CN102382825A - Human miR-1826 antisense nucleic acid and application thereof - Google Patents
Human miR-1826 antisense nucleic acid and application thereof Download PDFInfo
- Publication number
- CN102382825A CN102382825A CN2010102711226A CN201010271122A CN102382825A CN 102382825 A CN102382825 A CN 102382825A CN 2010102711226 A CN2010102711226 A CN 2010102711226A CN 201010271122 A CN201010271122 A CN 201010271122A CN 102382825 A CN102382825 A CN 102382825A
- Authority
- CN
- China
- Prior art keywords
- antisense oligonucleotide
- mir
- modification
- expression
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention discloses an antisense oligonucleotide for inhibiting a micoRNA-1826 expression and an application thereof. The antisense oligonucleotide is specifically combined with human miR-1826, and comprises a sequence which is complementary with at least 13 continuous nucleotides in a 5'-AUUGAUCAUCGACACUUCGAACGCAAU-3' nucleotide sequence, especially the sequence: 5'-AUUGCGUUCGAAGUGUCGAUGAUCAAU-3'. The antisense oligonucleotide disclosed by the invention can be ribonucleotide, deoxyribonucleotide or a chimera of the ribonucleotide and the deoxyribonucleotide, and can modify any one of the nucleotides in a chain. The miR-1826 antisense oligonucleotide disclosed by the invention can effectively inhibit the miR-1826 expression in human brain glioma cells, and inhibit the growth and the proliferation of the human brain glioma cells, so as to effectively treat the brain glioma and other tumours which have the miR-1826 high expression.
Description
Technical field
The present invention relates to biomedicine field.Particularly, the present invention relates to the purposes of a kind of microRNA (miRNA), especially relate to a kind of antisense oligonucleotide and application thereof that people microRNA-1826 (miR-1826) expresses that be used to suppress.This antisense oligonucleotide can be complementary with people miR-1826, thereby suppress the expression of people miR-1826 and play antineoplastic action.The invention still further relates to the pharmaceutical composition that contains this miRNA antisense oligonucleotide.
Background technology
MiRNAs is little non-coding RNA, and length is 20-28bp, is normally transcribed by rna plymerase ii (Pol II), and general initial product is the big pri-miRNA with cap sequence (7MGpppG) and polyadenylic acid tail (AAAAA).These pri-miRNA are processed into the pre-miRNA precursor product that 70 Nucleotide are formed under the effect of RNase III Drosha and its cofactor Pasha.RAN-GTP and exportin 5 are transported to this precursor molecule in the tenuigenin.Subsequently, another RNaseIII Dicer shears it and produces the two strands that is about 22 length of nucleotides.This two strands is directed in (miRISC) complex body very soon, wherein contains Argonaute albumen, and sophisticated strand miRNA is retained in this mixture.Sophisticated miRNA is attached to the site of its complementary mRNA and expresses through two kinds of machine-processed negative regulator genes that depend on the sequence complementarity, on the protein translation level, suppresses its expression with the incomplete complementary miRNA of said target mrna.Yet, evidence suggests also that recently these miRNA also might influence the stability of mRNA.Use the miRNA binding site of this mechanism to hold non-translational region at 3 ' of mRNA usually.If miRNA and target site complementary fully (perhaps almost completely complementary), the combination of these miRNA often causes the degraded of target molecule mRNA so.MiRNAs is quite conservative in spore, and the miRNAs that in animal, plant and fungi etc., finds expresses all has strict tissue specificity and sequential property.
At present, have only the biological function of very little a part of miRNAs to be illustrated.These miRNAs regulate cell growth and tissue differentiation, and are relevant with biological growth and development.A series of research shows: miRNAs plays a significant role in processes such as cell growth and apoptosis, hemocyte differentiation, homeobox generegulation, neuronic polarity, insulin secretion, the formation of brain form, heart generation, late embryogenesis growth.For example, miR-273 participates in the nervous system development process of nematode; MiR-430 participates in the brain development of zebra fish; MiR-181 control Mammals hematopoietic cell is divided into the B cell; MiR-375 regulates mammalian islet cell and grows and insulin secretion; MiR-143 works in the adipocyte differentiation; MiR-196 has participated in the Mammals four limbs and has formed; MiR-1 is relevant with heart development.Other has the researchist to find that many neural miRNAs receive sequential and regulate in pallium is cultivated, and shows its mRNA that possibly control compartmentation translation.
MiRNA expresses relevant with multiple cancer, and these genes possibly play tumor suppressor gene or oncogene effect.In B cell chronic lymphatic leukemia (CLL), find to have the change of miRNA expression level at first, in various human tumors, all detect the miRNA changes of expression level subsequently successively.Discover that it is relevant that miRNAs and tumour form, and can bring into play the effect (like miR-15a and miR-16-1) of tumor suppressor gene, can play the effect (like miR-155 and miR-17-92 bunch) of oncogene again.Think at present, in tumour cell, ripe body of some miRNA or precursor expression horizontal abnormality, and the miRNA of abnormal expression plays a role through influencing the said target mrna translation, participates in neoplastic process, and plays an important role.Receive the regulation and control of let-7 family like the Ras proto-oncogene, the BCL2 anti-apoptotic genes expression receives miR-15a-miR-16-1 bunch of regulation and control, and the E2F1 transcription factor receives miR-17-92 bunch of regulation and control, and the BCL6 anti-apoptotic genes expression receives the regulation and control of miR-127 etc.The down-regulated expression of miRNAs also has substantial connection with tumour, and this is indicating that miRNA has the function of oncogene.For example, miR-143 and miR-1826 obviously downward modulation in colorectal carcinoma.What is interesting is that the precursor molecule of its hairpin structure content in tumour and healthy tissues is similar, this shows that the down-regulated expression of miRNAs possibly be because its course of processing is damaged.But the tumor suppressor gene function of miR-143 and miR-1826 possibly not only be confined to colorectal carcinoma, also obviously downward modulation of its expression amount in clones such as mammary cancer, prostate cancer, uterus carcinoma, lymphatic cancer.Another report shows that miR-21 expresses increase in glioblastoma multiforme.The expression amount of this gene in tumor tissues than high 5-100 in healthy tissues doubly.
MiRNAs is natural antisense acting factor, can regulate and control the several genes relevant with propagation with eukaryote existence.Aspect oncotherapy, the application prospect of miRNA is bright.Utilizing miRNA as aspect the treatment target spot, existing experimental data support:, the variation of miRNA express spectra occurs as in the process of gemcitabine (gemcitabine) treatment; The expression level (as making miR-21 cross expression) of regulation and control part miRNA can be promoted the susceptibility of cholangiocarcinoma cell to chemotherapeutics.MiRNAs through in the possible effectively deactivation tumour of introducing and the miRNA complementary synthetic antisense oligonucleotide---anti-miRNA oligonucleotide (AMOs)---with oncogene characteristic delays its growth.Clinically, can methylate or lock nucleic acid modified antisense oligonucleotide administrations such as (LNA) through 2 '-O-frequent or that continue and make the miRNA inactivation.These modifications make oligonucleotide more stable, and are lower than other treatment means toxicity.Use antagomirs (with SUV link coupled AMOs), can effectively suppress the miRNA activity in Different Organs behind the injection mouse, thereby possibly become a kind of medicine likely.Opposite, cross and express the miRNAs that those have the tumor suppressor gene effect, like let-7 family, also can be used to treat some specific tumour.
Antisense oligonucleotide (Flanagan WM.Antisense comes of age.Cancer&Metastasis Reviews 1998; 17 (2): 169-76) be meant one section can with the Nucleotide of the base complementrity of its target gene.Antisense oligonucleotide can be answered expression of gene by inhibitory phase.
People microRNA-1826 (hsa-mir-1826) is positioned at karyomit(e) No. 16; Precursor sequence is AUUGAUCAUCGACACUUCGAACGCAAUUGCAGCCCGGGUUCCUCCCAGGGCUUUGC CUGUCUGAGCGUCGCUUGCCGAUCAGUAG, only contains a ripe microRNA:hsa-miR-1826 (sequence is AUUGAUCAUCGACACUUCGAACGCAAU).
People such as Zhou are utilizing microarray research 5-FU and oxaliplatin (L-OHP) to colon cancer cell line influence discovery, and miR-1826 is downward modulation (Zhou, J., Y.Zhou, et al.2009) after giving anticarcinogen.In other tumours, also do not report about the function of miR-1826 and the research of expression level.
Nearly 30 years although the complex therapy of tumour is very general clinically, is main with operation; Chemicotherapy is that the complex therapy of assisting is also not obvious to the survival rate raising of tumour patient; Overall survival rate was still lower in 5 years, paced up and down about 30%～55%, did not significantly improve; 5 years survival rates of middle and advanced stage patient are lower, are about 20%.And all there are limitation separately in these methods, particularly to middle and advanced stage and recurrence patient unsatisfactory curative effect, to poorer with metastasis person's curative effect.Therefore, seeking safer and more effective treatment approach is the difficult problem that raising tumour patient survival rate and life quality are needed to be resolved hurrily.
Summary of the invention
The subject matter that the present invention will solve just provides the antisense oligonucleotide (suppressor factor) of a kind of new miR-1826; Be used for efficient, low toxicity or suppress the expression of miR-1826 innocuously; And then treatment and miR-1826 over-expresses diseases associated, comprise various noumenal tumours, various white blood disease etc.
Another problem that the present invention will solve just provides the purposes of above-mentioned antisense oligonucleotide in the medicine of the relative disease of preparation treatment miR-1826 over-expresses.
The problem again that the present invention will solve provides the pharmaceutical composition that comprises above-mentioned antisense oligonucleotide.
The inventor has designed and synthesized the antisense nucleic acid oligomer of a species specificity to miR-1826 through extensive and deep research, and checking has the miR-1826 of inhibition expression and cytostatic effect in culturing cell.Research shows that these antisense nucleic acides can suppress the growth and the malignant proliferation ability of tumour cell.
The present invention has designed a kind of antisense nucleic acid molecule that can specificity be incorporated into miR-1826, in culturing cell U87/MG, and the antisense nucleic acid cell growth ability that checking suppresses the miR-1826 expression specificity, the influence of multiplication capacity.Antisense nucleic acid molecule length can comprise 13～27 nucleotide residues; Inhibition growth of human tumor cells ability in various degree, the characteristic of multiplication capacity are all arranged; Wherein the shortest antisense nucleic acid length is 13 bases, and the antisense nucleic acid of different lengths all has good growth of tumour cell and proliferation inhibition activity.Therefore, above-mentioned antisense nucleic acid all can be used to prepare the preparation that suppresses growth of tumour cell ability, multiplication capacity, the wherein tumour cell of preferred miR-1826 high expression level.Accomplished the present invention on this basis.
First aspect of the present invention provides the antisense oligonucleotide of a kind of miR-1826, and said antisense oligonucleotide suppresses the expression of miR-1826 in people's cell.Usually, continuous 13～27 nucleotide sequence complementations among said antisense oligonucleotide and the 5 '-AUUGAUCAUCGACACUUCGAACGCAAU-3 '.In a preferred embodiment of the invention, the length of said antisense oligonucleotide is 18～23 Nucleotide.More preferably, the sequence of said antisense oligonucleotide is 5 '-AUUGCGUUCGAAGUGUCGAUGAUCAAU-3 '.
At present, RNA is higher than the avidity of DNA and miRNA hybridization with the hybridization avidity of miRNA in the nucleic acid hybridization, has very high pharmaceutical use.But artificial-synthetic DNA's the cost cost than synthetic RNA far away is low, also has good market potential.And can adopt the chimeric antisense nucleic acid that forms that links to each other of ribose RNA monomer and ribodesose dna single body to develop as medicine.A series of antisense oligonucleotide molecules of the present invention's design both can be DNA, also can be RNA, can also be the mosaics of DNA and RNA.Above-mentioned molecule all has the activity that suppresses the miR-1826 expression.
The antisense nucleic acid of the present invention's design, it is active that its sequence has specific biological, and its antisense nucleic acid institute complementary length for the site of a certain gene complementation has much relations; Long like complementary; Then BA can be higher, and suppressing effect also can be more better, increasing or reducing an antisense nucleic acid that is complementary to same gene locus to several bases; Equally also have BA in various degree, also can reach in various degree inhibition growth of tumour cell and the effect of propagation.Research of the present invention shows, weak point can reach 13 bases and still have the effect that miR-1826 expresses that suppresses.In the antisense nucleic acid research, various chemical modification methods are a lot.The present invention adopts and is selected from the one or more combination modified antisense nucleic acid in ribose modification, base modification and the phosphoric acid backbone modification; Preclinical studies such as the pharmacology of the antisense nucleic acid of sulfo-, methoxy modification mode, pharmacokinetics, toxicology are that research is the most comprehensive in the various chemically modified antisense nucleic acides; Modified antisense nucleic acid can prevent effectively in vivo in the human body that a large amount of exonucleases cut the enzyme of antisense nucleic acid and degrade, thereby avoids antisense nucleic acid to lose due BA.The sulfo-antisense nucleic acid also can excite the activity of RNA enzyme in addition, the RNA chain of degraded and its hybridization, and therefore preferred these the two kinds antisense nucleic acides of modifying modes are used in experiment.Will be clear that any modifying method that can increase antisense nucleic acid stability and bioavailability can use, as SUV modify, PEG modification etc.Antisense nucleic acid modification preferred of the present invention is selected from one or more in thio-modification, 2 '-methoxyl group modification and the SUV modification.Most preferably adopt following modification mode: all Nucleotide carry out 2 '-methoxyl group to be modified, and two Nucleotide of 5 ' end carry out thio-modification, and four Nucleotide of 3 ' end carry out thio-modification and connect SUV at 5 ' or 3 ' end.
Above-mentioned antisense nucleic acid of the present invention has the effect that suppresses the miR-1826 expression.When with after above-mentioned antisense nucleic acid transfection is in the cell strain U87/MG that expresses miR-1826, can effectively suppress the growth and the malignant proliferation ability of U87/MG cell.
The present invention also provides a kind of pharmaceutical composition, and it contains oligonucleotide of the present invention and the pharmaceutically acceptable carrier or the vehicle of safe treatment significant quantity.This type drug administration carrier includes but not limited to the various carriers that can be used for the nucleic acid administration, like liposome, degradable macromolecular compound, salt solution, damping fluid, glucose, water, glycerine, ethanol and combination thereof.Pharmaceutical prepn should be complementary with administering mode.
Said " significant quantity " is meant and can produces function or amount active and that can be accepted by people and/or animal to people and/or animal.
Said " pharmaceutically acceptable " composition is applicable to people and/or animal and does not have excessive bad side reaction (like toxicity, stimulation and transformation reactions), the material of rational benefit/risk ratio is promptly arranged.
In the third aspect of the invention; The purposes of antisense oligonucleotide of the present invention is provided; Be used to prepare the medicine of treating following disease: treatment human body and miR-1826 cross the expression diseases associated, comprise various noumenal tumours (particularly cerebral glioma), various white blood disease etc.
As used herein, " antisense oligonucleotide " refers to the nucleotide oligomer of antisense.Antisense oligonucleotide through base complementrity (G-C) pairing forms three chains (anti-gene) with double-stranded DNA for A-T, A-U, or forms heteroduplex (antisense) with single stranded RNA, thus the processing and the translation of duplicating, transcribing or transcribing back mRNA of blocking gene.Simultaneously, double-stranded RNA can be degraded by intracellular ribonuclease H (RNaseH), thereby more effectively blocks target gene expression.Because GEM 132 can only combine with the target sequence of reverse complemental, has the specificity height, the characteristics that spinoff is little.
The not special restriction of the length of antisense oligonucleotide of the present invention, in general, in order to reach the specificity of hybridization, the Nucleotide that antisense oligonucleotide needs at least 13 monomers to form.Usually the length of antisense oligonucleotide is 13～35bp, and for miRNA, that preferable is 18～27bp.
Description of drawings
Fig. 1 has shown that the miR-1826 antisense oligonucleotide suppresses the expression of miR-1826 in the tumour cell U87/MG cell, and three lines are results of revision test among Figure 1A～D.A is the expression of transfection miR-1826 antisense oligonucleotide (5 '-AUUGCGUUCGAAGUGUCGAUGAUCAAU-3 ') back miR-1826, and B is the expression of transfection negative control antisense oligonucleotide (5 '-CAGUACUUUUGUGUAGUACAA-3 ') back miR-1826; C is the expression of internal control gene U6 behind the commentaries on classics miR-1826 antisense oligonucleotide; D is the expression of internal control gene U6 behind the transfection negative control antisense oligonucleotide; E is that miR-1826 suppresses the effect histogram behind the transfection antisense oligonucleotide; X-coordinate is the sample that is detected; The miR-1826 expression behind " suppressor factor " expression transfection miR-1826 antisense oligonucleotide wherein, miR-1826 expression behind " negative control " expression transfection negative control.
Fig. 2 has shown that the miR-1826 antisense oligonucleotide suppresses the growth and the propagation of tumour cell U87/MG cell, the U87/MG cell behind A, B the be transfection negative control of FAM mark; C is a U87/MG cell state behind the transfection negative control; D is transfection miR-1826 antisense oligonucleotide (5 '-AUUGCGUUCGAAGUGUCGAUGAUCAAU-3 ') back U87/MG cell state.
Embodiment
Antisense oligonucleotide of the present invention, continuous 13～27 nucleotide sequence complementations among its sequence and 5 '-AUUGAUCAUCGACACUUCGAACGCAAU-3 ', and also not complementary with the RNA sequence of other genes.In a preferred embodiment of the invention, the sequence of said antisense oligonucleotide is 5 '-AUUGCGUUCGAAGUGUCGAUGAUCAAU-3 '.Antisense oligonucleotide provided by the invention can be modified outcome; It contains at least two, and at least 4 usually, preferable at least 6; At least 8 better Nucleotide do not have the Nucleotide of the modification of toxic side effects, and said modification mode comprises the methoxyl group replacement of 2 '-position, thio-modification etc.In order to increase the cellular uptake rate of antisense oligonucleotide, can also on the basis of above-mentioned modification, carry out SUV and modify or the PEGization modification antisense oligonucleotide.Oligonucleotide after the above-mentioned modification can continue effectively to match with target sequence, and has the longer transformation period in vivo than common Yeast Nucleic Acid or thymus nucleic acid without modifying.
The present invention has following advantage:
1, antisense oligonucleotide acts on specific target site, the site of non-specific binding seldom, specificity is high;
2, antisense oligonucleotide provided by the invention is through suitable chemically modified, has that toxicity is low, spinoff is little and characteristics such as long half time;
3, antisense oligonucleotide provided by the invention has the good restraining effect, the inhibiting rate of the expression of miR-1826 is reached more than 95%, to the inhibiting rate of growth of tumour cell near 40%.
To combine embodiment and accompanying drawing to describe the present invention in further detail below.Yet should be appreciated that and enumerate these embodiment, and be not to be used for limiting scope of the present invention just for an illustration.
Embodiment
At first, by Shanghai JiMa pharmacy Technology Co., Ltd's synthetic antisense oligonucleotide, sequence is: 5 '-AUUGCGUUCGAAGUGUCGAUGAUCAAU-3 '.The used sequence that relates in an embodiment is synthetic by Shanghai JiMa pharmacy Technology Co., Ltd.
Carry out real-time quantitative fluorescence and detect, the oligonucleotide sequence that wherein relates to is synthetic by Shanghai JiMa pharmacy Technology Co., Ltd, and concrete experimental procedure comprises:
Cell cultures: U87/MG cell (available from typical case's culture collection council of Chinese Academy of Sciences cell bank), 10%FBS-DMEM substratum (FBS is available from Hyclone, and DMEM is available from Gibco) is cultivated, and 37 ℃, 5%CO
2Cultivate.
Cell transfecting:
1) transfection previous day, with not containing antibiotic culture medium inoculated culturing cell in right amount, the degree of converging of cell reaches 30～50% when making transfection in 24 orifice plates;
2) the transfection sample is prepared oligomer-Lipofecta mine according to following method
TM2000 mixtures:
A.
substratum (Gibco) that does not contain serum with 50 μ l dilutes the negative control of miR-1826 antisense oligonucleotide (5 '-AUUGCGUUCGAAGUGUCGAUGAUCAAU-3 '), negative control (5 '-CAGUACUUUUGUGUAGUACAA-3 '), FAM mark respectively; Final concentration is 50nM; Mixing gently, each transfection are established 3 multiple holes;
B. mixing Lipofecta mine gently before using
TM2000 (Invitrogen) get 2 μ l then and are diluted to 50 μ l's
In the substratum, at room temperature hatch 5min gently behind the mixing;
C. after hatching 5min, the Lipofecta mine of dilution
TM2000 mix with the GEM 132 and the contrast of dilution respectively, at room temperature hatch 20min gently behind the mixing, to allow the formation of mixture;
3) mixture is joined in each hole that comprises cell and substratum, the culture plate that rocks back and forth lightly mixes;
4) 37 ℃, 5%CO
2The incubator incubated overnight is changed the substratum that contains 10% foetal calf serum and is continued to cultivate 24h.
Total RNA extracts:
1) centrifugal collecting cell adds 500 μ l Ezol (Invitrogen) in the centrifuge tube, and with the centrifuge tube mixing that turns upside down, room temperature is placed 10min.
2) add the special-purpose trichloromethane of 200 μ l RNA (worker is given birth in Shanghai), the mixing that acutely turns upside down, the thorough mixing of the liquid in centrifuge tube becomes the oyster white shape.
3) room temperature is placed 5min, the centrifugal 15min of 12000rpm.
4) carefully supernatant is transferred in another clean 1.5ml centrifuge tube, avoids inhaling middle level albumen phase and lower floor's organic phase.
5) add the special-purpose Virahol (worker is given birth in Shanghai) of RNA of 500 μ l precoolings in the supernatant, room temperature is placed 5min.The centrifugal 10min of 10000rpm.
6) carefully abandon most supernatant, add 75% special-purpose ethanol (worker is given birth in Shanghai) washing precipitation of 1ml RNA, the centrifugal 10min of 10000rpm.
7) carefully abandon most supernatant, place room temperature to dry ethanol, every pipe adds 20 μ l DEPC water dissolution, mixing.
The RNA rt:
The RNA that above-mentioned extracting is obtained carries out rt with U6 and two kinds of special reverse transcriptase primers of RNA of hsa-miR-1826 respectively, preparation cDNA template.Damping fluid and enzyme used in the rt are the Promega Company products; Primer sequence is synthetic by Shanghai JiMa pharmacy Technology Co., Ltd, miR-1826RT primer: 5 '-GTCGGGTCCAGAGCAGGGTCCGAGGTACACGTTCGCTCTGGACCCGACATTGCGTT CG-3 '.
(i). the rt system:
(ii). the reverse transcription reaction condition:
Reaction conditions is: 26 ℃ of 30min; 42 ℃ of 30min; 85 ℃ of 10min.
Fluorescence quantitative PCR detection:
(1) dilution of .cDNA template:
With 3 times of the cDNA dilutions that obtains behind the above-mentioned rt, in the system of 20 μ l, add the ddH that 40 μ l do not have RNase/DNase
2O, mixing.
(2). (primer sequence is synthetic by Shanghai JiMa pharmacy Technology Co., Ltd for the quantitative fluorescent PCR system; MiR-1826FP primer: 5 '-TCCGCATTGATCATCGACA-3 '; MiR-1826RP primer: 5 '-CAGAGCAGGGTCCGAGGTA-3 '):
| Reagent name | Consumption/ |
| 2×PCR?Master?Mix | 10μl |
| F?Primer(20μM) | 0.2μl |
| R?Primer(20μM) | 0.2μl |
| Template | 2μl |
| RTaq archaeal dna polymerase (5U/ul) | 0.2μl |
| ddH 2O | Add to 20 μ l |
(3). reaction conditions:
(i)95℃3min；
(ii)95℃30s；
(iii)62℃40s；
(iv)72℃30s；
Ii to the iv goes on foot totally 40 circulations.
Fluorescence quantitative PCR detection result shows that antisense oligonucleotide has the good restraining effect.Fig. 1 has shown that the miR-1826 antisense oligonucleotide suppresses the expression of miR-1826 in the tumour cell U87/MG cell, and three lines are results of revision test among Figure 1A～D.A is the expression of transfection miR-1826 antisense oligonucleotide (5 '-AUUGCGUUCGAAGUGUCGAUGAUCAAU-3 ') back miR-1826, and B is the expression of transfection negative control antisense oligonucleotide (5 '-CAGUACUUUUGUGUAGUACAA-3 ') back miR-1826; C is the expression of internal control gene U6 behind the commentaries on classics miR-1826 antisense oligonucleotide; D is the expression of internal control gene U6 behind the transfection negative control antisense oligonucleotide; E is that miR-1826 suppresses the effect histogram behind the transfection antisense oligonucleotide; X-coordinate is the sample that is detected; The miR-1826 expression behind " suppressor factor " expression transfection miR-1826 antisense oligonucleotide wherein, miR-1826 expression behind " negative control " expression transfection negative control.The result shows that antisense oligonucleotide has the obvious suppression effect to the expression of miR-1826.
The oligonucleotide sequence that wherein relates to is synthetic by Shanghai JiMa pharmacy Technology Co., Ltd.
Cell cultures:
U87/MG cell (available from typical case's culture collection council of Chinese Academy of Sciences cell bank), 10%FBS-DMEM substratum (FBS is available from Gibco, and DMEM is available from Hyclone) is cultivated, and 37 ℃, 5%CO
2Cultivate.Collect the good U87/MG cell of growth conditions, centrifugal counting is with 2 * 10
3Every hole is laid in 96 orifice plates, and 37 ℃, 5%CO
2Cultivate 24h.
Transfection:
1) transfection previous day, with not containing antibiotic culture medium inoculated culturing cell in right amount, the degree of converging of cell reaches 30～50% when making transfection in 96 orifice plates;
2) the transfection sample is prepared oligomer-Lipofecta mine according to following method
TM2000 mixtures:
A.
substratum (Gibco) that does not contain serum with 25 μ l dilutes the negative control of miR-1826 antisense oligonucleotide (5 '-AUUGCGUUCGAAGUGUCGAUGAUCAAU-3 '), negative control (5 '-CAGUACUUUUGUGUAGUACAA-3 '), FAM mark respectively; Final concentration is 50nM after adding in the hand-hole; Mixing gently, each transfection are established 3 multiple holes;
B. mixing Lipofecta mine gently before using
TM2000 (Invitrogen) get 0.25 μ l then and are diluted to 25 μ l's
Substratum is at room temperature hatched 5min gently behind the mixing;
C. after hatching 5min, the Lipofecta mine of dilution
TM2000 mix with the GEM 132 and the contrast of dilution respectively, at room temperature hatch 20min gently behind the mixing, to allow the formation of mixture;
3) mixture is joined in each hole that comprises cell and substratum, the culture plate that rocks back and forth lightly mixes; The final concentration of GEM 132 and contrast is 50nM.
4) 37 ℃, 5%CO
2After incubator continued to hatch 72 hours, microscopic examination U87/MG cell was taken a picture.
As shown in Figure 2, transfection is after 72 hours, surpass 80% U87/MG cell success transfection the negative control of FAM mark (figure A, B); Behind the transfection negative control, the U87/MG cell is complete, light transmission strong (figure C); And most of U87/MG necrocytosis behind the transfection miR-1826 antisense oligonucleotide (figure D).
Cytotoxicity experiment based on MTT:
The cell that upwards obtains in the step adds MTT (Sigma) 5mg/ml (the saline water preparation with 0.9%) for preparing, and every hole adds 20 μ l, 37 ℃, 5%CO
2Hatch after 4 hours to inhale and remove substratum and MTT, every hole adds DMSO 100 μ l and reads the absorbance of OD570-OD630 through ELIASA:
Calculate inhibiting rate:
Calculating the miR-1826 antisense oligonucleotide is 38.76 ± 11.53% to human neuroglia glucagonoma cell line cell growth inhibition ratio.The result shows: miR-1826 antisense oligonucleotide provided by the invention has the good restraining effect, to the inhibiting rate of U87/MG growth near 40%.MiR-1826 antisense oligonucleotide of the present invention can effectively suppress miR-1826 expression in the human glioma cell, suppresses its growth and propagation, thereby effectively treats the tumour of cerebral glioma and other miR-1826 high expression levels.
Claims (10)
1. an antisense oligonucleotide is characterized in that, said antisense oligonucleotide comprise with 5 '-AUUGAUCAUCGACACUUCGAACGCAAU-3 ' in continuous 13～27 nucleotide sequence complementary sequences.
2. antisense oligonucleotide as claimed in claim 1 is characterized in that said antisense oligonucleotide comprises sequence 5 '-AUUGCGUUCGAAGUGUCGAUGAUCAAU-3 '.
3. antisense oligonucleotide as claimed in claim 1 is characterized in that, said antisense oligonucleotide is the mosaic of ribonucleotide, deoxyribonucleotide or ribonucleotide and deoxyribonucleotide.
4. like each described antisense oligonucleotide in the claim 1～3, it is characterized in that said antisense oligonucleotide is further modified.
5. antisense oligonucleotide as claimed in claim 4 is characterized in that, said modification is selected from one or more the combination in ribose modification, base modification and the phosphoric acid backbone modification.
6. antisense oligonucleotide as claimed in claim 5 is characterized in that, said modification is selected from one or more in thio-modification, 2 '-methoxyl group modification and the SUV modification.
7. antisense oligonucleotide as claimed in claim 6; It is characterized in that; All Nucleotide carry out 2 '-methoxyl group to be modified, and two Nucleotide of 5 ' end carry out thio-modification, and four Nucleotide of 3 ' end carry out thio-modification and connect SUV at 5 ' or 3 ' end.
8. be used to prepare the purposes of medicine of the relative disease of treatment miR-1826 over-expresses like each described antisense oligonucleotide in the claim 1～7.
9. purposes as claimed in claim 8 is characterized in that, the relative disease of said miR-1826 over-expresses is a cerebral glioma.
10. a pharmaceutical composition is characterized in that, contains each described antisense oligonucleotide and pharmaceutically acceptable carrier in the claim 1～7 of treating significant quantity.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010271122 CN102382825B (en) | 2010-09-01 | 2010-09-01 | Human miR-1826 antisense nucleic acid and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010271122 CN102382825B (en) | 2010-09-01 | 2010-09-01 | Human miR-1826 antisense nucleic acid and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102382825A true CN102382825A (en) | 2012-03-21 |
| CN102382825B CN102382825B (en) | 2013-02-27 |
Family
ID=45822657
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201010271122 Active CN102382825B (en) | 2010-09-01 | 2010-09-01 | Human miR-1826 antisense nucleic acid and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102382825B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113201544A (en) * | 2021-05-20 | 2021-08-03 | 大连海洋大学 | miR-210 simulant, preparation method and application of miR-210 simulant as antibiotic substitute for breeding |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101507821A (en) * | 2009-03-20 | 2009-08-19 | 天津医科大学总医院 | Medicine for treating malignant cerebroma and breast cancer by combining gene and chemotherapy medicine and preparation method thereof |
| WO2009149182A1 (en) * | 2008-06-04 | 2009-12-10 | The Board Of Regents Of The University Of Texas System | Modulation of gene expression through endogenous small rna targeting of gene promoters |
-
2010
- 2010-09-01 CN CN 201010271122 patent/CN102382825B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009149182A1 (en) * | 2008-06-04 | 2009-12-10 | The Board Of Regents Of The University Of Texas System | Modulation of gene expression through endogenous small rna targeting of gene promoters |
| CN101507821A (en) * | 2009-03-20 | 2009-08-19 | 天津医科大学总医院 | Medicine for treating malignant cerebroma and breast cancer by combining gene and chemotherapy medicine and preparation method thereof |
Non-Patent Citations (1)
| Title |
|---|
| JANA NOVAKOVA ET AL.: "MicroRNA involvement in glioblastma pathogensis", 《BIOCHEMICAL AND BIOPHYSICAL RESEARCH》, vol. 386, no. 1, 14 August 2009 (2009-08-14), pages 1 - 5 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113201544A (en) * | 2021-05-20 | 2021-08-03 | 大连海洋大学 | miR-210 simulant, preparation method and application of miR-210 simulant as antibiotic substitute for breeding |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102382825B (en) | 2013-02-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102080086B (en) | Human miR-133a antisense nucleic acid and application thereof | |
| CN102382824A (en) | Human miR-145 antisense nucleic acid and application thereof | |
| CN102533755A (en) | Human miR-328 antisense nucleic acid and application thereof | |
| CN102140468A (en) | Human miR-185* antisense nucleic acid and application thereof | |
| CN102031256B (en) | Human miR-485-5p antisense nucleic acid and application thereof | |
| CN102080083B (en) | Human miR-149 antisense nucleotide and application thereof | |
| CN102140469B (en) | Human miR (microRNA)-1233 antisensenucleic acid and application thereof | |
| CN102080085B (en) | Human miR-193b antisense nucleotide and application thereof | |
| CN102080082B (en) | Human miR-129* antisensenucleic acid and applications thereof | |
| CN102031254B (en) | Human miR-150 antisense nucleic acid and application thereof | |
| CN102382825B (en) | Human miR-1826 antisense nucleic acid and application thereof | |
| CN102140462B (en) | Human miR-1260 antisense nucleic acid and application thereof | |
| CN102140470B (en) | Human miR-1236 antisense ribonucleic acid and application thereof | |
| CN102140467B (en) | Human miR-365 antisense nucleic acid and application thereof | |
| CN102140464B (en) | Human miR-1238 antisense nucleic acid and applications thereof | |
| CN102140465B (en) | Human miR-1249 antisense nucleic acid and application thereof | |
| CN102031255B (en) | Antisense nucleic acid of human miR-223 and applications of antisense nucleic acid | |
| CN102643811A (en) | Human miR-1229 antisense oligonucleotide and application thereof | |
| CN102080084B (en) | Human miR-125a-5p antisense nucleotide and application thereof | |
| CN102643807B (en) | Antisense oligodeoxyncleotide of human miR-484 and application thereof | |
| CN102382823B (en) | Human miR-515-5p antisense oligod-eoxynucleotide and applications thereof | |
| CN102140466B (en) | Human miR-1825 antisense nucleic acid and application thereof | |
| CN102041256B (en) | Human miR-486-5p antisense nucleic acid and application thereof | |
| CN102643813A (en) | Human miR-504 antisense oligonucleotide and application thereof | |
| CN102643810A (en) | Human miR-299-5p antisense oligonucleotide and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |