes spindle body; Tumoricidal mitotic division; Make microtubule and spindle body lose normal function and cause necrocytosis (Gan P, Pasquier E, Kavallris M.Class III-tubulin mediates sensitivity to chemotherapeutic drugs in non-small cell lung cancer.Cancer Res 2007; 67:9356-63.).
Existing research report, there are close ties in the expression level of β-tubulin III and taxanes chemotherapeutics and vinca chemotherapeutical medicine curative effect.(Seve P such as Seve; Mackey J; Isaac S, Tredan O, Souquet PJ; PerolM, et al.Class III-Tubulin expression intumor cells predicts response and outcome inpatients with non-small cell lung cancer receiving paclitaxel.Mol Cancer Ther 2005; 4:2001-7.) be research object with 47 routine nonsmall-cell lung cancer patients; The treatment of discovery taxanes chemotherapeutics in β-tubulin III high expression level person is efficient to be 12.5%; And in the low expresser of β-tubulin III its treatment efficient be 61.9%, the nothing recurrence lifetime that β-tubulin III is low expresses the patient and the person that all obviously is longer than the high expression level total lifetime.People such as Rosell (Rosell R; Scagliotti G; Danenberg KD, Lord RV, Bepler G; Novell O, et al.Transcripts in pretreatment biopsies from a three-arm randomized trial in metastatic non-small-cell lungcancer.Oncogene 2003; 22:3548-52.) research detected the mRNA expression level of β among the nonsmall-cell lung cancer patient-tubulin III gene; The result finds in the patient who accepts vinealeucoblastine(VLB)/cisplatin chemotherapy scheme; The low patient who expresses β-tubulin III mRNA has higher chemotherapy efficient; Have the trend of tangible prolongation its lifetime, indicated that the expression level of β-tubulin III can be used as the important indicator of prediction nonsmall-cell lung cancer patient to the vinealeucoblastine(VLB) chemotherapeutic efficacy.Therefore, β-tubulin III expression levels in tumour can be used for confirming whether taxanes chemotherapeutics and vinca chemotherapeutics can effectively treat the main prognosis factor of cancer.
Clinical cost benefit (Cost effectiveness) analysis and research show (A Clegg; DA Scott, P Hewitson, M Sidhu; N Waugh.Clinical and cost effectiveness of paclitaxel; Docetaxel, gemcitabine, and vinorelbine in non-small cell lung cancer:a systematic review.Thorax 2002; 57:20-8.); Adopt taxanes or vinca chemotherapeutics to treat the lifetime that lung cancer can obviously increase tumour patient, and the prolongation of this lifetime does not show the decline of life quality (Quality of Life) and the increase of medical expense expenditure.Discover that it is that the scheme of treatment is very benefited that patients with lung cancer is accepted with taxanes or vinca and taxanes or vinca associating platinum-based chemotherapy medicine.β-tubulin III gene conduct and taxanes and the closely related gene of vinca chemotherapy drug susceptibility; Therefore; Before implementing chemotherapy, detect for increasing patient's lifetime for β-tubulin III genetic expression; Improve the treatment quality of life, reduce the patient treatment cost, have very important meaning.
At present; The measuring method that comprises the detection by quantitative genetic expression of β-tubulin III in being expressed in is one of focus of molecular biosciences field of medicaments research; The sensitivity of its detection by quantitative gene expression method; The method of calculation of accuracy and measurement genetic expression height enjoy molecular biosciences medical research personnel to pay close attention to.Up to now, still there is not bigger progress in this technical field.Therefore, needs are a kind of especially can be efficiently quick, high-accuracy, and the detection method that highly sensitive quantitate gene is expressed and a kind of easy can intuitively be weighed genetic expression method of calculation just, so that the early stage prognosis of oncotherapy is provided.
The present invention provides the detection method of the β-tubulin III mRNA expression amount in a kind of patient's of detection tumour cell; Thereby assess the β-tubulin III expression level in various paraffin embeddings and the flesh tissue, with the possible resistance of prediction tumour patient to taxanes or vinca and taxanes or the treatment of vinca associating platinum medicine.It is a kind of efficient that the present invention provides simultaneously, high-accuracy, highly sensitive real-time quantitative fluorescence PCR test method and detection kit and a kind of new method of calculation of weighing the genetic expression height.
Summary of the invention
One aspect of the present invention provides the method for β in assess and determine paraffin embedding and the flesh tissue cell-tubulin III mRNA expression level.
The present invention provides the method for a kind of definite patient's chemotherapy regimen on the other hand, comprises isolation of RNA from neoplasmic tissue sample; β in the working sample-tubulin III expression of gene level; The reference group of β-tubulin III expression of gene level and β-tubulin III gene compares; Compare definite chemotherapy regimen based on β-tubulin III expression of gene and reference group expression level.If said β-tubulin III is expressed 25% tantile that is less than or equal to β-tubulin III expression level; The chemotherapeutics of selecting so to comprise taxanes or vinca and taxanes or vinca associating platinum class is treated; And if β-tubulin III expression level is higher than 75% tantile, the chemotherapy of selecting so not contain taxanes or vinca and taxanes or vinca associating platinum class is advisable.
The present invention is provided for measuring the β-primer of tubulin genetic expression and the sequence of probe and sees table 1 in embodiments.
Table 1 primer and probe sequence
The present invention provides the test kit that is used for measuring the tissue sample β-tubulin III genetic expression from the patient on the other hand.In embodiments, saidly be used to measure β-tubulin III and express test kit and comprise: Oligonucleolide primers, with the forward primer of β-tubulin III hybridization; Reversed transcriptive enzyme; Archaeal dna polymerase, damping fluid and Nucleotide, wherein fluorescent PCR reaction amplification system is following:
The present invention is provided as the experimenter and estimates suitable embolic chemotherapy on the other hand.This method comprises the chemotherapy regimen that adopts real-time quantitative fluorescence PCR to measure the β-tubulin III gene expression dose in the tumor sample and confirm based on β-tubulin III gene expression dose, and this method may further comprise the steps:
(1) collection cancer patients's serum sample extracts its mRNA;
(2) design of PCR primer and probe is with synthetic, and primer and probe sequence are seen table 1;
(3) separation of total mRNA preparation;
(4) total cDNA's is synthetic;
(5) carry out the real-time fluorescence quantitative PCR amplification;
(6) calculate the formula of gene expression amount according to the Ct value.Comprise: the numerical value C1 on record β-tubulin III gene typical curve; The numerical value C2 of test sample on internal control gene β-actin typical curve; Ask relative ratio=C1/C2 again, then relative ratio is taken from right logarithm, that is: gene expression amount=ln (C1/C2).
Employed anti-cell tubulin based chemotherapy agent taxanes and vinca among the present invention comprise Taxan (taxanes), taxol (paclitaxel), many Xi Tasai (docetaxel), reach vinealeucoblastine(VLB) (vinblastine), vincristine(VCR) (vincristine), vinorelbine (vinorelbine), vinca alkaloids (vinca alkaloids), vindesine (vindesine) and Vinflunine (vinflunine).
Platiniferous chemotherapeutics used in the present invention comprises cis-platinum (cisplatin), carboplatin (carboplatin), and oxaliplatin (oxaliplatin).
Test kit beneficial effect of the present invention is: adopt based on Auele Specific Primer and novel bicyclic probe technique, set up PCR in real time and detected the detection method that β-tubulin III is expressed, this method: (1) is highly sensitive, can detect the mutant DNA that is low to moderate 15 copies; (2) high specificity, 10
4The copy genomic dna does not have non-special signal; (3) detection speed is fast, and whole testing process only needed to accomplish in 90 minutes.(4) a kind of new genetic expression method of calculation are provided; Promptly write down the numerical value C1 on β-tubulin III gene typical curve; The numerical value C2 of test sample on internal control gene β-actin typical curve; Ask relative ratio=C1/C2, then relative ratio is taken from right logarithm, gene expression amount=ln (C1/C2).This method calculating is easy, methodological science is directly perceived.
Description of drawings
Fig. 1 be include in Meta analyze relevant β-tubulin III at random the clinical study document include process flow diagram flow chart in.
Fig. 2 is low expresser of β-tubulin III and the Meta analysis forest analysis of high expression level person to the chemotherapeutic efficacy of taxanes or vinca/taxanes or vinca associating platinum class.
Fig. 3 is that low expresser of β-tubulin III and high expression level person analyze the funnel analysis to the Meta that accepts taxanes or vinca/taxanes or vinca associating platinum-based chemotherapy curative effect.
Fig. 4 is the low expresser of β-tubulin III and the high expression level person unites the correlated forest analysis of platinum-based chemotherapy Aisa people and European to taxanes or vinca/taxanes and vinca.
Fig. 5 is the high and low distribution plan of β in the reference group-tubulin III gene expression amount.
Detailed Description Of The Invention
The invention provides a kind of highly sensitive, the real-time quantitative fluorescence PCR method of high-accuracy is measured the method and the test kit of β-tubulin III genetic expression, and adopts the Meta-analysis analytical procedure to carry out confirming of chemotherapy regimen.
DBs such as PubMed, EMBASE, CBMdisc (CBM), CJFD (CNKI) and all places DB are retrieved through computingmachine with " Class III β-tubulin/ β-tubulin ", " Cancer " and " Chemotherapy ".
Retrieve 543 pieces of relevant articles altogether, after reading exercise question and summary, got rid of 430 pieces with β-expression of tubulin III and chemotherapy document that it doesn't matter.Preliminary screening 113 pieces of pertinent literatures, through readable text, wherein have 26 pieces to express with β-tubulin III and to study relevant with clinical chemotherapy.Again through reading screening, find to have 11 pieces to express with β-tubulin III and the clinical chemotherapy document meets the standard of including in, in these 11 pieces of documents, there are 7 pieces from the Asia, 4 pieces from Europe.In the document screening process, document is included standard (1) research and design in: original research type is perspective clinical control research; (2) research object: through tissue or cytopathology is made a definite diagnosis and without the cancer patients of operative treatment; (3) research contents: the low relation of expressing taxanes or vinca/taxanes or vinca associating platinum-based chemotherapy curative effect of research β-tubulin III high expression level and β-tubulin III; (4) WHO standard is adopted in therapeutic evaluation, with objective remission rate promptly fully alleviations+part alleviation (CR+PR) serve as treat efficient.Following document is not included in: (1) summary Journal of Sex Research and non-clinical study; (2) research object and intervening measure do not meet inclusion criteria; (3) enough detailed means of subsistence information is not provided, it is as shown in Figure 1 that document is included process in.
The collection of documents and materials is analyzed and quality evalution: screened in strict accordance with the standard of including in by two researchists, include the document quality evalution of research in and adopt Newcastle-Ottawa Scale (NOS) standard to carry out the quality evalution method.(Wells GA, Shea B, O ' Connell D; Peterson J; Welch V, Losos M, et al.The Newcastle-Ottawa Scale (NOS) for assessing the quality of non randomised studies in meta-analyses; 2003) evaluation system is by the selection of research object, and the comparability of research and result of study are formed: high group of (1) expression amount and the low group of expression amount research object are selected (full marks 4 minutes); (2) comparability (full marks 2 minutes) of high group of expression amount and the low group of expression amount research object; (3) evaluation of result (full marks 3 minutes).Through screening; There are 11 prospective clinical studyes to include Meta at last and analyze (seeing table 2); Add up case 534 people altogether; Comprise the low patient of expression of 256 routine β-tubulin III high expression level patient and 278 routine β-tubulin III, β-tubulin III high expression level patient's the efficient that is associated with is 20.7%, and the low efficient that is associated with of expressing the patient of β-tubulin III is 50.7%.Include 11 perspective clinical study essential characteristics of research in and see table 3.
It is the effect statistic to the objective remission rate of solid tumor criterion that the present invention adopts The World Health Organization (WHO); Adopt and merge odds ratio (Odds Ration; OR) and (Confidence internal is CI) as chemotherapeutic efficacy analytic statistics amount, to heterogeneity in 95% credibility interval; If homogeneity is preferably arranged between result of study, adopt fixed-effect model (Fix effect); Otherwise adopt random-effect model analysis (Random effects); Above The data two-tailed test.
The Meta analytical results: 11 pieces of documents to including in carry out The Heterogeneity, heterogeneity: Chi
2=7.48, P=0.68, I
2=0% adopts fixed-effect model; Merging the OR value is 0.25; 95% credibility interval 0.17-0.37; Z=6.93, P＜0.00001 shows that low patient of expression of β-tubulin III and high expression level patient have very significant difference to the chemotherapeutic efficacy of taxanes or vinca/taxanes or vinca associating platinum class.Analytical results shows that the low patient of expression of β-tubulin III is responsive to the chemotherapy of taxanes or vinca and taxanes and vinca associating platinum class; β-tubulin III high expression level patient has strong resistance to the chemotherapy of taxol or vinealeucoblastine(VLB)/taxol and vinealeucoblastine(VLB) associating platinum class; The forest analysis is seen Fig. 2 as a result, and funnel figure is as shown in Figure 3.
Adopt the Meta analytical procedure simultaneously; Contrasted β-tubulin III gene high expression patient and low expresser in Aisa people and European to taxanes or vinca/taxanes or vinca associating platinum-based chemotherapy sensitivity difference; The subfraction analysis result shows, Chi
2=0.04, P=0.83, I
2=0%; Show that β-tubulin III high expression level has identical susceptibility with low be expressed among Aisa people and the European to taxanes or vinca and taxanes or vinca associating platinum-based chemotherapy, two crowds unite the susceptibility of platinum-based chemotherapy and do not have significant difference accepting taxanes or vinca and taxanes or vinca.The comparative analysis forest map is shown in 4.
Therefore, express the tumour of low-level β-tubulin III mRNA and can confirm to select the chemotherapy based on taxanes or vinca/taxanes or vinca associating platinum class for use, tumour patient has longer lifetime.Can confirm not have taxanes or vinca/taxanes or vinca associating platinum-based chemotherapy for suitable if express the tumour of high-level β-tubulin III mRNA.
Comprise that in mensuration β-tubulin III gene expression method is to implement the early stage prognosis important foundation of chemotherapy, the method sensitivity of present mensuration genetic expression is low, and poor specificity has influenced the accuracy rate of measuring.The present invention provides the mensuration and the method for calculation of a kind of real-time quantitative fluorescence PCR technology for detection β based on special primer and probe-tubulin III genetic expression.The accuracy rate of using this detection method mensuration can reach 99%, detects the susceptibility of sample and can hang down to 1%, and its whole mensuration process only needed to accomplish in 90 minutes.This detection method has that sensitivity is good, accuracy rate is high, high specificity, characteristics such as convenient and swift, mensuration process such as embodiment that it is complete.
Sample tissue source: that takes from that 2010-2011 gives that my company detects does not pass through chemotherapy cancer patient tissue totally 65 examples, male 39 examples among the 65 routine patients, women 21 examples, gland cancer 54 examples wherein, squama cancer 11 examples.
Design of primers is with synthetic: sequence β-tubulin III and house-keeping gene β-actin according to GeneBank carry out design of primers.Use the Premier 5.0 software design primer and the probes of Canadian Premier company, primer and probe sequence are as shown in table 1.
Pathological tissue RNA preparation:, under liquid nitrogen environment, about the about 1g of clip, smash the back to pieces and use RNA to extract test kit (Qiagen, Blood & Tissue Kit) extraction RNA for fresh pathological tissue.Concrete steps are pressed the operation instructions of test kit.For the paraffin-embedded tissue sample, adopt RNA to extract test kit (Qiagen, RNeasy FFPE kit) and extract RNA, concrete steps are pressed the operation instructions of test kit.The above-mentioned RNA that carries is dissolved in Tris-HCl, and (10mmol/L, PH=8.0), the RNA that uses UV spectrophotometer measuring to extract requires D
260nm/ D
280nmBetween 1.9-2.1, and read rna content.
CDNA is synthetic: adopt the synthetic cDNA of Xiamen Amoydx Bio-Pharmaceutical Technology Co., Ltd.'s test kit, the RNA 1 μ g that gets extraction is as reaction template; In reaction system, add 0.04 μ L primer (50 μ mol/L); 0.04mM each dNTP; 5 μ L Buffer (PH=8.3); 3.75mM MgCL
212.5mM DTT; 1 μ L RNase Inhibitor (40U/ μ L) supplies 16 μ L with DEPC water.Carry out reverse transcription reaction then according to the following steps:
(1) get above-mentioned reverse transcription reaction mixed solution 16 μ L, M-MLV reversed transcriptive enzyme 1 μ l (200U/ μ L) adds in the aseptic centrifuge tube mixing.
(2) the RNA 3 μ l of adding testing sample, the RNA total amount is in 10ng-2 μ g scope.
(3) 42 ℃ are incubated 1 hour.
(4) 95 ℃ of insulations place on ice after 5 minutes immediately, centrifugal collection product, and the cDNA solution that obtains is used for pcr amplification, and synthetic cDNA is placed on-70 ℃ of refrigerators and preserves subsequent use.
β-tubulin III cDNA is become 4 concentration with house-keeping gene β-actin standard substance proportional diluted, take real-time quantitative fluorescence PCR to increase, real-time quantitative fluorescence PCR 25 μ L reaction amplification system is following:
Real-time PCR reactions condition: fs: 1 circulation of 94 ℃ of 5min; Subordinate phase: 94 ℃ of 15S; 60 ℃ of 20S; 72 ℃ of 20S; 10 circulations; Phase III: 94 ℃ of 15S; 58 ℃ of 35S; 72 ℃ of 15S; 30 circulations; Ct value according to amplification curve is carried out quantitative analysis.
In the real-time quantitative fluorescence PCR reaction process; The probe that present embodiment adopts be a kind of " fluorescence dicyclo probe " (Pat.No.200910300518.6), the double-stranded land of its circular part and probe interior can combine to form the more stable duplex of a kind of thermodynamics with target sequence.The disappearance of dicyclo probe ring structure causes the generation of fluorescence; The dicyclo probe can be in this reaction; The target sequence that matees is fully detected, and the power of its fluorescent signal can reflect the copy number of target sequence, thereby the detection sensitivity of making and accuracy rate are greatly enhanced.
The result calculates and statistics: with β-tubulin III cDNA and house-keeping gene β-actin separately 4 gradient standard substance make typical curve respectively; Require β-tubulin III and house-keeping gene β-actin relation conefficient between 0.97-1.00, have good linear relationship between the logarithmic value of resulting Ct value and different concns standard substance.
Write down the numerical value C1 of test sample on β-tubulin III gene typical curve respectively; The numerical value C2 of test sample on internal control gene β-actin typical curve; Ask relative ratio=C1/C2 again, then relative ratio is taken from right logarithm, be i.e. Y=ln (C1/C2).
Adopt SPSS 13.0 statistical softwares that calculation result is carried out the cumulative frequency statistics; Adopt dichotomy that β-tubulin III genetic expression is divided into low and high expression threshold value; If expression level shows as low the expression when being less than or equal to 25% tantile; If show as high expression level when expressing more than or equal to 75% tantile, calculation result is as seeing table 4, and statistical distribution is as shown in Figure 5.
In confirming based on taxanes or vinca and taxanes or the scheme of vinca associating platinum-based chemotherapy medicine for treatment; Low and the height of β-tubulin III gene expression dose be relative value be through with the value of reference group relatively (as; Lord et al., Clin Cancer Res; 2002,2286-2291),, show as the low expression of β-tubulin III if expression level is equal to or less than the 25% tantile β-tubulin III expression level in the reference group; If expression level is higher than the 75% tantile β-tubulin III expression level in the reference group, show as β-tubulin III high expression level.The sample of reference group should be from the patient of the tumour of same type, and does not pass through any chemotherapy, the analytical data of reference group should be at least greater than 20 experimenters' tumor sample.
Embodiment 2
Get and give in May, 2011 my company to detect gland cancer patient paraffin-embedded tissue sample 2 examples, be designated as patient A and patient B.Carry out β-tubulin III mRNA extraction, synthetic cDNA and real-time fluorescence PCR quantitatively determined (experimental procedure is operated according to test kit specification sheets operation steps) according to embodiment 1 said detection kit and method.With β-tubulin III cDNA and house-keeping gene β-actin separately 4 gradient standard substance make typical curve respectively, β-tubulin III and house-keeping gene β-actin relation conefficient are 0.98.Write down the numerical value C1 of test sample on β-tubulin III gene typical curve respectively, the numerical value C2 of test sample on internal control gene β-actin typical curve.
Using formula: Y=ln (C1/C2)
Calculate β-tubulin III gene expression amount of two patients respectively, calculation result is seen table 5.
The reference group of institute's calculated value and embodiment 1 is compared; The result shows that β-tubulin III genetic expression of patient A is higher than reference group 75% tantile, therefore adopts the chemotherapy that does not contain taxanes or vinca and taxanes or vinca associating platinum class for suitable.The β of patient B-tubulin III genetic expression is lower than reference group 25% tantile, therefore adopts the chemotherapy regimen that comprises taxanes or vinca and taxanes or vinca associating platinum medicine to be advisable.
Above-mentionedly be merely specific embodiment of the present invention, but design concept of the present invention is not limited thereto, allly utilizes this design that the present invention is carried out the change of unsubstantiality, all should belong to the behavior of invading protection domain of the present invention.
Table 2 is included the quality evalution table of Newcastle-Ottawa Scale (N0S) standard of 11 clinical studyes that Meta analyzes in
β in table 4 reference group when 25%, 50% and 75% fen position-tubulin III genetic expression value and relative expression's value.
Table 5 pair desire is implemented the patient A of chemotherapy and the calculation result of β-tubulin III determination of gene expression that patient B carries out
Claims (5)
1. be used to detect the primer and the probe of β-tubulin III genetic expression, comprise:
TUBB3-F?TCTACTACAACGAGGCCTCTTCT
TUBB3-R?CAAAGATGAAATTGTCAGGCCTGAA
TUBB3-P?AGCCACACCAGAATGGCTCGAGGCACGTACCTCG
TUBB3-reverse transcription-TTGCCGGCCCCACTCTGACCAAA.
2. a test kit that is used to measure β-tubulin III mRNA amount is characterized in that this test kit comprises described primer of claim 1 and probe.
3. the primer of the 'beta '-tubulin III mRNA that is used to increase; It is characterized in that: substantially the same with the described primer sequence of claim 2; Described sequence is substantially the same be meant under stringent condition with the nucleotide pair of target hybridization than the time, the identical nucleotide fragments of Nucleotide more than 70% is arranged.
4. as claimed in claim 2ly a kind ofly be used to measure the PCR reaction kit that 'beta '-tubulin III mRNA expresses and also comprise: reversed transcriptive enzyme, archaeal dna polymerase, damping fluid, wherein fluorescent PCR reaction amplification system is following:
5. be used for confirming the method for β-tubulin III gene expression amount, said method comprises:
(a) separating mRNA from paraffin-embedded tissue or flesh tissue;
(b) by the synthetic cDNA of isolating mRNA;
(c) amount of β in the working sample-tubulin III mRNA;
(d) calculating comprises the calculation formula of the gene expression amount of β-tubulin III, and the described calculation formula that is used to calculate the gene expression amount that comprises β-tubulin III comprises:
Numerical value C1 on record β-tubulin III gene typical curve, the numerical value C2 of test sample on internal control gene β-actin typical curve asks relative ratio=C1/C2 again, then relative ratio taken from right logarithm, that is: gene expression amount=ln (C1/C2).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110230606.0A CN102409087B (en) | 2011-08-11 | 2011-08-11 | Primer, probe and detection kit for determining beta-tubulin III gene expression |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110230606.0A CN102409087B (en) | 2011-08-11 | 2011-08-11 | Primer, probe and detection kit for determining beta-tubulin III gene expression |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102409087A true CN102409087A (en) | 2012-04-11 |
| CN102409087B CN102409087B (en) | 2014-01-01 |
Family
ID=45911426
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110230606.0A Active CN102409087B (en) | 2011-08-11 | 2011-08-11 | Primer, probe and detection kit for determining beta-tubulin III gene expression |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102409087B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103088124A (en) * | 2012-12-07 | 2013-05-08 | 周宏灏 | Kit and method for detecting expression level of TUBB3 (Tubulin B3) mRNA (messenger Ribonucleic Acid) |
| CN107385104A (en) * | 2017-09-21 | 2017-11-24 | 福建省农业科学院果树研究所 | For screening primer pair and its application of wax-apple Fruit Development Process reference gene |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007035842A2 (en) * | 2005-09-21 | 2007-03-29 | Ccc Diagnostics, Llc | Comprehensive diagnostic testing procedures for personalized anticancer chemotherapy (pac) |
| CN101424638A (en) * | 2006-09-27 | 2009-05-06 | 广东省人民医院 | Paclitaxel medicament curative effect predicting kit and application thereof |
| CN101671744A (en) * | 2009-02-24 | 2010-03-17 | 厦门艾德生物医药科技有限公司 | Probe for real-time detection of nucleic acid |
-
2011
- 2011-08-11 CN CN201110230606.0A patent/CN102409087B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007035842A2 (en) * | 2005-09-21 | 2007-03-29 | Ccc Diagnostics, Llc | Comprehensive diagnostic testing procedures for personalized anticancer chemotherapy (pac) |
| CN101424638A (en) * | 2006-09-27 | 2009-05-06 | 广东省人民医院 | Paclitaxel medicament curative effect predicting kit and application thereof |
| CN101671744A (en) * | 2009-02-24 | 2010-03-17 | 厦门艾德生物医药科技有限公司 | Probe for real-time detection of nucleic acid |
Non-Patent Citations (2)
| Title |
|---|
| 《Lancet Oncology》 20080229 Pascal Sève等 Is class III beta-tubulin a predictive factor in patients receiving tubulin-binding agents? 第9卷, * |
| PASCAL SÈVE等: "Is class III β-tubulin a predictive factor in patients receiving tubulin-binding agents?", 《LANCET ONCOLOGY》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103088124A (en) * | 2012-12-07 | 2013-05-08 | 周宏灏 | Kit and method for detecting expression level of TUBB3 (Tubulin B3) mRNA (messenger Ribonucleic Acid) |
| CN107385104A (en) * | 2017-09-21 | 2017-11-24 | 福建省农业科学院果树研究所 | For screening primer pair and its application of wax-apple Fruit Development Process reference gene |
| CN107385104B (en) * | 2017-09-21 | 2020-09-11 | 福建省农业科学院果树研究所 | Primer pair for screening reference genes in development process of wax apple fruits and application of primer pair |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102409087B (en) | 2014-01-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Witkiewicz et al. | Targeting the vulnerability of RB tumor suppressor loss in triple-negative breast cancer | |
| Chang et al. | EZH2 promotes expansion of breast tumor initiating cells through activation of RAF1-β-catenin signaling | |
| Alluri et al. | Basal-like and triple-negative breast cancers: searching for positives among many negatives | |
| Broderick et al. | Mutations of PIK3CA in anaplastic oligodendrogliomas, high-grade astrocytomas, and medulloblastomas | |
| Pizer et al. | The potential impact of tumour biology on improved clinical practice for medulloblastoma: progress towards biologically driven clinical trials | |
| Li et al. | Molecular prognostic factors of anaplastic oligodendroglial tumors and its relationship: a single institutional review of 77 patients from China | |
| CN102399772A (en) | Preparation method for probes related to breast cancer molecular markers and application of same | |
| CN108342482B (en) | Glioblastoma marker, application thereof and kit | |
| Ha et al. | Glioblastoma with oligodendroglial component represents a subgroup of glioblastoma with high prevalence of IDH1 mutation and association with younger age | |
| Wallace et al. | Detection of the bcl-2 t (14; 18) translocation and proto-oncogene expression in primary intraocular lymphoma | |
| Ting et al. | Clinical significance of aberrant microRNAs expression in predicting disease relapse/refractoriness to treatment in diffuse large B-cell lymphoma: A meta-analysis | |
| Zeng et al. | miR-17-5p-CXCL14 axis related transcriptome profile and clinical outcome in diffuse gliomas | |
| Yu et al. | A meta‐analysis: micro RNA s’ prognostic function in patients with nonsmall cell lung cancer | |
| Sheng et al. | Characterizing the genomic landscape of brain glioma with circulating tumor DNA from tumor in situ fluid | |
| Henriksson et al. | p53 mutation and cyclin D1 amplification correlate with cisplatin sensitivity in xenografted human squamous cell carcinomas from head and neck | |
| Hinz et al. | TP53 null mutations identify lung cancer cell lines with highest sensitivity to the nontaxane microtubule inhibitor eribulin | |
| CN102409087B (en) | Primer, probe and detection kit for determining beta-tubulin III gene expression | |
| CN108728533A (en) | The purposes of gene group and SNCA genes as the biomarker of 4 type medulloblastomas for medulloblastoma molecule parting | |
| Wood et al. | Combining inhibitors of Brd4 and cyclin-dependent kinase can decrease tumor growth in neuroblastoma with MYCN amplification | |
| CN107287345A (en) | Detection kit and TSEN34 clinical practices for the accurate diagnosis and treatment of acute myeloid leukemia | |
| CN101424639A (en) | Platinum medicament curative effect predicting kit and use thereof | |
| CN106244675A (en) | Adult's AML risk factor layering and clinical prognosis assess test kit and the application of CPNE3 | |
| Oh et al. | Lrrc17 is linked to prognosis of ovarian cancer through a p53-dependent anti-apoptotic function | |
| CN101424638A (en) | Paclitaxel medicament curative effect predicting kit and application thereof | |
| Piccaluga et al. | IFI16 reduced expression is correlated with unfavorable outcome in chronic lymphocytic leukemia |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C56 | Change in the name or address of the patentee | ||
| CP03 | Change of name, title or address |
Address after: 361000, No. 39, Ding Shan Road, Haicang District, Fujian, Xiamen Patentee after: AMOY DIAGNOSTICS CO., LTD. Address before: 361000 Fujian Province, Xiamen City Haicang Xinyang Industrial Zone Weng Kok Road No. 289 Chong Building 5 floor Patentee before: Amoy Diagnostics Co., Ltd. |
|
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20201214 Address after: Room 202, building 3, 138 xinjunhuan Road, Minhang District, Shanghai Patentee after: Shanghai Xiawei medical laboratory Co.,Ltd. Address before: No. 39, Haicang Ding Shan Road, Haicang District, Xiamen, Fujian Patentee before: Xiamen Aide Biomedical Technology Co.,Ltd. |