CN102391376A - Fusion protein of human somatostatin tetradecapeptide and human serum albumin, and coding gene and preparation method thereof - Google Patents
Fusion protein of human somatostatin tetradecapeptide and human serum albumin, and coding gene and preparation method thereof Download PDFInfo
- Publication number
- CN102391376A CN102391376A CN2011100613327A CN201110061332A CN102391376A CN 102391376 A CN102391376 A CN 102391376A CN 2011100613327 A CN2011100613327 A CN 2011100613327A CN 201110061332 A CN201110061332 A CN 201110061332A CN 102391376 A CN102391376 A CN 102391376A
- Authority
- CN
- China
- Prior art keywords
- fusion rotein
- serum albumin
- sequence
- human serum
- lys
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention discloses a fusion protein of human somatostatin tetradecapeptide and human serum albumin, comprising a first region homologous with at least 85% sequence of the human somatostatin tetradecapeptide and a second region homologous with at least 85% sequence of the human serum albumin or a second region with partial amino acid sequence of the human serum albumin, wherein the first region homologous with the human somatostatin tetradecapeptide is positioned at the N terminal of the fusion protein, the second region homologous with the human serum albumin is positioned at the C terminal of the fusion protein, and no connecting peptide is added between the first and second regions; or the second region homologous with at least 85% sequence of the human serum albumin is positioned at the N terminal of the fusion protein, the first region homologous with at least 85% sequence of the human somatostatin tetradecapeptide is positioned at the C terminal of the fusion protein, and no connecting peptide is added between the first and second regions. The fusion protein disclosed by the invention prolongs the retention time of the human somatostatin tetradecapeptide molecules in the blood circulation system, and can be used for treating various diseases caused by surplus secretion of growth hormone, for treating diseases caused by endocrine disorder of gastrointestinal tract, for inhibiting growth of tumors expressing somatostatin receptors (SSTRs) and not expressing SSTRs, and for reducing the death rate caused by radiation injury of gastrointestinal tract.
Description
Technical field
The invention belongs to long-acting fusion rotein technical field of pharmaceuticals, be specifically related to the grow fusion rotein of chalone tetradecapeptide and human serum albumin of people.
Background technology
Somatostatin (somatostatin; SST) be a kind of annular polypeptide parahormone; Be a kind of somatostatin (somatotropin release-inhibiting factor that Brazeau etc. separated to purify from the sheep hypothalamus in 1973; SRIF), mainly contain 14 peptides (SST-14) and two kinds of crude forms of 28 peptides (SST28).SST through with target cell membrane on specific receptors (Somatostatin receptors SSTRs) combines and brings into play multiple biological activity.SSTRs has 5 molecular isoforms, SSTR1～5, and wherein SSTR2 exists SSTR2A and two kinds of varients of SSTR2B again, and they all combine with natural SST-14 and SST28 with similar avidity.The SST decapacitation suppresses almost secretory reaction inside and outside all physiologicals of body all to be had restraining effect, and can extensively suppress the proliferation activity of cell outside the tethelin.Discovering in recent years, SST and analogue thereof have the activity that suppresses tumor growth, and they can not only suppress the propagation of endocrine tumors, and to many other noumenal tumours, also inhibited like mammary cancer, large bowel cancer, liver cancer, lung cancer etc.
SST-14 is the active substance that at first is found in the hypothalamus, and structure is a ring-type 14 peptides, combines with disulfide linkage between the 3rd and 14 s' the halfcystine, and usually said SST is meant SST-14.The action time of SST-14 is of short duration, is merely 3 minutes plasma half-life, is prone to the high secreting phenomenon of knock-on of hormonal readiness after the drug withdrawal, thereby lacks clinical pharmaceutical use.Though people have designed and have a series ofly had preferably; The SST analogue that body can tolerate like Sostatin, vapreotide, Lanreotide etc., makes to extend to 120 minutes its plasma half-life; But these analogues only have high-affinity with the part acceptor, in the performance of physiological function, can not show a candle to natural SST.
Human serum albumin (Human serum albumin; HSA) as the staple of human plasma; Have non-enzymatic activity and immunogenicity, big, the long half time advantages such as (about 23 days) of molecular weight, and be the carrier of many castle's intrinsic factors and external source medicine.Employing is the fusion protein technology of carrier with HSA, with pharmaceutical protein and HSA molecule amalgamation and expression, has increased the molecular weight of pharmaceutical protein on the one hand, has reduced the discharge rate of kidney; On the other hand, the protein molecular of fusion surface produces space steric effect, and proteolytic ferment stays the time to the hydrolytic action of pharmaceutical protein thereby prolonged the Chu of pharmaceutical protein molecule in the recycle system effectively in the attenuating blood.Through changing the pharmacokinetic properties of medicine, make that the plasma concns of medicine is more stable, the time that medicine is kept in vivo is longer, thereby reaches the effect that improves curative effect of medication.
The gene serial connection technology is several goal gene to be joined end to end be together in series at random; Usually be used under the situation that to obtain enough dna fragmentations or expression of gene product; Because SST produces physiological action through the mode that acceptor and part mutually combine; Increase the number of part in the drug molecule, can make medicine and part bonded chance increase increased activity in theory undoubtedly.
Summary of the invention
The object of the invention is exactly to above-mentioned defective; The fusion rotein that provides a kind of people to grow chalone tetradecapeptide and human serum albumin, comprise with the people grow chalone tetradecapeptide at least 85% sequence homology first district and with second district of human serum albumin at least 85% sequence homology or partial amino-acid series second district of human serum albumin; Said and people chalone tetradecapeptide homologous first district of growing is positioned at the N-terminal of fusion rotein, and said and human serum albumin homologous second district is positioned at the C-terminal of fusion rotein, and the centre does not add any connection peptides; Or second district said and human serum albumin at least 85% sequence homology is positioned at the N-terminal of fusion rotein, and grow first district of chalone tetradecapeptide at least 85% sequence homology of said and people is positioned at the C-terminal of fusion rotein, and the centre does not add any connection peptides.
Described people grows first district of chalone tetradecapeptide at least 85% sequence homology for the concatermer form.
Described people grows first district of chalone tetradecapeptide at least 85% sequence homology for monomer, diad or triplet.
Second district of said fusion rotein is made up of human serum albumin part-structure territory or the human serum albumin after reset in human serum albumin part-structure territory is formed.
Said fusion rotein, be following a) or b) protein:
A) protein of forming by the amino acid residue sequence of sequence in the sequence table 2 or 4;
B) with the amino acid residue sequence of sequence in the sequence table 2 or 4 through the transformation period in the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and the body that can prolong by a) deutero-protein.
Another object of the present invention has provided the grow encoding sox of the fusion rotein that chalone tetradecapeptide and human serum albumin form by the people.
Described encoding sox is following 1) or 2) gene:
1) its nucleotide sequence is the sequence 1 or 3 in the sequence table;
2) under stringent condition with 1) the dna sequence dna hybridization that limits and the dna molecular of encoding said fusion protein.
The 3rd purpose of the present invention provides recombinant expression vector, transgenic cell line or the reorganization bacterium that contains said fusion rotein encoding sox.
The 4th purpose of the present invention provide a kind of express described by the grow method of the fusion rotein that chalone tetradecapeptide and human serum albumin form of people; Be that the recombinant expression vector that will contain said fusion rotein encoding sox imports the host, express obtaining fusion rotein; Said host is a yeast, is preferably pichia spp GS115; The said carrier that sets out that is used to make up said recombinant expression vector is pPIC9K.
Beneficial effect of the present invention is: the provided by the invention growth by the people do not add any connection peptides in the middle of the fusion rotein that chalone tetradecapeptide and human serum albumin form, and avoided adding because of connection peptides the problem of aspects such as the fusion rotein stability (avoiding the proteasome degradation to connection peptides) brought and immunogenicity; And it is improving and/or is keeping on the bioactive basis of natural human Somatostatin tetradecapeptide; Prolong the Chu of natural human Somatostatin tetradecapeptide molecule in blood circulation and stayed the time; Changed its pharmacokinetic properties, thereby made this fusion rotein have clinical pharmaceutical use; This kind fusion rotein can be applicable to treatment because of the superfluous caused various diseases of growth hormone secretion; Be used to treat the disease that the gi tract endocrine regulation causes; Be used for suppressing to express SSTRs and do not express the SSTRs growth of tumor, be used to reduce the mortality ratio that the gi tract radiation injury causes.
Description of drawings
Fig. 1 is the related synoptic diagram with human serum albumin of chalone of growing of people in the fusion rotein of the present invention.
Fig. 2 is plasmid pPIC9K-(SST-14)
3-HSA/pPIC9K-HSA-(SST-14)
3Structure iron.
Fig. 3 is (SST-14)
3Overlapping PCR product.
Fig. 4 is the PCR product of HSA.
Fig. 5 is fusion rotein (SST-14)
3-HSA and HSA-(SST-14)
3SDS-PAGE analyze.
Wherein, M: protein molecular weight standard; Lane 1: reorganization bacterium GS115/pPIC9K-(SST-14)
3-HSA expression product; Lane 2: reorganization bacterium GS115/pPIC9K-HSA-(SST-14)
3Expression product.
Fig. 6 is fusion rotein (SST-14)
3-HSA and HSA-(SST-14)
3Western blot identify.
Wherein, Lane 1: fusion rotein (SST-14)
3-HSA; Lane 2: fusion rotein HSA-(SST-14)
3
Fig. 7 is fusion rotein (SST-14)
3-HSA with (SST-14)
3The separation and purification of-HSA.
Wherein, M: protein molecular weight standard; Lane 1: the fusion rotein of buffer B wash-out (SST-14)
3The dialysis product of-HSA; The fusion rotein (SST-14) of Lane 2:50% terepthaloyl moietie wash-out
3The dialysis product of-HSA; Lane 3: the fusion rotein HSA-(SST-14) of buffer B wash-out
3The dialysis product; The fusion rotein HSA-(SST-14) of Lane 2:50% terepthaloyl moietie wash-out
3The dialysis product.Contain the high density fusion rotein in the elutriant of buffer B, purity is more than 95%, after the lyophilize as the sample of follow-up pharmacodynamic study.Major part is the degraded product of fusion rotein in the elutriant of 50% terepthaloyl moietie, shows that this affinity column has separating effect preferably.
Fig. 8 is fusion rotein (SST-14)
3-HSA with (SST-14)
3-HSA is in the intravital pharmacodynamics detected result of mouse.
Embodiment
Experimental technique among the following embodiment and used reagent if no special instructions, are ordinary method and conventional reagent.
The plasmid extraction test kit, DNA glue reclaims test kit, and PCR product purification test kit is all given birth to worker's biotechnology ltd available from Shanghai.
PMD19-T Simple Vector, TaKaRa Taq
TM, the T4 dna ligase, various restriction enzymes and E.coli Competent Cell JM109 are all available from TaKaRa company.
Pichia spp host bacterium GS115 and secreted expression carrier pPIC9K are available from Invitrogen company.
Primer synthesizes and the dna sequencing service provides by the living worker's biotechnology in Shanghai ltd.
Tryptones and yeast extract are Britain Oxoid Company products, and not having amino acid whose yeast nitrogen base is U.S. company BD Difco substratum.
Pvdf membrane is available from U.S. Bio-Rad company.
The anti-people SST of rabbit resists (ab53165) and the anti-people HSA of rabbit more, and how anti-(ab83465) is Britain Abcam Company products.
It is U.S. Santa Cruz Company products that the goat-anti rabbit two of HRP mark resists.
The colour developing of enhancement type HRP-DAB substrate colouring reagents box is available from sky root biochemical technology ltd.
Blue Sepharose is available from U.S. Pharmacia company.
Little rat growth hormone (GH) detection by quantitative test kit is a U.S. R&D Company products.
Main agents among the following embodiment:
1. primer:
PS1：5’- TGAGAATTCAAAAGAgctggctgcaagaatttcttctggaagacTTC - 3’；
PS2：5’- TAAATCGATGAGCAACCTCACTCTTGTGTGCATCacaggatgtgaaag - 3’；
PS3：5’- GATCCTTAGGCTTAGCTGGCTGCAAGAAT - 3’；
PS4：5’- TTAGCGGCCGCTTATTAACAGGATGTGAAA - 3’；
PH1：5’- AGGTCGACGATGCACACAAGAGTGAGGTTGCTC - 3’；
PH2：5’- GCCAAGCTTTTATAAGCCTAAGGCAGCTTGACTT - 3’；
PH3：5’-GCCGGAATTCAAAAGAGATGCACACAAGAGTGAGGTTGCTCATCGAT- 3’；
PH4：5’- CATAAGGCGGCCGCTTATTATAAGCCTAAGGCAGCTTG - 3’；
2. SST-14 triplet gene
(SS-14)
3-oligonucleotide sequence 1:
5’-GCTGGCTGCAAGAATTTCTTCTGGAAGACTTTCACATCCTGTGCTGGCTGCAAGAATTTCTTCTGGAAGACTTTCACATCCTGTGCTGGCTGC- 3’；
(SS-14)
3-oligonucleotide sequence 2:5 '-ACAGGATGTGAAAGTCTTCCAGAAGAAATTCTTGCAGCCAGCACAGGATGTGAAAG TCTTCCAGAAGAAATTCTTGCAGCCAGCACAGGATGT-3 ';
3. culture medium prescription
BMGY substratum: 2% Tryptones, 1% yeast extract, 100 mmol/L potassiumphosphates (pH 6.0), 1.34% no amino acid whose yeast nitrogen base (YNB), 410
-5The % vitamin H, 2% glycerine.
BMMY substratum: 2% Tryptones, 1% yeast extract, 100 mmol/L potassiumphosphates (pH 6.0), 1.34% no amino acid whose yeast nitrogen base (YNB), 410
-5The % vitamin H, 2% methyl alcohol.
4, sequence explanation: fusion rotein (SST14)
3-HSA and HSA-(SST14)
3Amino acid and gene order.Introduce the ClaI restriction enzyme site through rite-directed mutagenesis at the N of HSA end, be used for making up (SST14)
3-HSA fusion gene; There is the SauI restriction enzyme site in the C end of HSA, is used to make up HSA-(SST14)
3Fusion gene; Adopt EcoRI and NotI restriction enzyme site, insert the reading frame of expression vector pPIC9K.
Embodiment:
1. the clone of SST-14 triplet gene
A. (SST-14)
3Oligonucleotide annealing
Two complementary of synthetic (SST-14)
3Oligonucleotide is (referring to (SS-14)
3-oligonucleotide sequence 1 with (SS-14)
3-oligonucleotide sequence 2).The oligonucleotide sequence 1 and 2 of 100M concentration is respectively got 10l to 70l ddH
2Among the O, add 10l 10 annealing buffers simultaneously, preparation 10M (SS14)
3-oligonucleotide mixing solutions.95C heat oligonucleotide mixing solutions let the oligonucleotide mixing solutions naturally cool to room temperature (25C-30C) after 2 minutes.
B. (SST-14)
3Extend
30 l annealed oligonucleotide templates, 10 l10 Klenow damping fluids, 10l 25 mM dNTPs mix, 37C hatching 30 minutes.Increase by 4 l100 mM EDTA termination reactions.
C. (SST-14)
3Pcr amplification
Reaction system is: the PS1 of 10 μ mol/L and each 0.5l of PS2 primer, and the dNTP 0.5l of 10mmol/L, 10pfu damping fluid 2.5 μ l, the pfu archaeal dna polymerase 0.5l of 5U/l, (SST-14)
3Extension products 0.5l (containing 1ng DNA) adds dd H
2O polishing 25l.
PCR response procedures: 95 ℃ of preparatory sex change 5 minutes; 94 ℃ of sex change 30 seconds, 60 ℃ of annealing 30 seconds, 72 ℃ are extended second, circulate 25 times; 72 ℃ were extended 2 minutes.
The overlapping PCR reaction product of 2% agarose gel analysis; Cutting is purpose band (being the 150bp band) down, and PCR glue reclaims test kit and reclaims, and is connected with pMD19-T Simple vector; Connecting product is converted in the escherichia coli jm109 competent cell; Identify positive colony through bacterium colony, dna sequencing checking SST-14 triplet gene order is correct, the positive recombinant called after JM109/pMD19T-(SST-14) of acquisition
3
2.HSA the clone of gene
Utilize PCR from people's tire liver cDNA library, to amplify HSA cDNA.
The PCR reaction system: each 1.5 μ l of the PH1 of 10 μ mol/L and PH2 primer, the dNTP 4 μ l of 2.5mmol/L, 10pfu damping fluid 5 μ l, the pfu archaeal dna polymerase 0.5 μ l of 5U/ μ l, people's tire liver cDNA library 1ng adds ddH
2O polishing 50 μ l.
PCR response procedures: 95 ℃ of preparatory sex change 5 minutes; 94 ℃ of sex change 1 minute, 60 ℃ of annealing 1 minute, 72 ℃ were extended 1 minute and 30 seconds, and circulated 25 times; 72 ℃ were extended 10 minutes.
Agarose gel electrophoresis is analyzed the PCR reaction product, reclaims the also purpose segment of purifying 1.8kb.Purpose segment and pBlu2KSP carrier to reclaiming carry out Sal I and Hind III double digestion, and through T
4Dna ligase is connected the PCR purpose fragment of double digestion and the pBlu2KSP carrier of double digestion; Connect product transformed into escherichia coli JM109 competent cell, the having or not of the cultivation of the LB agar plate through containing X-gal, IPTG and 100 μ g/ml penbritins, pcr amplification, endonuclease site, and method such as determined dna sequence identify positive colony.Positive recombinant called after JM109/pBlu2KSP-HSA.
3. (SST-14)
3Clone with the HSA fusion gene
A. (SST-14)
3-1, (SST-14)
3The amplification of-2 PCR reaction product
With pMD19T-(SST-14)
3Being template, is primer with PS1 and PS2, carries out pcr amplification reaction, and reaction product is (SST-14)
3-1, be used for construction of fusion protein (SST-14)
3-HSA.
With pMD19T-(SST-14)
3Being template, is primer with PS3 and PS4, carries out pcr amplification reaction, and amplified production is (SST-14)
3-2, be used for construction of fusion protein HSA-(SST-14)
3
The PCR reaction system is: each 1.5 μ l of the primer PS1 of 10 μ mol/L and PS2 (or PS3 and PS4), and the dNTP 4 μ l of 2.5mmol/L, 10PCR damping fluid 5 μ l, the TaKaRa Taq 0.25 μ l of 5U/ μ l, DNA 0.5 μ l (containing 1ng DNA) adds ddH
2O polishing 50 μ l.
PCR response procedures: 95 ℃ of preparatory sex change 3 minutes; 94 ℃ of sex change 30 seconds, 60 ℃ of annealing 30 seconds, 72 ℃ were extended 30 seconds, and circulated 25 times; 72 ℃ were extended 3 minutes.
B. the pcr amplification of HSA gene
With pBlu2KSP-HSA is template, is primer with PH3 and PH4, carries out pcr amplification reaction.
Reaction system is: each 1.5 μ l of the primer PH3 of 10 μ mol/L and PH4, and the dNTP 4 μ l of 2.5mmol/L, 10PCR damping fluid 5 μ l, the TaKaRa Taq 0.25 μ l of 5U/ μ l, DNA 0.5 μ l (containing 1ng DNA) adds ddH
2O polishing 50 μ l.
PCR response procedures: 95 ℃ of preparatory sex change 5 minutes; 94 ℃ of sex change 1 minute, 60 ℃ of annealing 1 minute, 72 ℃ were extended 1 minute and 30 seconds, and circulated 25 times; 72 ℃ were extended 10 minutes.The PCR product is connected with the pMD19-T carrier, positive recombinant called after JM109/pMD19T-HSA.
C. (SST-14)
3Structure with HSA expressing fusion protein gene
PCR product (SST-14)
3-1 through the EcoRI-ClaI double digestion, PCR product (SST-14)
3-2 through the SauI-NotI double digestion, and is connected with the pMD19T-HSA carrier of cutting through same enzyme respectively, and pcr amplification reaction is identified positive colony bacterium colony, positive recombinant called after JM109/pMD19T-(SST-14)
3-HSA and JM109/pMD19T-HSA-(SST-14)
3
4. (SST-14)
3-HSA and HSA-(SST-14)
3Yeast expression system makes up and Expression of Fusion Protein
A. fusion rotein (SST-14)
3-HSA and HSA-(SST-14)
3The structure of yeast expression system
(a-1). pMD19T-(SST-14)
3-HSA, pMD19T-HSA-(SST-14)
3And Yeast expression carrier pPIC9K, respectively through the EcoRI-NotI double digestion, agarose gel electrophoresis is identified and is reclaimed enzyme and cut (SST-14)
3-HSA, HSA-(SST-14)
3And carrier pPIC9K enzyme cuts dna fragmentation, through T
4Dna ligase with carrier pPIC9K respectively with (SST-14)
3-HSA and HSA-(SST-14)
3Be connected, pcr amplification reaction is identified the positive colony bacterium colony.Positive recombinant called after JM109/pPIC9K-(SST-14)
3-HSA and JM109/pPIC9K-HSA-(SST-14)
3
(a-2). pPIC9K-(SST-14)
3-HSA and pPIC9K-HSA-(SST-14)
3, behind the SalI single endonuclease digestion, DNA glue reclaims test kit recovery enzyme and cuts product.Single endonuclease digestion reclaims product and transforms pichia spp GS115 through electric-shocking method, and conversion product is coated on the MD flat board that contains the 1mol/L sorbyl alcohol, cultivates 4 days in 30 ℃.Positive colony called after GS115/pPIC9K-(SST-14)
3-HSA and GS115/pPIC9K-HSA-(SST-14)
3
B. fusion rotein (SST-14)
3-HSA and HSA-(SST-14)
3Yeast expression
Inoculation fusion rotein (SST-14)
3-HSA and fusion rotein HSA-(SST-14)
3Positive single bacterium colony is in the triangular flask that 10ml BMGY substratum is housed, and 200rpm cultivates about 24h to OD for 30 ℃
600Be 18, leave standstill 2h and make the thalline natural subsidence that supernatant inclines; Resuspended thalline is in 3ml BMMY substratum; Continuous induction is cultivated 72h, and it is 2% that per 24 h add methyl alcohol a to final concentration, centrifugal collection supernatant; SDS-PAGE detects the expressing fusion protein situation, and the starting strain of the highest reorganization bacterium of output as subsequent experimental expressed in screening.
C. fusion rotein (SST-14)
3-HSA and HSA-(SST-14)
3Evaluation
Select and produce fusion rotein (SST-14)
3-HSA and HSA-(SST-14)
3The highest recombinant bacterial strain, its fermentation supernatant utilize the anti-people SST of rabbit how anti-how anti-with the anti-people HSA of rabbit behind the SDS-PAGE electrophoresis, identify fusion rotein (SST-14) through Western blot
3-HSA and HSA-(SST-14)
3Expression.
5. (SST-14)
3-HSA and HSA-(SST-14)
3The specimen preparation of fusion rotein
A. the expression of fusion rotein on 5 liters of (5L) fermentor tanks
Positive GS115/pPIC9K-(SST-14)
3-HSA or GS115/pPIC9K-HSA-(SST-14)
3The clone bacterium is seeded in the 250ml triangular flask that 50ml BMGY substratum is housed, and 200rpm cultivates 24h, prepares first order seed for 30 ℃.With 2% inoculum size the first order seed access is equipped with in the 500ml triangular flask of 150ml BMGY substratum, 200rpm cultivates 24h, prepares secondary seed for 30 ℃.The secondary seed access is housed in the 5L fermentor tank of 2.5l BMGY substratum by 5% inoculum size, setting the fermentation starting condition is 30 ℃ of temperature, rotating speed 500rpm, air flow 2VVM, pH6.0.About fermentation beginning 24h, the carbon source in the initial medium (glycerine) is exhausted, and dissolved oxygen begins bounce-back, begins flow feeding growth medium (5% Tryptones, 10% yeast extract, 10% glycerine, 6.7% YNB, 210 this moment
-4The % vitamin H), flow velocity is 4ml/min, feed supplement 500ml.After feed supplement was accomplished, disposable 0.2% methyl alcohol of adding made it adapt to new carbon source.Treating that dissolved oxygen rises once more surpasses at 40% o'clock, opens methyl alcohol pulsed stream and adds, and disposable 0.5% methyl alcohol of adding is periodically carried out, and surpasses at 40% o'clock whenever dissolved oxygen rises, and disposable 0.5% methyl alcohol of adding is induced 42h.The different period Expression of Fusion Protein situation of SDS-PAGE electrophoresis detection.
B. the separation and purification of fusion rotein tunning
After following jar of the fermented liquid, 4 C, the centrifugal 10min of 8,000 r/min gets supernatant, crosses 0.45 μ m film.Adopt the semi-automatic ultra-filtration equipment of Cogent M1 pilot scale, molecular weight cut-off is 10 kDa, carries out ultrafiltration.Original fermented liquid supernatant 3L ultrafiltration is to 300ml, and adding 300ml zero(ppm) water ultrafiltration again so repeats 3 times to 300ml, electricity is led reduce to below 10 ms/cm.
Blue Sepharose F.F. resin 50 ml adorn post (25/20), with buffer A (pH7.2,0.02 mol/L phosphoric acid buffer, 0.15 mol/L NaCl) balance, flow velocity 10 ml/min.Transferring pH after above-mentioned sample thaws is centrifugal 10 min of 7.2,15,000 r/min, and with appearance on the flow velocity of 5 ml/min, applied sample amount is 300 ml.Regulating flow velocity behind the end of the sample is 10 ml/min, continues to be eluted to baseline values with buffer A.Be adsorbed on the protein sample on the affinity column with buffer B (pH7.2,0.02 mol/L phosphoric acid buffer, 2 mol/L NaCl) wash-out; Use 50% terepthaloyl moietie (50% terepthaloyl moietie subsequently; PH7.2,0.02 mol/L phosphoric acid buffer, 2 mol/L NaCl) the wash-out residual protein.Collect each elution peak, carry out SDS-PAGE and analyze.Purification of samples is dialysed in zero(ppm) water and led to electricity is 20 μ s/cm, is used for follow-up pharmacodynamic experiment after the lyophilize.
6. fusion rotein (SST-14)
3-HSA and HSA-(SST-14)
3At the intravital pharmacodynamic study of mouse
18 of BALB/c male mices, mean body weight is about 20g, is divided into positive controls at random, fusion rotein (SST-14)
3-HSA group and HSA-(SST-14)
3Group, tail vein injection 10mg/kg body weight fusion rotein, positive control sample is that (Cat No. S1763-1mg, Sigma), ID is the 0.15mg/kg body weight to natural SST-14.Took a blood sample the content of mice serum GH in tethelin (GH) detection by quantitative test kit (R&D company) detection serum in 0,2,6,24 h minutes after the fusion rotein injection from the eye frame.
7. the structure of SST-14 monomer fusion gene
Synthetic SST-14 monomer gene; Adopt EcoRI and ClaI double digestion to make up (SST-14)-HSA fusion gene respectively; Adopt SauI and NotI double digestion to make up HSA-(SST-14) fusion gene, adopt EcoRI and Not I double digestion to be inserted into respectively among the yeast expression vector pPIC9K.All the other operations are with the preparation of SST-14 triplet fusion rotein.
8. the structure of SST-14 diad fusion gene
The 1 said overlapping PCR that carries out the SST-14 concatermer set by step; The PCR product is cut off SST-14 diad gene purpose band (about 100bp band) through the agarose gel electrophoresis analysis, and PCR glue reclaims test kit and reclaims; And be connected with pMD19-T Simple vector, the sequence verification sequence is correct.From step 2 beginning, all the other operations are with the preparation of SST-14 triplet fusion rotein.
< 110>Jiangsu Inst of Atomic Medical Sciences
< 120>people fusion rotein and the encoding sox and the preparation method of chalone tetradecapeptide and human serum albumin that grow
<210> 1
<211> 1904
<212> DNA
< 213>artificial sequence
<400> 1
gaattcaaaa gagctggctg caagaatttc ttctggaaga ctttcacatc ctgtgctggc 60
tgcaagaatt tcttctggaa gactttcaca tcctgtgctg gctgcaagaa tttcttctgg 120
aagactttca catcctgtga tgcacacaag agtgaggttg ctcatcgatt taaagatttg 180
ggagaagaaa atttcaaagc cttggtgttg attgcctttg ctcagtatct tcagcagtgt 240
ccatttgaag atcatgtaaa attagtgaat gaagtaactg aatttgcaaa aacatgtgtt 300
gctgatgagt cagctgaaaa ttgtgacaaa tcacttcata ccctttttgg agacaaatta 360
tgcacagttg caactcttcg tgaaacctat ggtgaaatgg ctgactgctg tgcaaaacaa 420
gaacctgaga gaaatgaatg cttcttgcaa cacaaagatg acaacccaaa cctcccccga 480
ttggtgagac cagaggttga tgtgatgtgc actgcttttc atgacaatga agagacattt 540
ttgaaaaaat acttatatga aattgccaga agacatcctt acttttatgc cccggaactc 600
cttttctttg ctaaaaggta taaagctgct tttacagaat gttgccaagc tgctgataaa 660
gctgcctgcc tgttgccaaa gctcgatgaa cttcgggatg aagggaaggc ttcgtctgcc 720
aaacagagac tcaagtgtgc cagtctccaa aaatttggag aaagagcttt caaagcatgg 780
gcagtagctc gcctgagcca gagatttccc aaagctgagt ttgcagaagt ttccaagtta 840
gtgacagatc ttaccaaagt ccacacggaa tgctgccatg gagatctgct tgaatgtgct 900
gatgacaggg cggaccttgc caagtatatc tgtgaaaatc aagattcgat ctccagtaaa 960
ctgaaggaat gctgtgaaaa acctctgttg gaaaaatccc actgcattgc cgaagtggaa 1020
aatgatgaga tgcctgctga cttgccttca ttagctgctg attttgttga aagtaaggat 1080
gtttgcaaaa actatgctga ggcaaaggat gtcttcctgg gcatgttttt gtatgaatat 1140
gcaagaaggc atcctgatta ctctgtcgtg ctgctgctga gacttgccaa gacatatgaa 1200
accactctag agaagtgctg tgccgctgca gatcctcatg aatgctatgc caaagtgttc 1260
gatgaattta aacctcttgt ggaagagcct cagaatttaa tcaaacaaaa ttgtgagctt 1320
tttgagcagc ttggagagta caaattccag aatgcgctat tagttcgtta caccaagaaa 1380
gtaccccaag tgtcaactcc aactcttgta gaggtctcaa gaaacctagg aaaagtgggc 1440
agcaaatgtt gtaaacatcc tgaagcaaaa agaatgccct gtgcagaaga ctatctatcc 1500
gtggtcctga accagttatg tgtgttgcat gagaaaacgc cagtaagtga cagagtcacc 1560
aaatgctgca cagaatcctt ggtgaacagg cgaccatgct tttcagctct ggaagtcgat 1620
gaaacatacg ttcccaaaga gtttaatgct gaaacattca ccttccatgc agatatatgc 1680
acactttctg agaaggagag acaaatcaag aaacaaactg cacttgttga gctcgtgaaa 1740
cacaagccca aggcaacaaa agagcaactg aaagctgtta tggatgattt cgcagctttt 1800
gtagagaagt gctgcaaggc tgacgataag gagacctgct ttgccgagga gggtaaaaaa 1860
cttgttgctg caagtcaagc tgccttaggc ttataagcgg ccgc 1904
<210> 2
<211> 627
<212> PRT
< 213>artificial sequence
<400> 2
Ala Gly Cys Lys Asn Phe Phe Trp Lys Thr Phe Thr Ser Cys Ala Gly
1 5 10 15
Cys Lys Asn Phe Phe Trp Lys Thr Phe Thr Ser Cys Ala Gly Cys Lys
20 25 30
Asn Phe Phe Trp Lys Thr Phe Thr Ser Cys Asp Ala His Lys Ser Glu
35 40 45
Val Ala His Arg Phe Lys Asp Leu Gly Glu Glu Asn Phe Lys Ala Leu
50 55 60
Val Leu Ile Ala Phe Ala Gln Tyr Leu Gln Gln Cys Pro Phe Glu Asp
65 70 75 80
His Val Lys Leu Val Asn Glu Val Thr Glu Phe Ala Lys Thr Cys Val
85 90 95
Ala Asp Glu Ser Ala Glu Asn Cys Asp Lys Ser Leu His Thr Leu Phe
100 105 110
Gly Asp Lys Leu Cys Thr Val Ala Thr Leu Arg Glu Thr Tyr Gly Glu
115 120 125
Met Ala Asp Cys Cys Ala Lys Gln Glu Pro Glu Arg Asn Glu Cys Phe
130 135 140
Leu Gln His Lys Asp Asp Asn Pro Asn Leu Pro Arg Leu Val Arg Pro
145 150 155 160
Glu Val Asp Val Met Cys Thr Ala Phe His Asp Asn Glu Glu Thr Phe
165 170 175
Leu Lys Lys Tyr Leu Tyr Glu Ile Ala Arg Arg His Pro Tyr Phe Tyr
180 185 190
Ala Pro Glu Leu Leu Phe Phe Ala Lys Arg Tyr Lys Ala Ala Phe Thr
195 200 205
Glu Cys Cys Gln Ala Ala Asp Lys Ala Ala Cys Leu Leu Pro Lys Leu
210 215 220
Asp Glu Leu Arg Asp Glu Gly Lys Ala Ser Ser Ala Lys Gln Arg Leu
225 230 235 240
Lys Cys Ala Ser Leu Gln Lys Phe Gly Glu Arg Ala Phe Lys Ala Trp
245 250 255
Ala Val Ala Arg Leu Ser Gln Arg Phe Pro Lys Ala Glu Phe Ala Glu
260 265 270
Val Ser Lys Leu Val Thr Asp Leu Thr Lys Val His Thr Glu Cys Cys
275 280 285
His Gly Asp Leu Leu Glu Cys Ala Asp Asp Arg Ala Asp Leu Ala Lys
290 295 300
Tyr Ile Cys Glu Asn Gln Asp Ser Ile Ser Ser Lys Leu Lys Glu Cys
305 310 315 320
Cys Glu Lys Pro Leu Leu Glu Lys Ser His Cys Ile Ala Glu Val Glu
325 330 335
Asn Asp Glu Met Pro Ala Asp Leu Pro Ser Leu Ala Ala Asp Phe Val
340 345 350
Glu Ser Lys Asp Val Cys Lys Asn Tyr Ala Glu Ala Lys Asp Val Phe
355 360 365
Leu Gly Met Phe Leu Tyr Glu Tyr Ala Arg Arg His Pro Asp Tyr Ser
370 375 380
Val Val Leu Leu Leu Arg Leu Ala Lys Thr Tyr Glu Thr Thr Leu Glu
385 390 395 400
Lys Cys Cys Ala Ala Ala Asp Pro His Glu Cys Tyr Ala Lys Val Phe
405 410 415
Asp Glu Phe Lys Pro Leu Val Glu Glu Pro Gln Asn Leu Ile Lys Gln
420 425 430
Asn Cys Glu Leu Phe Glu Gln Leu Gly Glu Tyr Lys Phe Gln Asn Ala
435 440 445
Leu Leu Val Arg Tyr Thr Lys Lys Val Pro Gln Val Ser Thr Pro Thr
450 455 460
Leu Val Glu Val Ser Arg Asn Leu Gly Lys Val Gly Ser Lys Cys Cys
465 470 475 480
Lys His Pro Glu Ala Lys Arg Met Pro Cys Ala Glu Asp Tyr Leu Ser
485 490 495
Val Val Leu Asn Gln Leu Cys Val Leu His Glu Lys Thr Pro Val Ser
500 505 510
Asp Arg Val Thr Lys Cys Cys Thr Glu Ser Leu Val Asn Arg Arg Pro
515 520 525
Cys Phe Ser Ala Leu Glu Val Asp Glu Thr Tyr Val Pro Lys Glu Phe
530 535 540
Asn Ala Glu Thr Phe Thr Phe His Ala Asp Ile Cys Thr Leu Ser Glu
545 550 555 560
Lys Glu Arg Gln Ile Lys Lys Gln Thr Ala Leu Val Glu Leu Val Lys
565 570 575
His Lys Pro Lys Ala Thr Lys Glu Gln Leu Lys Ala Val Met Asp Asp
580 585 590
Phe Ala Ala Phe Val Glu Lys Cys Cys Lys Ala Asp Asp Lys Glu Thr
595 600 605
Cys Phe Ala Glu Glu Gly Lys Lys Leu Val Ala Ala Ser Gln Ala Ala
610 615 620
Leu Gly Leu
625
<210> 3
<211> 1904
<212> DNA
< 213>artificial sequence
<400> 3
gaattcaaaa gagatgcaca caagagtgag gttgctcatc gatttaaaga tttgggagaa 60
gaaaatttca aagccttggt gttgattgcc tttgctcagt atcttcagca gtgtccattt 120
gaagatcatg taaaattagt gaatgaagta actgaatttg caaaaacatg tgttgctgat 180
gagtcagctg aaaattgtga caaatcactt catacccttt ttggagacaa attatgcaca 240
gttgcaactc ttcgtgaaac ctatggtgaa atggctgact gctgtgcaaa acaagaacct 300
gagagaaatg aatgcttctt gcaacacaaa gatgacaacc caaacctccc ccgattggtg 360
agaccagagg ttgatgtgat gtgcactgct tttcatgaca atgaagagac atttttgaaa 420
aaatacttat atgaaattgc cagaagacat ccttactttt atgccccgga actccttttc 480
tttgctaaaa ggtataaagc tgcttttaca gaatgttgcc aagctgctga taaagctgcc 540
tgcctgttgc caaagctcga tgaacttcgg gatgaaggga aggcttcgtc tgccaaacag 600
agactcaagt gtgccagtct ccaaaaattt ggagaaagag ctttcaaagc atgggcagta 660
gctcgcctga gccagagatt tcccaaagct gagtttgcag aagtttccaa gttagtgaca 720
gatcttacca aagtccacac ggaatgctgc catggagatc tgcttgaatg tgctgatgac 780
agggcggacc ttgccaagta tatctgtgaa aatcaagatt cgatctccag taaactgaag 840
gaatgctgtg aaaaacctct gttggaaaaa tcccactgca ttgccgaagt ggaaaatgat 900
gagatgcctg ctgacttgcc ttcattagct gctgattttg ttgaaagtaa ggatgtttgc 960
aaaaactatg ctgaggcaaa ggatgtcttc ctgggcatgt ttttgtatga atatgcaaga 1020
aggcatcctg attactctgt cgtgctgctg ctgagacttg ccaagacata tgaaaccact 1080
ctagagaagt gctgtgccgc tgcagatcct catgaatgct atgccaaagt gttcgatgaa 1140
tttaaacctc ttgtggaaga gcctcagaat ttaatcaaac aaaattgtga gctttttgag 1200
cagcttggag agtacaaatt ccagaatgcg ctattagttc gttacaccaa gaaagtaccc 1260
caagtgtcaa ctccaactct tgtagaggtc tcaagaaacc taggaaaagt gggcagcaaa 1320
tgttgtaaac atcctgaagc aaaaagaatg ccctgtgcag aagactatct atccgtggtc 1380
ctgaaccagt tatgtgtgtt gcatgagaaa acgccagtaa gtgacagagt caccaaatgc 1440
tgcacagaat ccttggtgaa caggcgacca tgcttttcag ctctggaagt cgatgaaaca 1500
tacgttccca aagagtttaa tgctgaaaca ttcaccttcc atgcagatat atgcacactt 1560
tctgagaagg agagacaaat caagaaacaa actgcacttg ttgagctcgt gaaacacaag 1620
cccaaggcaa caaaagagca actgaaagct gttatggatg atttcgcagc ttttgtagag 1680
aagtgctgca aggctgacga taaggagacc tgctttgccg aggagggtaa aaaacttgtt 1740
gctgcaagtc aagctgcctt aggcttagct ggctgcaaga atttcttctg gaagactttc 1800
acatcctgtg ctggctgcaa gaatttcttc tggaagactt tcacatcctg tgctggctgc 1860
aagaatttct tctggaagac tttcacatcc tgttaagcgg ccgc 1904
<210> 4
<211> 627
<212> PRT
< 213>artificial sequence
<400> 4
Asp Ala His Lys Ser Glu Val Ala His Arg Phe Lys Asp Leu Gly Glu
1 5 10 15
Glu Asn Phe Lys Ala Leu Val Leu Ile Ala Phe Ala Gln Tyr Leu Gln
20 25 30
Gln Cys Pro Phe Glu Asp His Val Lys Leu Val Asn Glu Val Thr Glu
35 40 45
Phe Ala Lys Thr Cys Val Ala Asp Glu Ser Ala Glu Asn Cys Asp Lys
50 55 60
Ser Leu His Thr Leu Phe Gly Asp Lys Leu Cys Thr Val Ala Thr Leu
65 70 75 80
Arg Glu Thr Tyr Gly Glu Met Ala Asp Cys Cys Ala Lys Gln Glu Pro
85 90 95
Glu Arg Asn Glu Cys Phe Leu Gln His Lys Asp Asp Asn Pro Asn Leu
100 105 110
Pro Arg Leu Val Arg Pro Glu Val Asp Val Met Cys Thr Ala Phe His
115 120 125
Asp Asn Glu Glu Thr Phe Leu Lys Lys Tyr Leu Tyr Glu Ile Ala Arg
130 135 140
Arg His Pro Tyr Phe Tyr Ala Pro Glu Leu Leu Phe Phe Ala Lys Arg
145 150 155 160
Tyr Lys Ala Ala Phe Thr Glu Cys Cys Gln Ala Ala Asp Lys Ala Ala
165 170 175
Cys Leu Leu Pro Lys Leu Asp Glu Leu Arg Asp Glu Gly Lys Ala Ser
180 185 190
Ser Ala Lys Gln Arg Leu Lys Cys Ala Ser Leu Gln Lys Phe Gly Glu
195 200 205
Arg Ala Phe Lys Ala Trp Ala Val Ala Arg Leu Ser Gln Arg Phe Pro
210 215 220
Lys Ala Glu Phe Ala Glu Val Ser Lys Leu Val Thr Asp Leu Thr Lys
225 230 235 240
Val His Thr Glu Cys Cys His Gly Asp Leu Leu Glu Cys Ala Asp Asp
245 250 255
Arg Ala Asp Leu Ala Lys Tyr Ile Cys Glu Asn Gln Asp Ser Ile Ser
260 265 270
Ser Lys Leu Lys Glu Cys Cys Glu Lys Pro Leu Leu Glu Lys Ser His
275 280 285
Cys Ile Ala Glu Val Glu Asn Asp Glu Met Pro Ala Asp Leu Pro Ser
290 295 300
Leu Ala Ala Asp Phe Val Glu Ser Lys Asp Val Cys Lys Asn Tyr Ala
305 310 315 320
Glu Ala Lys Asp Val Phe Leu Gly Met Phe Leu Tyr Glu Tyr Ala Arg
325 330 335
Arg His Pro Asp Tyr Ser Val Val Leu Leu Leu Arg Leu Ala Lys Thr
340 345 350
Tyr Glu Thr Thr Leu Glu Lys Cys Cys Ala Ala Ala Asp Pro His Glu
355 360 365
Cys Tyr Ala Lys Val Phe Asp Glu Phe Lys Pro Leu Val Glu Glu Pro
370 375 380
Gln Asn Leu Ile Lys Gln Asn Cys Glu Leu Phe Glu Gln Leu Gly Glu
385 390 395 400
Tyr Lys Phe Gln Asn Ala Leu Leu Val Arg Tyr Thr Lys Lys Val Pro
405 410 415
Gln Val Ser Thr Pro Thr Leu Val Glu Val Ser Arg Asn Leu Gly Lys
420 425 430
Val Gly Ser Lys Cys Cys Lys His Pro Glu Ala Lys Arg Met Pro Cys
435 440 445
Ala Glu Asp Tyr Leu Ser Val Val Leu Asn Gln Leu Cys Val Leu His
450 455 460
Glu Lys Thr Pro Val Ser Asp Arg Val Thr Lys Cys Cys Thr Glu Ser
465 470 475 480
Leu Val Asn Arg Arg Pro Cys Phe Ser Ala Leu Glu Val Asp Glu Thr
485 490 495
Tyr Val Pro Lys Glu Phe Asn Ala Glu Thr Phe Thr Phe His Ala Asp
500 505 510
Ile Cys Thr Leu Ser Glu Lys Glu Arg Gln Ile Lys Lys Gln Thr Ala
515 520 525
Leu Val Glu Leu Val Lys His Lys Pro Lys Ala Thr Lys Glu Gln Leu
530 535 540
Lys Ala Val Met Asp Asp Phe Ala Ala Phe Val Glu Lys Cys Cys Lys
545 550 555 560
Ala Asp Asp Lys Glu Thr Cys Phe Ala Glu Glu Gly Lys Lys Leu Val
565 570 575
Ala Ala Ser Gln Ala Ala Leu Gly Leu Ala Gly Cys Lys Asn Phe Phe
580 585 590
Trp Lys Thr Phe Thr Ser Cys Ala Gly Cys Lys Asn Phe Phe Trp Lys
595 600 605
Thr Phe Thr Ser Cys Ala Gly Cys Lys Asn Phe Phe Trp Lys Thr Phe
610 615 620
Thr Ser Cys
625
Claims (9)
1. the people fusion rotein of chalone tetradecapeptide and human serum albumin of growing is characterized in that: comprise with the people grow chalone tetradecapeptide at least 85% sequence homology first district and with second district of human serum albumin at least 85% sequence homology or partial amino-acid series second district of human serum albumin; Said and people chalone tetradecapeptide homologous first district of growing is positioned at the N-terminal of fusion rotein, and said and human serum albumin homologous second district is positioned at the C-terminal of fusion rotein, and the centre does not add any connection peptides; Or second district said and human serum albumin at least 85% sequence homology is positioned at the N-terminal of fusion rotein, and grow first district of chalone tetradecapeptide at least 85% sequence homology of said and people is positioned at the C-terminal of fusion rotein, and the centre does not add any connection peptides.
2. fusion rotein according to claim 1 is characterized in that: described people grows first district of chalone tetradecapeptide at least 85% sequence homology for the concatermer form.
3. fusion rotein according to claim 2 is characterized in that: described people grows first district of chalone tetradecapeptide at least 85% sequence homology for monomer, diad or triplet.
4. fusion rotein according to claim 3 is characterized in that: second district of said fusion rotein is made up of human serum albumin part-structure territory or the human serum albumin after reset in human serum albumin part-structure territory is formed.
5. fusion rotein according to claim 4 is characterized in that: be following a) or b) protein:
A) protein of forming by the amino acid residue sequence of sequence in the sequence table 2 or 4;
B) with the amino acid residue sequence of sequence in the sequence table 2 or 4 through the transformation period in the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and the body that can prolong by a) deutero-protein.
6. claim 5 is described by the grow encoding sox of the fusion rotein that chalone tetradecapeptide and human serum albumin form of people.
7. encoding sox as claimed in claim 6 is characterized in that: be following 1) or 2) gene:
1) its nucleotide sequence is the sequence 1 or 3 in the sequence table;
2) under stringent condition with 1) the dna sequence dna hybridization that limits and the dna molecular of encoding said fusion protein.
8. the recombinant expression vector, transgenic cell line or the reorganization bacterium that contain the said fusion rotein encoding sox of claim 7.
One kind to express claim 1 described by the grow method of the fusion rotein that chalone tetradecapeptide and human serum albumin form of people, it is characterized in that: the recombinant expression vector that will contain said fusion rotein encoding sox imports the host, expresses obtaining fusion rotein; Said host is a yeast; The said carrier that sets out that is used to make up said recombinant expression vector is pPIC9K.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011100613327A CN102391376A (en) | 2011-03-15 | 2011-03-15 | Fusion protein of human somatostatin tetradecapeptide and human serum albumin, and coding gene and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011100613327A CN102391376A (en) | 2011-03-15 | 2011-03-15 | Fusion protein of human somatostatin tetradecapeptide and human serum albumin, and coding gene and preparation method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102391376A true CN102391376A (en) | 2012-03-28 |
Family
ID=45858776
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2011100613327A Pending CN102391376A (en) | 2011-03-15 | 2011-03-15 | Fusion protein of human somatostatin tetradecapeptide and human serum albumin, and coding gene and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102391376A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109641036A (en) * | 2016-02-26 | 2019-04-16 | 安能泰制药有限公司 | The composition of fusion protein comprising albumin and its analog, its preparation and application |
| EP3503911A4 (en) * | 2016-08-26 | 2020-07-29 | Nal Pharmaceutical Group Limited | Compositions containing fusion protein of albumin and analogs thereof, methods for making and using the same |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1409517A2 (en) * | 2001-02-15 | 2004-04-21 | Board of Regents, The University Of Texas System | Fusion proteins based upon somatostatin receptors |
| CN101280019A (en) * | 2008-05-23 | 2008-10-08 | 江南大学 | Fused protein of human serum albumin and human granulocyte colony stimulating factor mutant, and preparation thereof |
| CN101280017A (en) * | 2008-05-23 | 2008-10-08 | 江南大学 | Fused protein of human brain natriuretic peptide diad [(BNP)2] and human serum albumin (HAS), and preparation thereof |
| CN101280018A (en) * | 2008-05-23 | 2008-10-08 | 江南大学 | Fused protein of mutant human interleukin-2 and human serum albumin, and preparation thereof |
-
2011
- 2011-03-15 CN CN2011100613327A patent/CN102391376A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1409517A2 (en) * | 2001-02-15 | 2004-04-21 | Board of Regents, The University Of Texas System | Fusion proteins based upon somatostatin receptors |
| CN101280019A (en) * | 2008-05-23 | 2008-10-08 | 江南大学 | Fused protein of human serum albumin and human granulocyte colony stimulating factor mutant, and preparation thereof |
| CN101280017A (en) * | 2008-05-23 | 2008-10-08 | 江南大学 | Fused protein of human brain natriuretic peptide diad [(BNP)2] and human serum albumin (HAS), and preparation thereof |
| CN101280018A (en) * | 2008-05-23 | 2008-10-08 | 江南大学 | Fused protein of mutant human interleukin-2 and human serum albumin, and preparation thereof |
Non-Patent Citations (1)
| Title |
|---|
| 赵媛媛: "内皮抑素-人血清白蛋白融合蛋白的表达及鉴定", 《中国优秀硕士学位论文全文数据库》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109641036A (en) * | 2016-02-26 | 2019-04-16 | 安能泰制药有限公司 | The composition of fusion protein comprising albumin and its analog, its preparation and application |
| EP3503911A4 (en) * | 2016-08-26 | 2020-07-29 | Nal Pharmaceutical Group Limited | Compositions containing fusion protein of albumin and analogs thereof, methods for making and using the same |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106220724B (en) | 21 recombinant protein of human fibroblastic growth factor and its preparation method and application | |
| CN106432509B (en) | A kind of 21 fusion protein of recombinant human fibroblast growth factor and its preparation method and application for treating metabolic disease | |
| CN101240033B (en) | Fusion protein of insulin secretion accelerating peptide and human serum albumin, and preparation method thereof | |
| CN102153653B (en) | Fusion protein of tumor blood vessel targeted polypeptide and tissue factor and preparation method thereof | |
| CN109295067A (en) | A kind of the moral paddy insulin precursor-gene and its expression of codon optimization | |
| CN101875700A (en) | Method for improving bioactivity of exendin fusion protein | |
| CN102796201B (en) | Erythropoietin mimetic peptide (EMP)-human serum albumin (HSA) fusion protein and preparation method thereof | |
| CN102295695A (en) | Recombinant human follicle stimulating hormone and preparation thereof | |
| CN101402688B (en) | Fusion protein, encoding gene and uses thereof | |
| CN101665798B (en) | Method for preparing recombinant human serum albumin and interferon alpha fusion protein | |
| CN1962695B (en) | GLP-1 infusion proteins, their preparation and use | |
| CN111303275A (en) | Recombinant human growth hormone, preparation method and pharmaceutical application thereof | |
| CN102391376A (en) | Fusion protein of human somatostatin tetradecapeptide and human serum albumin, and coding gene and preparation method thereof | |
| CN101514229B (en) | Human interferon alpha derivative and polyethylene glycol modified substance thereof | |
| CN103102418B (en) | The fusion rotein of granulocyte colony-stimulating factor (G-CSF) and mutant (mG-CSF) and human serum albumin the 3rd structural domain (3DHSA) and application | |
| CN102675467A (en) | Fusion protein of human somatostatin 28 peptide and human serum albumin, encoding gene of fusion protein and preparation method for fusion protein | |
| CN106222175A (en) | The optimized gene of channel catfish LEAP 2 mature peptide and the preparation method of recombiant protein thereof | |
| CN101538318A (en) | Signal peptide, coding genes thereof and application | |
| CN101928348A (en) | Human TSHR extracellular fusion protein and preparation method thereof | |
| CN101671390A (en) | Human interferon alpha derivatives and preparation and use of pegylated products thereof | |
| CN103864939A (en) | mGM-CSF/beta hCG fusion protein, and preparation method and application thereof | |
| CN100434522C (en) | Production method of recombination human growth hormone | |
| CN103601805B (en) | A kind of light chain of people FGF21 monoclonal antibody and variable region of heavy chain | |
| CN108752459A (en) | Cynoglossus semilaevis IGF-I albumen and its vivoexpression preparation method and application | |
| CN113956989B (en) | Genetically engineered bacterium secreting urate oxidase, construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20120328 |