CN102363816B - Reagent for detecting enterohemorrhagic escherichia coli by using cross primer nucleic acid isothermal amplification technology, amplification method and detection method for enterohemorrhagic escherichia coli - Google Patents
Reagent for detecting enterohemorrhagic escherichia coli by using cross primer nucleic acid isothermal amplification technology, amplification method and detection method for enterohemorrhagic escherichia coli Download PDFInfo
- Publication number
- CN102363816B CN102363816B CN 201110382763 CN201110382763A CN102363816B CN 102363816 B CN102363816 B CN 102363816B CN 201110382763 CN201110382763 CN 201110382763 CN 201110382763 A CN201110382763 A CN 201110382763A CN 102363816 B CN102363816 B CN 102363816B
- Authority
- CN
- China
- Prior art keywords
- nucleic acid
- escherichia coli
- seq
- primer
- enterohemorrhagic escherichia
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Abstract
The invention discloses a reagent for detecting enterohemorrhagic escherichia coli by using a cross primer nucleic acid isothermal amplification technology, an amplification method and a detection method for enterohemorrhagic escherichia coli. Five primer group sequences are designed, namely 5'CAGTCGTACGGGGATGCAG, 5'TCAGCAGTCATTACATAAG, 5'GCTCTTGCCACAGACTGCGTC, 5'AGGTTCCGCTATGCGACAT and 5'GCTCTTGCCACAGACTGCGTCAGTTTCGCCATTCGTTGACTACTT. Aiming at the enterohemorrhagic escherichia coli O157:H7 bacteria, the defects in the prior art are overcome by the reagent, and a method for detecting the enterohemorrhagic escherichia coli quickly at low cost by using the cross primer nucleic acid isothermal amplification technology is provided.
Description
Technical field
The present invention relates to the bacteriologic test technology, specifically use cross primer nucleic acid constant-temperature amplification technology for detection EHEC O157:H7 reagent and amplification method and detection method.
Background technology
EHEC O157:H7 belongs to the enterobacteriaceae Escherichia, is the main serotype of EHEC, the hemorrhagic colitis that can cause.Nineteen eighty-two is strangled Gang Zhou and Michigan State in U.S. Russia, and is separated and name in the Feces of Patients of the food poisoning that causes because of edible hamburger.According to the Center for Disease Control (CDC) report, 20,000 many cases patients are found in the annual whole nation approximately.Death toll 200-500 people is found or causes to break out with popular in the whole world more than 20 country in five large states later on successively.Found so far from 82 years, it is the last ten-days period in May, 97 that largest once outburst occurs, and 6 mass food poisoning events occur in succession for tens middle schools, county such as Japanese Okayama, Hiroshima and kindergarten, and number is 1600 people nearly, cause 3 death of child, hospitalized child reaches 80 people.Japanese celestial platform and deer island form Poisoning Number and cross ten thousand people simultaneously, dead 11 people, and the burst that involves 44 Dou Fu counties is poisoned by food, and causes global concern.The countries and regions such as the U.S., Canada, Sweden, Australia, Scotland, Wales have also been reported sporadic infection and outbreak of epidemic in succession in addition.China was separated to EHEC O157:H7 in 1988 first.From existing epidemiology survey data, also there is Sporadic cases in China, does not also have the report of eruption and prevalence.Also by monitoring, successively from ox, pig, sheep, ight soil, found EHEC O157:H7 in the food such as meat in recent years.Detecting fast and accurately EHEC O157:H7 is the precondition of effectively prevention and control Enterobacteriaceae infections.Along with molecular biological development, the method for determining bacteria in the real work on traditional simple biochemical test level to molecular biological method such as the technical developments such as PCR, probe hybridization.Recent development cross primer nucleic acid constant-temperature amplification technology out is a kind of more efficient molecular detecting method, by the approval of a lot of countries, and greatly develops.
Summary of the invention
For EHEC O157:H7, the present invention has overcome shortcoming of the prior art, provide a kind of quick, convenient, cheaply use cross primer nucleic acid constant-temperature amplification technology for detection EHEC O157:H7 reagent and amplification method and detection method.
In order to solve the problems of the technologies described above, the technical solution used in the present invention is: a kind of reagent that uses cross primer nucleic acid constant-temperature amplification technology for detection EHEC comprises following five primers:
SEQ ID NO.1：5’ CAGTCGTACGGGGATGCAG
SEQ ID NO.2：5’ TCAGCAGTCATTACATAAG
SEQ ID NO.3：5’ GCTCTTGCCACAGACTGCGTC
SEQ ID NO.4：5' AGGTTCCGCTATGCGACAT
SEQ ID NO.5：5' GCTCTTGCCACAGACTGCGTCAGTTTCGCCATTCGTTGACTACTT
Wherein 5 ' of primer sequence 3 end has fluorescein isothiocyanate group mark, and 5 ' end of primer sequence 4 has vitamin H fluorophor mark.
Each component composition is as follows in the nucleic acid amplification reaction system:
Constituent concentration application of sample amount
Bst enzyme 5U/ μ L 1 μ L
Bst enzyme buffer liquid-5 μ L
SEQ ID NO.1： 10μmol/L 1μL
SEQ ID NO.2： 10μmol/L 1μL
SEQ ID NO.3： 10μmol/L 0.5μL
SEQ ID NO.4： 10μmol/L 0.5μL
SEQ ID NO.5： 10μmol/L 0.2μL
Distilled water 13.8 μ L
Cumulative volume 25 μ L
Wherein the composition of Bst enzyme buffer liquid is 20 mM Tris-HCl, 10 mM (NH
4)
2SO
4, 10 mM KCl, 2 mM MgSO
4, mass percent 0.1 % Triton X-100, and pH is 8.8.
The amplification method of the reagent of described utilization cross primer nucleic acid constant-temperature amplification technology for detection EHEC, the nucleic acid amplification program is:
(1) 63 ℃ 90 minutes;
(2) 80 ℃ 2 minutes.
The detection method of the reagent of described utilization cross primer nucleic acid constant-temperature amplification technology for detection EHEC, reaction solution dropped to detect on fluorescein isothiocyanate group and the colloidal gold test of vitamin H fluorophor with the nucleic acid samples of tense marker, reading result in 15-30 minute, if only a red line occurs at Quality Control district C, represent in the sample without EHEC O157:H7; If there is two red lines, a detection line, there is EHEC O157:H7 in a nature controlling line in the expression sample; If occur without red line.Show and detect unsuccessfully that sample needs again to detect.
Compared with prior art, the invention has the beneficial effects as follows: compare traditional Physiology and biochemistry detection method, cross primer nucleic acid constant-temperature amplification technology is applicable to directly from patient's mycetome liquid, ight soil, amplified target gene in the clinical samples such as food and body fluid culture, only need a constant-temperature amplification just can detect EHEC O157:H7 and whether exist, greatly improved efficient and saved the time.Other method of comparing, our legal system only needs simple equipment to get final product, and has greatly improved cost performance and has saved cost.This technology for detection EHEC O157:H7 have detect accurately, high specificity, highly sensitive characteristics, can identify quickly and accurately, avoided repeatedly cultivating, save time; The method is not subjected to the impact of culture condition and Bacterial Physiological state, and is more accurate than the Physiology and biochemistry authentication method.
Description of drawings
Fig. 1 is as a result interpretation synoptic diagram of the present invention.
Fig. 2 is experimental result (the detector bar 1. enteritis EHEC O157:H7 CIQ103 detected results that the present invention uses cross primer nucleic acid constant-temperature amplification technology for detection EHEC O157:H7; Detector bar 2. enteritis EHEC O157:H7 CIQ109 detected results; Detector bar 3. enteritis EHEC O157:H7 CIQ79 detected results; Detector bar 4. Shigellae ATCC12022 detected results; Detector bar 5. blanks).
Embodiment
Below in conjunction with the drawings and specific embodiments the present invention is described in further detail:
The present invention is achieved by the following technical solutions:
(1) design specific oligonucleotide primer is used for cross primer nucleic acid constant-temperature amplification technology for detection;
(2) integrate each primer and make it non-interference.
(3) with the primer sequence group, amplification testing sample template is carried out the specific amplification of goal gene;
(4) amplification can be by specific colloidal gold colloidal gold detection test paper strip visual observation after complete.
The method comprises: use the method and detect the employed primer sets of EHEC O157:H7 and supporting nucleic acid amplification reaction condition with it.Wherein primer sequence is as follows:
SEQ ID NO.1：5’ CAGTCGTACGGGGATGCAG
SEQ ID NO.2：5’ TCAGCAGTCATTACATAAG
SEQ ID NO.3：5’ GCTCTTGCCACAGACTGCGTC
SEQ ID NO.4：5' AGGTTCCGCTATGCGACAT
SEQ ID NO.5：5' GCTCTTGCCACAGACTGCGTCAGTTTCGCCATTCGTTGACTACTT
Wherein 5 ' of primer sequence 3 end has fluorescein isothiocyanate group mark.
5 ' end of primer sequence 4 has vitamin H fluorophor mark.
This primer is and the pathogenic closely-related will of EHEC is congratulated (shiga-like toxin 1 subunit A) selective design in the sample enterotoxin A subunit gene, and reference sequences is GenBank AE005174.2
Escherichia coliPartial stx1 gene for shiga toxin 1, strain EHEC FE94076, detecting gene region is 2996033 ~ 2996980.
Among preferred the present invention in the Fluorescence PCR system each component composition as follows:
Constituent concentration application of sample amount
Bst enzyme 5U/ μ L 1 μ L
Bst enzyme buffer liquid-5 μ L
SEQ ID NO.1： 10μmol/L 1μL
SEQ ID NO.2： 10μmol/L 1μL
SEQ ID NO.3： 10μmol/L 0.5μL
SEQ ID NO.4： 10μmol/L 0.5μL
SEQ ID NO.5： 10μmol/L 0.2μL
Distilled water 13.8 μ L
Cumulative volume 25 μ L
Wherein the composition of Bst enzyme buffer liquid is 20 mM Tris-HCl, 10 mM (NH
4)
2SO
4, 10 mM KCl, 2 mM MgSO
4, mass percent 0.1 % Triton X-100, and pH is 8.8.
The nucleic acid amplification program is:
(1) 63 ℃ 90 minutes;
(2) 80 ℃ 2 minutes.
Such as Fig. 1, shown in 2, nucleic acid amplification product can detect by the colloidal gold test that can detect the nucleic acid amplification mark, decision method is as follows: reaction solution is dropped to can detect on fluorescein isothiocyanate group and the colloidal gold test of vitamin H fluorophor with the nucleic acid samples of tense marker, reading result in 15-30 minute, as only a red line occurring at Quality Control district C, represent in the sample without EHEC O157:H7, if there is two red lines,, a detection line, article one, there is EHEC O157:H7 in nature controlling line in the expression sample.If occur without red line, show and detect unsuccessfully that sample needs again to detect.
Sample: certain fecal sample.
Detect the doubtful bacterium colony of EHEC O157:H7 with conventional physiology, biochemical method, then carry out following cross primer nucleic acid constant-temperature amplification and detect:
(1) getting 0.1 gram sample to be checked suspends with 1 gram physiological saline.
(2) get 1 gram sample and carry out the nucleic acid extracting.
(3) cross primer nucleic acid constant-temperature amplification
Each component composition is as follows in the reaction system:
Constituent concentration application of sample amount
Bst enzyme 5U/ μ L 1 μ L
Bst enzyme buffer liquid-5 μ L
SEQ ID NO.1： 10μmol/L 1μL
SEQ ID NO.2： 10μmol/L 1μL
SEQ ID NO.3： 10μmol/L 0.5μL
SEQ ID NO.4： 10μmol/L 0.5μL
SEQ ID NO.5： 10μmol/L 0.2μL
Distilled water 13.8 μ L
Cumulative volume 25 μ L
Wherein the composition of Bst enzyme buffer liquid is 20 mM Tris-HCl, 10 mM (NH
4)
2SO
4, 10 mM KCl, 2 mM MgSO
4, mass percent 0.1 % Triton X-100, and pH is 8.8.
The nucleic acid amplification program is:
63 ℃ 90 minutes; 80 ℃ 2 minutes.
Carry out altogether 3 pipe experiments, what wherein the DNA sample added is respectively: EHEC O157:H7DNA template standard product; This testing sample DNA; Negative control without DNA.
(4) result observes
Reaction solution dropped to detect on fluorescein isothiocyanate group and the colloidal gold test of vitamin H fluorophor with the nucleic acid samples of tense marker, reading result in 20 minutes, two red lines appear in EHEC O157:H7DNA template standard product and this testing sample DNA,, a detection line, a nature controlling line; Negative control without DNA only a red line occurs at Quality Control district C.Based on the above results, there is EHEC O157:H7 in the expression testing sample.
After 3 days, prove by conventional microorganism culturing and biochemistry detection that the purpose bacterium colony of checking is EHEC O157:H7.Cross primer nucleic acid constant-temperature amplification assay is consistent with the biochemistry detection result.
Sample: certain ground pork.
Detect the doubtful bacterium colony of EHEC O157:H7 with conventional physiology, biochemical method, then carry out following cross primer nucleic acid constant-temperature amplification and detect:
(1) gets 100 grams sample to be checked, pulverize.
(2) get 1 gram sample and carry out the nucleic acid extracting.
(3) cross primer nucleic acid constant-temperature amplification
Constituent concentration application of sample amount
Bst enzyme 5U/ μ L 1 μ L
Bst enzyme buffer liquid-5 μ L
SEQ ID NO.1： 10μmol/L 1μL
SEQ ID NO.2： 10μmol/L 1μL
SEQ ID NO.3： 10μmol/L 0.5μL
SEQ ID NO.4： 10μmol/L 0.5μL
SEQ ID NO.5： 10μmol/L 0.2μL
Distilled water 13.8 μ L
Cumulative volume 25 μ L
Wherein the composition of Bst enzyme buffer liquid is 20 mM Tris-HCl, 10 mM (NH
4)
2SO
4, 10 mM KCl, 2 mM MgSO
4, mass percent 0.1 % Triton X-100, and pH is 8.8.
The nucleic acid amplification program is:
63 ℃ 90 minutes; 80 ℃ 2 minutes.
Carry out altogether 3 pipe experiments, what wherein the DNA sample added is respectively: EHEC O157:H7DNA template standard product; This testing sample DNA; Negative control without DNA.
(4) result observes
Reaction solution dropped to detect on fluorescein isothiocyanate group and the colloidal gold test of vitamin H fluorophor with the nucleic acid samples of tense marker, reading result in 20 minutes, two red lines appear in EHEC O157:H7DNA template standard product and this testing sample DNA,, a detection line, a nature controlling line; Negative control without DNA only a red line occurs at Quality Control district C.Based on the above results, there is EHEC O157:H7 in the expression testing sample.
After 3 days, prove by conventional microorganism culturing and biochemistry detection that the purpose bacterium colony of checking is EHEC O157:H7.Cross primer nucleic acid constant-temperature amplification assay is consistent with the biochemistry detection result.
Above-described embodiment only is used for illustrating technological thought of the present invention and characteristics, its purpose is to make those skilled in the art can understand content of the present invention and implements according to this, can not only limit claim of the present invention with present embodiment, be equal variation or the modification that all disclosed spirit is done, still drop in the claim of the present invention.
Claims (2)
1. a reagent that uses cross primer nucleic acid constant-temperature amplification technology for detection EHEC O157:H7 is characterized in that, comprises following five primers:
Primer 1 is SEQ ID NO.1:5 ' CAGTCGTACGGGGATGCAG
Primer 2 is SEQ ID NO.2:5 ' TCAGCAGTCATTACATAAG
Primer 3 is SEQ ID NO.3:5 ' GCTCTTGCCACAGACTGCGTC
Primer 4 is SEQ ID NO.4:5'AGGTTCCGCTATGCGACAT
Primer 5 is SEQ ID NO.5:5'GCTCTTGCCACAGACTGCGTCAGTTTCGCCATTCGTTGACTACTT
Wherein 5 ' of primer sequence 3 end has fluorescein isothiocyanate group mark, and 5 ' end of primer sequence 4 has vitamin H fluorophor mark.
2. the reagent of utilization cross primer nucleic acid constant-temperature amplification technology for detection EHEC O157:H7 according to claim 1 is characterized in that each component composition is as follows in the nucleic acid amplification reaction system:
Wherein the composition of Bst enzyme buffer liquid is 20 mM Tris-HCl, 10 mM (NH
4)
2SO
4, 10 mM KCl, 2 mM MgSO
4, mass percent 0.1 % Triton X-100, and pH is 8.8.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110382763 CN102363816B (en) | 2011-11-25 | 2011-11-25 | Reagent for detecting enterohemorrhagic escherichia coli by using cross primer nucleic acid isothermal amplification technology, amplification method and detection method for enterohemorrhagic escherichia coli |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110382763 CN102363816B (en) | 2011-11-25 | 2011-11-25 | Reagent for detecting enterohemorrhagic escherichia coli by using cross primer nucleic acid isothermal amplification technology, amplification method and detection method for enterohemorrhagic escherichia coli |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102363816A CN102363816A (en) | 2012-02-29 |
| CN102363816B true CN102363816B (en) | 2013-04-17 |
Family
ID=45690409
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110382763 Active CN102363816B (en) | 2011-11-25 | 2011-11-25 | Reagent for detecting enterohemorrhagic escherichia coli by using cross primer nucleic acid isothermal amplification technology, amplification method and detection method for enterohemorrhagic escherichia coli |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102363816B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103343164B (en) * | 2013-06-17 | 2016-05-18 | 武汉轻工大学 | Shiga toxin producing escherichia coli multi-PCR detection method, kit and application |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101343661A (en) * | 2008-08-22 | 2009-01-14 | 华南理工大学 | Constant temperature nucleic acid amplification fast detecting reagent kit for bacillus coli O157 and use method thereof |
| CN101487057B (en) * | 2009-01-23 | 2011-11-09 | 浙江省疾病预防控制中心 | Loop-mediated isothermal amplification fast detecting reagent kit for O157:H7 coliform |
| CN101899501B (en) * | 2010-02-10 | 2012-06-20 | 江苏出入境检验检疫局动植物与食品检测中心 | Constant temperature amplification detection kit and method for detecting food allergen crustacean gene |
| CN101864494B (en) * | 2010-04-13 | 2012-10-03 | 上海国际旅行卫生保健中心 | Constant-temperature amplification detection kit of A(H1N1) virus and detection method thereof |
-
2011
- 2011-11-25 CN CN 201110382763 patent/CN102363816B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN102363816A (en) | 2012-02-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102363815B (en) | Reagent for detecting salmonellae by using cross primer nucleic acid isothermal amplification technology, amplification method and detection method for salmonellae | |
| Huang et al. | Quadruplex real-time PCR assay for detection and identification of Vibrio cholerae O1 and O139 strains and determination of their toxigenic potential | |
| CN107746879A (en) | Detect RPA primers, probe, kit and the detection method of staphylococcus aureus | |
| CN103468811B (en) | Yersinia enterocolitica virulence gene multiplex-PCR (Polymerase Chain Reaction) detection primer group and kit | |
| US20240084402A1 (en) | Detection kit for salmonella typhi , preparation method and application thereof | |
| CN104928376A (en) | Composition, kit and method for detecting high-virulence bacterial strains and/or toxin type of clostridium difficile | |
| Mu et al. | The fluorescent probe-based recombinase-aided amplification for rapid detection of Escherichia coli O157: H7 | |
| CN104232783B (en) | Quick detection method for cow brucella attenuated vaccine strain A19 | |
| CN105779625A (en) | Dual-fluorescence quantitative PCR (Polymerase Chain Reaction) primer, kit and method for simultaneously detecting general type and type 2 Streptococcus suis | |
| DeShields et al. | Recombinase polymerase amplification (RPA) for the rapid isothermal detection of Spongospora subterranea f. sp. subterranea and potato mop-top virus | |
| CN101768636B (en) | Composition and kit for detecting vibrio cholerae and detection method | |
| CN101974644A (en) | Staphylococcus aureus enterotoxin gene PCR (Polymerase Chain Reaction) parting detection kit and method | |
| CN102952850B (en) | Real-time fluorescent quantitative PCR method used for detecting Mycobacterium tuberculosis, and primer, probe and kit thereof | |
| CN103451305B (en) | Detect the primer of disperse adhesivity colon bacillus, probe and method and test kit | |
| CN102363816B (en) | Reagent for detecting enterohemorrhagic escherichia coli by using cross primer nucleic acid isothermal amplification technology, amplification method and detection method for enterohemorrhagic escherichia coli | |
| CN106916903A (en) | The real-time fluorescence RT PCR detection methods and kit of mycobacterium tuberculosis 85B mRNA | |
| CN106435007A (en) | Primer, probe, kit and method for detecting bacillus erysipelatos-suis by fluorescent quantitative PCR (Polymerase Chain Reaction) | |
| CN101191145B (en) | Highly effective detection method for mycobacterium tuberculosis complex in clinic sample | |
| CN102312013B (en) | Primers and probes for detecting 89K pathogenicity island genes of Streptococcus suis serotype 2, real-time fluorescence quantitative PCR method and kit thereof | |
| CN104846067A (en) | Duplex PCR detection kit and detection method for Listeria monocytogenes and Enterococcus faecium | |
| CN101235411A (en) | Kit for detecting guinea pig aeromonas by utilizing Loop-mediated isothermal amplification technique | |
| CN109402277A (en) | For quickly detecting the LAMP primer composition and application of enterococcus faecalis and enterococcus faecium | |
| CN107326094A (en) | The kit and its detection method of chicken rhinitis type Klebsiella are detected based on ring mediated isothermal amplification | |
| CN103255202A (en) | Triplex PCR detection method of Vibrio cholera, Vibrio parahaemolyticus and Vibrio vulnificus | |
| Gaoh et al. | Propidium Monoazide (PMAxx)-Recombinase Polymerase Amplification Exo (RPA Exo) Assay for Rapid Detection of Burkholderia cepacia Complex in Chlorhexidine Gluconate (CHX) and Benzalkonium Chloride (BZK) Solutions |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CP03 | Change of name, title or address |
Address after: 310051 floor 6, building 2, No. 611, Dongguan Road, Binjiang District, Hangzhou City, Zhejiang Province Patentee after: Hangzhou Yousida Biotechnology Co.,Ltd. Address before: 310053 room 801-808, No. 3766, South Ring Road, Binjiang District, Hangzhou, Zhejiang Province Patentee before: USTAR BIOTECHNOLOGIES (HANGZHOU) Co.,Ltd. |
|
| CP03 | Change of name, title or address |