CN102337254A

CN102337254A - Mutant of beta-galactosidase and preparation method and application thereof

Info

Publication number: CN102337254A
Application number: CN2011102473383A
Authority: CN
Inventors: 吴敬; 陈晟; 吴玉飞; 陈坚; 夏泽华
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2011-08-26
Filing date: 2011-08-26
Publication date: 2012-02-01
Anticipated expiration: 2031-08-26
Also published as: CN102337254B

Abstract

The invention discloses a mutant of beta-galactosidase and a preparation method and application thereof. In the invention, phenyl alanine close to the active center of beta-galactosidase of sulfolobussolfataricus is mutated into tyrosine to obtain a mutant enzyme F441Y. Under the optimized enzymatic conversion condition of the mutant enzyme, the yield of galactooligosaccharide produced by the mutant enzyme F441Y is up to 61 percent, which is about 10 percent higher than that of a wild enzyme. According to the invention, increase in the yield of galactooligosaccharide is realized, and a higher industrial value is achieved.

Description

A kind of two mutants of beta-galactosidase enzymes

Technical field

The present invention relates to a kind of beta-galactosidase enzymes two mutants and preparation method thereof, after amino acid is undergone mutation near the site, active site, obtain the active beta-galactosidase enzymes that improves, belong to genetically engineered and enzyme engineering field.

Technical background

Oligomeric galactose (GOs) is a kind of new type functional oligose, has been applied in the industries such as milk formula, bakery, beverage at present.According to statistics, the Japan at present YO of oligomeric galactose reaches 6500～7000 tons, only is lower than oligomeric isomaltose, but annual sales amount is first of all functions property oligose.The America and Europe, people are also growing to the demand of oligomeric galactose.In China, oligomeric galactose still is an emerging industry, does not form fairly large as yet.After " 95 ", at Yucheng, Shandong, ground such as Guangdong Jiangmen have just begun the production of oligomeric galactose successively, but output is limited.

Beta-galactosidase enzymes is the main enzyme of using of industrial Production by Enzymes oligomeric galactose.Beta-galactosidase enzymes acts on β (1 → 4) glycosidic link of lactose, forms galactosyl-enzyme complex, and under the commentaries on classics glycosides vigor effect of this enzyme, mixture further combines with semi-lactosi, disaccharides or trisaccharide, generates oligomeric galactose.The beta-galactosidase enzymes in different microorganisms source is owing to different in kind own, and synthetic GOs ability also there are differences, as derives from E. coli, A. nigerThe hydrolytic activity of beta-galactosidase enzymes stronger, and derive from B. circulans, A. oryzae, Kluyveromyces lactisBeta-galactosidase enzymes then have stronger commentaries on classics glycosides active.At present, domestic a lot, but be mostly the research of its hydrolysis aspect to beta-galactosidase enzymes research, change glycosides active aspect the research relative deficiency,, and industrialization promotion is few, has limited the raising of oligomeric galactose production capacity.

Used in the present invention deriving from Sulfolobus solfataricusThough the beta-galactosidase enzymes of P2 can be realized the High-efficient Production of oligomeric galactose in conversion process, the back extraction process is still indispensable.How to improve substrate conversion efficiency, practice thrift cost, simplify the research direction that the back extraction process will become beta-galactosidase enzymes.

Summary of the invention

The invention provides a kind of beta-galactosidase enzymes two mutants, this two mutants be with sulphur ore deposit sulfolobus solfataricus ( Sulfolobus solfataricus) beta-galactosidase enzymes (NCBI numbering: near AAK43121) amino acid whose replacement the active site, compare with its parental generation beta-galactosidase enzymes, it has higher transformation efficiency to lactose.

Said beta-galactosidase enzymes two mutants is that 441 amino acids phenylalanine(Phe)s sport tyrosine, called after F441Y.

The present invention is applied to the production of oligomeric galactose, and optimum temperuture is 70 ℃, and ph optimum is 6.5.

The present invention has optimized the enzymatic conversion condition of mutant enzyme on the basis of the mutant strain that makes up, realized the raising of oligomeric galactose output, has higher commercial value.Use this two mutants to produce oligomeric galactose, under optimum enzymatic conversion condition, the productive rate of the oligomeric galactose that mutant enzyme F441Y produces reaches 61%, and wilder enzyme is high by about 10%.

Description of drawings

Fig. 1 utilizes wild enzymatic conversion lactose to generate the optimum temperuture of oligomeric galactose;

Fig. 2 utilizes mutant enzyme to transform the optimum temperuture that lactose generates oligomeric galactose;

Fig. 3 utilizes wild enzymatic conversion lactose to generate the righttest Ph of oligomeric galactose;

Fig. 4 utilizes mutant enzyme to transform the ph optimum that lactose generates oligomeric galactose.

Embodiment

embodiment 1: the preparation of the wild beta-galactosidase enzymes of this example explanation.

, beta-galactosidase enzymes the clone

(available from ATCC, ATCC numbers: 35095), and extract its total DNA to cultivate sulphur ore deposit sulfolobus solfataricus P2.

Gene according to the beta-glycosidase of sulphur ore deposit sulfolobus solfataricus LacSGene (NCBI numbering: AE006641) design primer:

Forward primer P1:GTCTG CATATGTACTCATTTCCAAATAGC (underscore is a restriction enzyme site)

Reverse primer P2:GAAT CTCGAGTTAGTGCCTTAATGGCTTTAC (underscore is a restriction enzyme site)

Utilizing above-mentioned primer, is template with total DNA of sulphur ore deposit sulfolobus solfataricus P2, and the pcr amplification beta-galactosidase gene is reflected in the 50 μ L systems and carries out.Reaction conditions is: 94 ℃ of preparatory sex change 4 min; Carry out 30 circulations (94 ℃ of 10 s, 60 ℃ of 5 s, 72 ℃ of 1min50s) subsequently; 72 ℃ are extended 10 min; Last 4 ℃ of insulations.The PCR fragment that amplification obtains after glue reclaims, is connected with pMD18-T simple carrier; And will connect product and be converted into e. coli jm109, it is dull and stereotyped that converted product is coated the LB that contains the 100mg/L penbritin, through 37 ℃ of overnight cultures; Choose 5 bacterium colonies on the flat board; Insert the LB liquid nutrient medium, extracting plasmid and order-checking behind the 8h, the result is correct.

, beta-galactosidase enzymes expression and preparation:

With above-mentioned plasmid that obtains and pT7-7 carrier, carry out NdeI and XhoI double digestion, enzyme is cut product after glue reclaims; Spend the night with 16 ℃ of connections of T4 ligase enzyme; Connect product and be converted into e. coli jm109,, select transformant and in the LB liquid nutrient medium that contains the 100mg/L penbritin, cultivate through 37 ℃ of overnight cultures; Extracting plasmid behind the 8h obtains the lacS/pT7-7 plasmid of enrichment.

With plasmid lacS/pT7-7 transformed into escherichia coli BL21 (DE3) cell; Selecting transformant 37 ℃ of liquid culture in LB substratum (containing 100 μ g/mL penbritins) spends the night; The back is inserted and is induced with 4 mg/L IPTG (isopropylthio-β-D galactoside) after 37 ℃ of TB fermentation broth (containing 100 μ g/mL penbritins) are cultivated 2 h, is cooled to 25 ℃ of constant temperature culture 20 h.

Fermented liquid is in 4 ℃, and centrifugal 10 min of 8000 rpm collect thalline, with the potassium phosphate buffer redissolution of pH 6.5 50mmol/L of equal volume.Water-bath 30min in 80 ℃ of shaking baths, the centrifugal 20min of back 10000rpm removes deposition, collects supernatant, obtains purer wild enzyme.

embodiment 2: the preparation of this example explanation mutant enzyme F441Y.

, rite-directed mutagenesis

Utilize the fast PCR technology, the rite-directed mutagenesis of single mutation F441Y: expression vector LacS/ pT7-7 is a template, and F441Y rite-directed mutagenesis primer is:

Forward primer P3:5 '-GATTCTCTATGAGG TATGGTCTGTTAAAGGTCG-3 ' (underscore is a mutating alkali yl)

Reverse primer P4:5 '-CGACCTTTAACAGACC ATACCTCATAGAGAATC-3 ' (underscore is a mutating alkali yl)

The PCR reaction system is: 2 * PrimeSTAR ^TMGC Buffer (contains Mg ²⁺) 25 μ L, dNTPs (each 2.5 mmol/L) 4 μ L, forward primer P3 (10 μ M) 1 μ L, reverse primer P4 (10 μ M) 1 μ L, template DNA 1 μ L, PrimeSTAR ^TMHS DNA Polymerase (2.5 U/ μ l) 0.5 μ L adds distilled water to 50 μ L.

The pcr amplification condition is: 94 ℃ of preparatory sex change 4 min; Carry out 30 circulations (94 ℃ of 10 s, 60 ℃ of 5 s, 72 ℃ of 4 min30s) subsequently; 72 ℃ are extended 10 min; Last 4 ℃ of insulations.

PCR product warp DpnI (available from Canadian Fermentas company) digestion; Transformed into escherichia coli JM109 competent cell; Competent cell is after LB solid medium (containing 100 μ g/mL penbritins) overnight cultures; Choose mono-clonal and in LB liquid nutrient medium (containing 100 μ g/mL penbritins), cultivate, plasmid is extracted in the back, and the mutant plasmid order-checking is correct.

, mutant enzyme expression and preparation:

With mutant plasmid F441Y/pT7-7 transformed into escherichia coli BL21 (DE3) cell; Selecting transformant 37 ℃ of liquid culture in LB substratum (containing 100 μ g/mL penbritins) spends the night; The back is inserted and is induced with 4 mg/L IPTG (isopropylthio-β-D galactoside) after 37 ℃ of TB fermentation broth (containing 100 μ g/mL penbritins) are cultivated 2 h, is cooled to 25 ℃ of constant temperature culture 20 h.

Fermented liquid is in 4 ℃, and centrifugal 10 min of 8000 rpm collect thalline, with the potassium phosphate buffer redissolution of pH 6.5 50mmol/L of equal volume.Water-bath 30min in 80 ℃ of shaking baths, the centrifugal 20min of back 10000rpm removes deposition, collects supernatant, obtains purer mutant enzyme F441Y.

embodiment 3: the present embodiment explanation utilizes mutant enzyme to transform the optimum temperuture that lactose generates oligomeric galactose.

Preparation 60% (w/v) lactose solution is as substrate, and the 60g lactose is dissolved in the 50mL pH6.0 50mmol/L phosphoric acid buffer, is settled to 100mL.Add a certain amount of wild enzyme and mutant enzyme F441Y, the enzyme in the reaction system is lived to 4U/mL, place and react 36h under the differing temps, analyze the productive rate of oligomeric galactose.

Can know that by Fig. 1 the righttest enzymatic conversion temperature of wild-type beta-galactosidase enzymes is 75 ℃, can know that the optimum temperuture of mutant enzyme F441Y is 70 ℃ by Fig. 2.

embodiment 4: the present embodiment explanation utilizes mutant enzyme to transform the ph optimum that lactose generates oligomeric galactose.

Preparation 60% (w/v) lactose solution is as substrate, and the 60g lactose is dissolved in the different pH 50mmol/L of the 50mL damping fluid, is settled to 100mL.Add a certain amount of wild enzyme and mutant enzyme F441Y, make the enzyme 4U/mL of being alive in the reaction system, place 75 ℃ of reaction 36h, analyze the productive rate of oligomeric galactose.

Can know that by Fig. 3 the righttest enzymatic conversion pH of wild-type beta-galactosidase enzymes is 6.0, can know that the pH of mutant enzyme F441Y is 6.5 by Fig. 4.

embodiment 5: the productive rate of present embodiment explanation HPLC methods analyst oligomeric galactose.

Preparation 60% (w/v) lactose solution is as substrate; Add a certain amount of wild enzyme and mutant enzyme F441Y; Enzyme in the reaction system is lived to 4U/mL, place respectively and react 36h under the righttest enzymatic conversion temperature separately, the centrifugal 10min of reaction solution 12000rpm; Get supernatant, HPLC analyzes on the 20 μ L with getting behind the 0.45 μ m ultrafiltration membrance filter.

In the reaction solution, the tetrose in the oligomeric galactose, trisaccharide and the disaccharides amount in product adopts HPLC to confirm.The chromatographic condition of measuring trisaccharide and tetrose is: Agilent 1200 HPLC chromatographic instruments, Agilent automatic sampler, chromatographic column Bio-rad Aminex HPX-87H (7.8 mm * 300 mm), Agilent 2410 differential detectors; Moving phase is the 5mmol/L dilution heat of sulfuric acid, flow velocity 0.8 mL min ^-150 ℃ of column temperatures.

The chromatographic condition of measuring disaccharides is: Agilent 1200 HPLC chromatographic instruments, Agilent automatic sampler, chromatographic column Thermo Aps-2 HYPERSIL (4.6 mm * 250 mm), Agilent 2410 differential detectors; Moving phase (V/V) is 70% acetonitrile solution, flow velocity 0.8 mL min ^-130 ℃ of column temperatures.

The mutant enzyme that the said mutation body surface is reached acquisition is compared with wild enzyme, can find, two mutants F441Y has realized the raising of oligomeric galactose trisaccharide and tetrose content, and whole output reaches 61%.

Sequence table

< 110>Southern Yangtze University

< 120>a kind of two mutants of beta-galactosidase enzymes

<160>?4

<170>?PatentIn?version?3.3

<210>?1

<211>?29

<212>?DNA

< 213>artificial synthesized sequence

<220>

< 223>according to the gene order design, be used for gene amplification.

<400>?1

gtctgcatat?gtactcattt?ccaaatagc 29

?

<210>?2

<211>?31

<212>?DNA

< 213>artificial synthesized sequence

<220>

< 223>according to the gene order design, be used for gene amplification.

<400>?2

?

gaatctcgag?ttagtgcctt?aatggcttta?c 31

<210>?3

<211>?33

<212>?DNA

< 213>artificial synthesized sequence

<220>

< 223>according to the gene order design, be used for gene amplification.

<400>?3

gattctctat?gaggtatggt?ctgttaaagg?tcg 33

<210>?4

<211>?33

<212>?DNA

< 213>artificial synthesized sequence

<220>

< 223>according to the gene order design, be used for gene amplification.

<400>?4

cgacctttaa?cagaccatac?ctcatagaga?atc 33

Claims

1. the two mutants of a beta-galactosidase enzymes, it is characterized in that with sulphur ore deposit sulfolobus solfataricus ( Sulfolobus solfataricus) the betagalactosidase activity center near phenylalanine(Phe) sport tyrosine, the gene of the beta-glycosidase of sulphur ore deposit sulfolobus solfataricus in the aminoacid sequence of the beta-galactosidase enzymes of said sulphur ore deposit sulfolobus solfataricus and the ncbi database LacSThe aminoacid sequence of genes encoding is identical, LacSGene is numbered AE006641.

2. the described two mutants of claim 1 is characterized in that the 441st amino acids phenylalanine(Phe) sports tyrosine, called after F441Y.

3. the preparation method of the described two mutants of claim 1 is characterized in that on the basis of sulphur ore deposit sulfolobus solfataricus beta-galactosidase enzymes crystalline structure, confirming the mutational site; The mutant primer of design rite-directed mutagenesis is that template is carried out rite-directed mutagenesis structure mutant plasmid with the carrier that carries beta-galactosidase gene; With mutant plasmid transformed into escherichia coli BL21 (DE3) cell, the positive monoclonal of selecting after the checking carries out fermentation culture, 25 ℃ of constant temperature culture to 24 h; Collecting cell, suspend with damping fluid after; 80 ℃ of water-bath thermal treatment 30min, the centrifuging and taking supernatant obtains two mutants F441Y.

4. method according to claim 3 is characterized in that the said carrier that carries beta-galactosidase enzymes is a pUC series, pET series, pT7-7, or any among the pGEX.

5. the application of the said two mutants of claim 1 is characterized in that optimum temperuture is 70 ℃, and ph optimum is 6.5, and oligomeric galactose output reaches 61%.