KR20090111119A - Composition for producing ginsenoside compound K and preparation method of ginsenoside compound K using thermostable beta-galactosidase - Google Patents

Abstract

PURPOSE: A method for preparing ginsenoside compound K using thermophilic beta-galactosidase is provided to produce massive ginsenoside compound K which is industrially useful. CONSTITUTION: A method for preparing ginsenoside compound K using thermophilic beta-galactosidase comprises: a step of regulating reaction rate using thermophilic beta-galactosidase and a step of massively producing the ginsenoside compound K in a short time. The thermophilic beta-galactosidase is derived from Sulfolobus solfataricus strain.

Description

Composition for producing ginsenoside compound K and preparation method of ginsenoside compound K using thermostable beta-galactosidase

The present invention relates to a composition and a method for preparing a ginsenoside compound K using a high temperature beta-galactosidase enzyme, and more particularly to a super high temperature sulfobus solfataricus. ( Sulfolobus solfataricus ) is a strain derived from the high-temperature beta-galactosidase enzyme that shows stable activity even at high temperatures, thereby rapidly controlling the reaction rate at high temperature, thereby producing a large amount of ginsenoside compound k in a short time. Therefore, the present invention relates to a composition and a method for preparing the ginsenoside compound k which can be used industrially.

Ginsenoside compound K (20 (S) -Proptophanacanadiol-20-O-beta-di-glucopyranoside, see Formula 1 below) is an enteric bacterial metabolite of ginseng saponin component, protopa Glucose moieties are produced by hydrolysis of ginsenoside Rb1, ginsenoside Rb2, ginsenoside Rc, and ginsenoside Rd, which are naxadiol-based saponins.

To date, ginsenoside compound K is known to have various excellent effects such as immune enhancement, tumor angiogenesis inhibition, cancer cell invasion inhibition and cancer cell proliferation. Therefore, the need for stable and efficient production is increasing.

Conventional techniques for the preparation of such ginsenoside compound k include diol-based saponins, enzymes beta-glycosidase (Korea Patent Publication No. 2003-94757), cellulase or Aspergillus genus isolated from the genus Penicillium By treating beta-galactosidase (Korean Patent No. 377546) isolated in the US, naringinase isolated in the penicillium or pectinase (Korean Patent No. 418604) isolated in the Aspergillus genus Methods of making compound k are known.

As described above, ginsenoside compound k is produced using mesophilic enzymes in a temperature range of 10 to 50 ° C., but the enzymes are easily contaminated by microorganisms because they operate at low reaction temperatures, and production yields are low.

Therefore, in order to solve these problems, it is urgently needed to develop an industrially useful enzyme and a manufacturing method using the ginsenoside compound k.

Accordingly, the present inventors have continuously studied to develop a method for preparing a new ginsenoside compound K. As a result, clones of a high-temperature beta-galactosidase gene from a super high-temperature microorganism, Sulphorobus solfataricus, were used to clone a recombinant expression vector. And a microorganism transformed therefrom, and a high-temperature beta-galactosidase enzyme was produced using the same, and when reacted with a rice extract, a large amount of ginsenoside compound k was produced in a short time, thereby showing high yield. By confirming that the present invention was completed.

Accordingly, an object of the present invention is to provide a composition for preparing ginsenoside compound k containing a high temperature beta-galactosidase.

Another object of the present invention is to provide a method for preparing a ginsenoside compound k using a high temperature beta-galactosidase enzyme.

The high temperature beta-galactosidase is characterized in that it is derived from a Sulfolobus solfataricus strain.

According to the composition for producing the ginsenoside compound k containing the high temperature beta-galactosidase enzyme of the present invention and the method for producing the ginsenoside compound k using the high temperature beta-galactosidase enzyme, the super high temperature sulfo bus Thermophilic beta-galactosidase derived from Sulfolobus solfataricus strain exhibits stable activity even at high temperatures, resulting in faster reaction rates, resulting in the production of large amounts of ginsenoside compound k in a short time, resulting in high yields. Since it is effective, it can be useful industrially.

Hereinafter, the present invention will be described in detail.

The present invention provides a composition for preparing Ginsenoside compound K containing high temperature beta-galactosidase.

The beta-galactosidase is present in a variety of animals, plants, and microorganisms, and is involved in the digestion of lactose and the metabolism of complex sugars, and the beta-1,4-galactoside bonds of lactose (β-1,4- It is an enzyme that hydrolyzes galactosidic linkage to glucose and galactose, and at the same time, catalyzes the galactose transfer reaction (galactosylation) that binds galactose to sugars, depending on the reaction conditions (Prenosil, JE et al., (1987) Biotechnol . Bioeng . 30, 1019-1025). The optimum activity temperature of this general beta-galactosidase is 30-50 ° C.

The composition for preparing ginsenoside compound k of the present invention contains a high temperature beta-galactosidase exhibiting an optimum enzymatic activity at a higher temperature, and the high temperature beta-galactosidase optimum activity temperature is 70 to 100 ° C. It is characterized by that.

In addition, the thermophilic beta-galactosidase of the present invention is a microorganism belonging to the genus Sulphobus (Sulfolobus), which is a super-temperature microorganism, preferably Sulforobus Solfataricus ( Sulfolobus) solfataricus ) is derived from the strain and characterized by having the nucleotide sequence of SEQ ID NO: 3 and the amino acid sequence of SEQ ID NO: 4.

In general, the difference between the mesophilic beta galactosidase and the beta galactosidase of the sulfoverse solfataricus of the present invention differs in the composition of amino acids. The mesophilic beta galactosidase is low in cysteine (Cys) and low in arginine / lysine (Arg / Lys). This usually is a representative factor in the thermophilic enzymes can be described that the heat stability (Themostable β-galactosidase from the archaebacterium Sulfolobus solfataricus purification and properties. Eur. J. Biochem 187, 321-328 (1990)).

The sulfoverse solfataricus is a native bacteria (Archaea) system; Crenarchaeota Moon; Thermoprotei river; Sulfolobales; Sulpholobaceae (Sulfolobaceae): A strain belonging to the genus Sulpholobus (Sulfolobus), the microorganisms of the neck of Sulfolobales grow in hot spring water of volcanoes and shows optimal growth at pH 2-3 and 75-80 ℃. In particular, sulfobus solfataricus strains are known as aerobic crenarchaeons that exhibit optimal growth at 80 ° C. and pH 2-4 (Zillig, W., et al., (1980) Arch. Microbiol. 125 , 259-69).

Obtaining the thermophilic beta-galactosidase of the present invention from the sulforobus solfataricus strain is 1) direct purification from the strain, or 2) clones the beta-galactosidase gene from the strain to obtain a recombinant expression vector. It can be obtained by expression in and purification. This process for obtaining enzymes from microorganisms is by conventional methods in the art (Sambrook, J. and Russell, D. W. Molecular Cloning 3rd Ed. Cold Spring Harbor Laboratory, 2001).

The thermophilic beta-galactosidase thus obtained exhibits a relative activity of at least about 80% in the range of pH 4.5 to 6.3 when measured enzymatic activity at 75 ° C., and about 90% in the range of pH 5.0 to 6.0 The above relative activity is shown, and the maximum relative activity is shown in the vicinity of pH 5.5. In addition, when the enzyme activity of the thermophilic beta-galactosidase of the present invention was measured at pH 5.5, it exhibited about 65% or more relative activity in the range of 80 to 97 ° C, and about 80% or more relative activity in the range of 84 to 93 ° C. It shows maximum relative activity near 90 degreeC (FIG. 1). In addition, when measuring the temperature stability of the enzyme activity of the thermophilic beta-galactosidase of the present invention, the half-life of the enzyme activity was 700 hours at 70 ° C, 108.5 hours at 75 ° C, 72.05 hours at 80 ° C, and 48.23 hours at 85 ° C. (Fig. 2). In addition, the production of ginsenoside compound k using the high temperature beta-galactosidase of the present invention shows that the productivity was increased about 2.5 times compared to the conventional Pectinex 100 (FIG. 3).

Thus, the composition for preparing ginsenoside compound k containing the high temperature beta-galactosidase of the present invention is ginsenoside Rb1, Rb2, Rc, Rd or a mixture thereof (e.g., ginseng extract, etc.) which is the main diol-based saponin of ginseng. When reacting in a buffer solution, an aqueous solvent or a mixture of an aqueous solvent and an organic solvent, the reaction rate is rapidly controlled at a high temperature of 70 ~ 100 ℃ to show the action effect that the ginsenoside compound k is produced in a high yield in a short time.

In addition, the present invention is to prepare a ginsenoside compound k by reacting the high temperature beta-galactosidase as a substrate, ginsenosides Rb1, Rb2, Rc, Rd or at least one selected from these mixtures in a reaction mixture and a reaction solvent. Provide a method.

The thermophilic beta-galactosidase is derived from a microorganism belonging to the genus Sulphobus (Sulfolobus), preferably Sulfolobus solfataricus strain, which is an ultra-high temperature microorganism. It is characterized by having the amino acid sequence of the number 4.

In one preferred embodiment of the invention, a) genomic DNA (genomic DNA) of the sulfoverse solfataricus strain, PCR with the primers of SEQ ID NOS: 1 and 2 to amplify the DNA fragment containing the thermophilic beta-galactosidase gene (SEQ ID NO: 3); B) DNA fragments containing the amplified thermophilic beta-galactosidase gene were treated with restriction enzymes NdeI and XhoI and cloned into the plasmid vector pET-24a (+) to clone the recombinant expression vector pET-24a (+) / beta. -Making galactosidase; C) transformed to E. coli BL21 (DE3) ER2566 strain by conventional transformation method; D) culturing E. coli transformed with the thermophilic beta-galactosidase gene; E) inducing the expression of genes in culture to produce the thermophilic beta-galactosidase enzyme; And f) isolating the expressed thermophilic beta-galactosidase enzyme protein.

The step of isolating the high temperature beta-galactosidase enzyme protein expressed in the step (a), (a) crushing the microbial culture; (b) centrifuging the cell debris to obtain a supernatant; (c) heat treatment again at high temperature for centrifugation; And (d) filtering the supernatant obtained therefrom; This can be done by separating the enzyme liquid into the process.

In the step (a), it is preferable to crush the cells at a pressure of about 15,000 lb / in ² using a device such as a French presser. Heat treatment is preferably performed in and out, and in the step (d), it is preferable to filter by using a filter paper of about 0.45 μm or the like.

In addition, the substrate ginsenosides Rb1, Rb2, Rc, Rd is a diol-based saponin, may be used as a mixture of at least one selected from each of ginsenoside compound k, or a mixture thereof. The mixture is preferably ginseng saponin mixture or extract obtained by extracting and separating from the root or ground portion of Korean ginseng, samchil ginseng, American ginseng, bamboo shoot ginseng, Himalayan ginseng or Vietnamese ginseng.

The reaction solvent may be a phosphate buffer, a citrate-phosphate buffer, a buffer solution such as McIvavaine buffer, an aqueous solvent or a mixture of an aqueous solvent and an organic solvent.

The reaction between the thermophilic beta-galactosidase enzyme and the substrate in the reaction solvent is performed at pH 4.5-7.0, preferably pH 4.5-6.3, more preferably pH 5.5, and the temperature is 70-100 ° C, preferably It is preferable to proceed at 85 degreeC in consideration of the temperature stability of 80-97 degreeC, More preferably, an enzyme.

According to the manufacturing method of ginsenoside compound K using the thermophilic beta-galactosidase enzyme of the present invention, the thermophilic beta-galactosidase derived from the super-high temperature sulfobus solfataricus strain is high. It exhibits stable activity even at temperature, so that the reaction rate is fast, and thus, a large amount of ginsenoside compound k is produced in a short time, and thus it can be usefully used industrially since it shows a high yield effect.

Hereinafter, preferred examples are provided to aid in understanding the present invention. However, the following examples are merely provided to more easily understand the present invention, and the contents of the present invention are not limited by the examples.

Example  1. Thermophilic Beta- Galactosidase  Used Ginsenoside Compound K Manufacture

(1) thermophilic beta- Galactosidase  Preparation of recombinant expression vector and transform microorganism comprising

In the present invention, in order to prepare a high-temperature beta-galactosidase, first, a beta-galactosidase gene derived from a sulfoverse solfataricus strain was isolated.

Specifically, a sulfoverse solfataricus strain, in which a gene sequence and an amino acid sequence are already specified, was selected, and genomic DNA was extracted. In addition, the base sequence of the beta-galactosidase gene of this strain [see sequence list; On the basis of Genebank Accession No. M34696 (Genebank Accession No. M34696), two primers each comprising the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2 were prepared.

SEQ ID NO: 5'- GCGTCTG CATATG TACTCATTTCCAAATAGC

SEQ ID NO: 2' -ACTAAT CTCGAG GTGCCTTAATGGCTTTAGGG

Then, a polymerase chain reaction (PCR) was performed using the genomic DNA and primers to amplify the nucleotide sequence of the gene (SEQ ID NO: 3) of beta-galactosidase. By the above procedure, a large amount of beta-galactosidase gene was obtained, followed by insertion into the plasmid vector pET-24a (+) (Novagen) using restriction enzymes Nde I and Xho I. The recombinant expression vector pET-24a of the present invention. (+) / Beta-galactosidase was produced.

In addition, the recombinant expression vector prepared as described above was transformed into E. coli BL21 (DE3) ER2566 strain by a conventional transformation method, the transformed recombinant E. coli BL21 (DE3) ER2566 pET-24a (+) / Beta-galactosidase strain. In addition, the transformed E. coli was stored frozen before the culture was added by adding a 20% glycerin (glycerine) solution.

( 2) Expression of Thermophilic Beta-galactosidase

In the present invention, in order to mass-produce beta-galactosidase, 250 mL of frozen E. coli BL21 (DE3) ER2566 pET-24a (+) / beta-galactosidase strain containing 50 ml of LB medium was included. The flasks were inoculated and shaken in a shaker at 37 ° C. until absorbance at 600 nm was 2.0. Then, the culture solution was added again to a 2 L Erlenmeyer flask containing 500 ml of LB medium and cultured until the absorbance at 600 nm was 0.8. In the process, the stirring speed was adjusted to 200 rpm and the incubation temperature was adjusted to 37 ° C. . 0.1 mM IPTG (isopropyl-beta-thiogalactoside) was added thereto to induce the production of the overexpressed enzyme. The stirring rate was 150 rpm and the culture temperature was adjusted to 16 ° C.

In addition, in order to purify the thermophilic beta-galactosidase enzyme produced as described above, the culture of the transformed strain was centrifuged at 4,000 g for 30 minutes at 4 ℃ and the cell solution 15,000 lb Crushed at / in ² . The cell lysate was again centrifuged at 13,000 × g for 20 minutes at 4 ° C. and heat treated at 80 ° C. for 10 minutes, and then the heat treated material was centrifuged again at 4 ° C. for 20 minutes at 13,000 × g . It was. The resulting supernatant was filtered with 0.45 μm filter paper to separate the enzyme liquid which can be used for the production of ginsenoside compound k.

(3) Investigation of pH and temperature activity of pyrogenic beta-galactosidase

In the present invention, the activity according to the pH and temperature change of the high-temperature beta-galactosidase enzyme isolated in Example (2) was confirmed as follows. Enzymes and substrates were reacted under various pH and temperature conditions and enzyme activities were compared.

end. Determination of Enzyme Activity of Thermophilic Beta-galactosidase

In the present invention, the activity of the thermophilic beta galactosidase enzyme was measured using 2-nitrophenyl-β-D-galactopyranosyl ( o NPG) as a substrate. Specifically, prior to the reaction, 1.0 mM o NPG, 50 mM potassium phosphate buffer (pH 6.0) and the enzyme were diluted to a total volume of 1 ml, and then the reaction was performed at a temperature of 85 ° C. for 15 minutes. 2 M sodium carbonate was added thereto again to stop the reaction. The amount of 2-nitrophenol produced at this time was calculated by measuring the absorbance at 420 nm, and the enzyme activity was the amount of producing 1 micromole of galacto oligosaccharide per minute using 1 unit of enzyme in comparative analysis. Defined. In addition, the protein concentration of the enzyme was calculated using the Bradford method based on bovine serum albumin.

I. Investigation of pH Effect on Thermophilic Beta-galactosidase

First, in order to investigate the pH effect on the enzyme, 100 g of dried rice flour was added to 1 L of MeOH / water mixture (4: 1 v / v), extracted at 80 ° C. for 1 hour, and then filtered and concentrated. Rice extract dissolved in 1 liter of distilled water was used for the experiment (Kim SK, Kwak YS, Kim SW, Hwang YS, Ko ys, Yoo CM: Improved method for the preparation of crude ginseng saponin. J. Ginseng Res 1988; 22 155-160).

Rice extract And McKilvaine buffer containing 5 units / ml enzyme were reacted in the range of pH 4.5 to 7.0. At this time, the reaction was carried out at a temperature of 75 ℃ for 1 hour. After the reaction, n-butanol was added to terminate the reaction, and the activity of the thermophilic beta-galactosidase enzyme was measured. As a result, as shown in Figure 1 (A), it was confirmed that the optimum pH is 5.5.

All. Investigation of temperature effects on pyrogenic beta-galactosidase

In addition, in order to investigate the temperature effect on the enzyme, the reaction was performed for 1 hour by using the McKilbine buffer solution (pH 5.5) containing 5 g / ml of enzyme and rice extract in the temperature range of 70 ℃ to 100 ℃ I was. After the reaction, n-butanol was added to terminate the reaction, and the activity of the thermophilic beta-galactosidase enzyme was measured. As a result, as shown in Figure 1 (B), it was confirmed that the optimum temperature is 90 ℃.

Figure 1 shows a comparison of enzyme activity according to pH (A) and temperature (B) of the beta-galactosidase of the present invention.

la. Investigation of Temperature Stability of Thermophilic Beta-galactosidase

In the present invention, in order to investigate the temperature stability of the pyrogenic beta-galactosidase, McKilvain buffer solution containing the extract and 5 units / ml of the ginseng extract in the temperature range of 70 ℃ to 90 ℃ (pH 5.5) was used to advance the reaction until the time when each enzyme activity was halved. After the reaction was completed, the reaction was terminated by treating n-butanol and the activity of the pyrogenic beta-galactosidase enzyme was measured.

Figure 2 shows the results of measuring the temperature stability of the beta-galactosidase of the present invention. In the graph of FIG. 2, temperature notation is represented as 70 ° C., 75 ° C., 80 ° C., 85 ° C., 85 ° C., and 90 ° C., respectively.

As a result, as shown in FIG. 2, the enzyme activity was halved after 700 hours at 70 ° C, 108.5 hours at 75 ° C, 72.05 hours at 80 ° C, 48.23 hours at 85 ° C, and 2.35 hours at 90 ° C. I could confirm it.

(4) thermophilic beta- Galactosidase  Enzyme Ginsenoside Compound K's  production

In the present invention, in order to develop a method for producing the ginsenoside compound K using the pyrogenic beta-galactosidase enzyme, the temperature in consideration of the optimum pH (pH 5.5) and the time when the enzyme activity was reduced by half Hourly production of ginsenoside compound k was measured at 85 ° C. with ginseng extract (concentration 10%).

Figure 3 is a graph showing the production of ginsenoside compound k by beta-galactosidase of the present invention in the extract of ginseng 10% concentration as a substrate, producing 1.6 mg / ml of ginsenoside compound k at 12 hours Could confirm.

To date, the highest productivity of ginsenoside compound K has been produced by Pectinex 100 from Novozyme Co., a commercial enzyme. The results of producing 1.3 mg / ml have been reported (Bo-Hye Kim et al. 2006, Biotransformation of Korean Panax ginseng by Pectinex. Biol. Pharm. Bull. 29 , 2472-2487).

Comparing with this, when using the thermophilic beta-galactosidase of the present invention, it can be seen that the productivity is increased by about 2.5 times compared with the use of Pectinex 100.

In addition, beta-galactosidase (trade name: Lactozym, manufactured by Novo Nordisk) 40 U / ml (unit: Lactozym, manufactured by Novo Nordisk) as a beta-galactosidase on the market test: o NPG) was used to react with 10% of the extract concentration of the substrate (pH 6.5 and temperature 48 degrees).

As a result, Figure 4 shows the production of ginsenoside compound K by commercially available beta-galactosidase (trade name: Lactozym) at 10% of the substrate concentration of rice (1 = Digoxin; 2 = Rb1; 3 = Rc). 4 = Rb2; 5 = Rd; 6 = com K).

Referring to FIG. 4, even when reacted for 12 hours and 34 hours under the above conditions, there is no decrease of ginsenosides Rb1, Rc, Rb2, and Rd as before the reaction (0 hours), and no compound k (com K) formation is observed. No conversion to other compounds was observed.

The enzyme activity unit of mesophilic beta-galactosidase was increased fourfold to react at the optimum conditions suggested by Novo (pH 6.5 and temperature 48 ° C), but no compound K was produced. This is because lactosidase is not active because ginsenosides are not the original substrate.

Therefore, it can be seen that the beta-galactosidase isolated from the sulfoverse solfataricus of the present invention has an excellent effect on compound k production.

Another comparison is the production of compound k using beta-galactosidase of the genus Asparagus, which reacted for 72 hours using 1 g of the same mixture of ginsenosides Rb1, Rb2, Rc, and Rd to produce 0.455 g ( Korean Patent No. 377546) is an example. When the high temperature beta-galactosidase of the present invention is used, the production yield is 2.9 times higher than the beta-galactosidase of the genus Asparagus, and the productivity is increased by 8.6 times, which is different from the high temperature beta-galactosidase of the present invention. It can be seen that it is much better than beta-galactosidase.

Figure 1 shows a comparison of enzyme activity according to pH (A) and temperature (B) of the beta-galactosidase of the present invention.

Figure 2 shows the stability measurement results for the temperature of the beta-galactosidase of the present invention.

Figure 3 shows the production of ginsenoside compound k by beta-galactosidase of the present invention at a substrate concentration of 10% ginseng.

Figure 4 shows the production of ginsenoside compound K by commercially available beta-galactosidase (trade name: Lactozym) at 10% substrate concentration (1 = Digoxin; 2 = Rb1; 3 = Rc; 4 = Rb2; 5 = Rd; 6 = com K).

<110> Konkuk University Industrial Cooperation Corp <120> Composition for producing ginsenoside compound K and preparation          method of ginsenoside compound K using thermostable          beta-galactosidase <130> P08-E074 <160> 4 <170> KopatentIn 1.71 <210> 1 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for beta-galactosidase <400> 1 gcgtctgcat atgtactcat ttccaaatag c 31 <210> 2 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for beta-galactosidase <400> 2 actaatctcg aggtgcctta atggctttag gg 32 <210> 3 <211> 1470 <212> DNA <213> Sulfolobus solfataricus <220> <221> CDS (222) (1) .. (1467) <223> beta-galatosidase gene <400> 3 atg tac tca ttt cca aat agc ttt agg ttt ggt tgg tcc cag gcc gga 48 Met Tyr Ser Phe Pro Asn Ser Phe Arg Phe Gly Trp Ser Gln Ala Gly   1 5 10 15 ttt caa tca gaa atg gga aca cca ggg tca gaa gat cca aat act gac 96 Phe Gln Ser Glu Met Gly Thr Pro Gly Ser Glu Asp Pro Asn Thr Asp              20 25 30 tgg tat aaa tgg gtt cat gat cca gaa aac atg gca gcg gga tta gta 144 Trp Tyr Lys Trp Val His Asp Pro Glu Asn Met Ala Ala Gly Leu Val          35 40 45 agt gga gat cta cca gaa aat ggg cca ggc tac tgg gga aac tat aag 192 Ser Gly Asp Leu Pro Glu Asn Gly Pro Gly Tyr Trp Gly Asn Tyr Lys      50 55 60 aca ttt cac gat aat gca caa aaa atg gga tta aaa ata gct aga cta 240 Thr Phe His Asp Asn Ala Gln Lys Met Gly Leu Lys Ile Ala Arg Leu  65 70 75 80 aat gtg gaa tgg tct agg ata ttt cct aat cca tta cca agg cca caa 288 Asn Val Glu Trp Ser Arg Ile Phe Pro Asn Pro Leu Pro Arg Pro Gln                  85 90 95 aac ttt gat gaa tca aaa caa gat gtg aca gag gtt gag ata aac gaa 336 Asn Phe Asp Glu Ser Lys Gln Asp Val Thr Glu Val Glu Ile Asn Glu             100 105 110 aac gag tta aag aga ctt gac gag tac gct aat aaa gac gca tta aac 384 Asn Glu Leu Lys Arg Leu Asp Glu Tyr Ala Asn Lys Asp Ala Leu Asn         115 120 125 cat tac agg gaa ata ttc aag gat ctt aaa agt aga gga ctt tac ttt 432 His Tyr Arg Glu Ile Phe Lys Asp Leu Lys Ser Arg Gly Leu Tyr Phe     130 135 140 ata cta aac atg tat cat tgg cca tta cct cta tgg tta cac gac cca 480 Ile Leu Asn Met Tyr His Trp Pro Leu Pro Leu Trp Leu His Asp Pro 145 150 155 160 ata aga gta aga aga gga gat ttt act gga cca agt ggt tgg cta agt 528 Ile Arg Val Arg Arg Gly Asp Phe Thr Gly Pro Ser Gly Trp Leu Ser                 165 170 175 act aga aca gtt tac gaa ttc gct aga ttc tca gct tat ata gct tgg 576 Thr Arg Thr Val Tyr Glu Phe Ala Arg Phe Ser Ala Tyr Ile Ala Trp             180 185 190 aaa ttc gat gat cta gtg gat gag tac tca aca atg aat gaa cct aac 624 Lys Phe Asp Asp Leu Val Asp Glu Tyr Ser Thr Met Asn Glu Pro Asn         195 200 205 gtt gtt gga ggt tta gga tac gtt ggt gtt aag tcc ggt ttt ccc cca 672 Val Val Gly Gly Leu Gly Tyr Val Gly Val Lys Ser Gly Phe Pro Pro     210 215 220 gga tac cta agc ttt gaa ctt tcc cgt agg gca atg tat aac atc att 720 Gly Tyr Leu Ser Phe Glu Leu Ser Arg Arg Ala Met Tyr Asn Ile Ile 225 230 235 240 caa gct cac gca aga gcg tat gat ggg ata aag agt gtt tct aaa aaa 768 Gln Ala His Ala Arg Ala Tyr Asp Gly Ile Lys Ser Val Ser Lys Lys                 245 250 255 cca gtt gga att att tac gct aat agc tca ttc cag ccg tta acg gat 816 Pro Val Gly Ile Ile Tyr Ala Asn Ser Ser Phe Gln Pro Leu Thr Asp             260 265 270 aaa gat atg gaa gcg gta gag atg gct gaa aat gat aat aga tgg tgg 864 Lys Asp Met Glu Ala Val Glu Met Ala Glu Asn Asp Asn Arg Trp Trp         275 280 285 ttc ttt gat gct ata ata aga ggt gag atc acc aga gga aac gag aag 912 Phe Phe Asp Ala Ile Ile Arg Gly Glu Ile Thr Arg Gly Asn Glu Lys     290 295 300 att gta aga gat gac cta aag ggt aga ttg gat tgg att gga gtt aat 960 Ile Val Arg Asp Asp Leu Lys Gly Arg Leu Asp Trp Ile Gly Val Asn 305 310 315 320 tat tac act agg act gtt gtg aag agg act gaa aag gga tac gtt agc 1008 Tyr Tyr Thr Arg Thr Val Val Lys Arg Thr Glu Lys Gly Tyr Val Ser                 325 330 335 tta gga ggt tac ggt cac gga tgt gag agg aat tct gta agt tta gcg 1056 Leu Gly Gly Tyr Gly His Gly Cys Glu Arg Asn Ser Val Ser Leu Ala             340 345 350 gga tta cca acc agc gac ttc ggc tgg gag ttc ttc cca gaa ggt tta 1104 Gly Leu Pro Thr Ser Asp Phe Gly Trp Glu Phe Phe Pro Glu Gly Leu         355 360 365 tat gac gtt ttg acg aaa tac tgg aat aga tat cat ctc tat atg tac 1152 Tyr Asp Val Leu Thr Lys Tyr Trp Asn Arg Tyr His Leu Tyr Met Tyr     370 375 380 gtt act gaa aat ggt att gcg gat gat gcc gat tat caa agg ccc tat 1200 Val Thr Glu Asn Gly Ile Ala Asp Asp Ala Asp Tyr Gln Arg Pro Tyr 385 390 395 400 tat tta gta tct cac gtt tat caa gtt cat aga gca ata aat agt ggt 1248 Tyr Leu Val Ser His Val Tyr Gln Val His Arg Ala Ile Asn Ser Gly                 405 410 415 gca gat gtt aga ggg tat tta cat tgg tct cta gct gat aat tac gaa 1296 Ala Asp Val Arg Gly Tyr Leu His Trp Ser Leu Ala Asp Asn Tyr Glu             420 425 430 tgg gct tca gga ttc tct atg agg ttt ggt ctg tta aag gtc gat tac 1344 Trp Ala Ser Gly Phe Ser Met Arg Phe Gly Leu Leu Lys Val Asp Tyr         435 440 445 aac act aag aga cta tac tgg aga ccc tca gca cta gta tat agg gaa 1392 Asn Thr Lys Arg Leu Tyr Trp Arg Pro Ser Ala Leu Val Tyr Arg Glu     450 455 460 atc gcc aca aat ggc gca ata act gat gaa ata gag cac tta aat agc 1440 Ile Ala Thr Asn Gly Ala Ile Thr Asp Glu Ile Glu His Leu Asn Ser 465 470 475 480 gta cct cca gta aag cca tta agg cac taa 1470 Val Pro Pro Val Lys Pro Leu Arg His                 485 <210> 4 <211> 489 <212> PRT <213> Sulfolobus solfataricus <400> 4 Met Tyr Ser Phe Pro Asn Ser Phe Arg Phe Gly Trp Ser Gln Ala Gly   1 5 10 15 Phe Gln Ser Glu Met Gly Thr Pro Gly Ser Glu Asp Pro Asn Thr Asp              20 25 30 Trp Tyr Lys Trp Val His Asp Pro Glu Asn Met Ala Ala Gly Leu Val          35 40 45 Ser Gly Asp Leu Pro Glu Asn Gly Pro Gly Tyr Trp Gly Asn Tyr Lys      50 55 60 Thr Phe His Asp Asn Ala Gln Lys Met Gly Leu Lys Ile Ala Arg Leu  65 70 75 80 Asn Val Glu Trp Ser Arg Ile Phe Pro Asn Pro Leu Pro Arg Pro Gln                  85 90 95 Asn Phe Asp Glu Ser Lys Gln Asp Val Thr Glu Val Glu Ile Asn Glu             100 105 110 Asn Glu Leu Lys Arg Leu Asp Glu Tyr Ala Asn Lys Asp Ala Leu Asn         115 120 125 His Tyr Arg Glu Ile Phe Lys Asp Leu Lys Ser Arg Gly Leu Tyr Phe     130 135 140 Ile Leu Asn Met Tyr His Trp Pro Leu Pro Leu Trp Leu His Asp Pro 145 150 155 160 Ile Arg Val Arg Arg Gly Asp Phe Thr Gly Pro Ser Gly Trp Leu Ser                 165 170 175 Thr Arg Thr Val Tyr Glu Phe Ala Arg Phe Ser Ala Tyr Ile Ala Trp             180 185 190 Lys Phe Asp Asp Leu Val Asp Glu Tyr Ser Thr Met Asn Glu Pro Asn         195 200 205 Val Val Gly Gly Leu Gly Tyr Val Gly Val Lys Ser Gly Phe Pro Pro     210 215 220 Gly Tyr Leu Ser Phe Glu Leu Ser Arg Arg Ala Met Tyr Asn Ile Ile 225 230 235 240 Gln Ala His Ala Arg Ala Tyr Asp Gly Ile Lys Ser Val Ser Lys Lys                 245 250 255 Pro Val Gly Ile Ile Tyr Ala Asn Ser Ser Phe Gln Pro Leu Thr Asp             260 265 270 Lys Asp Met Glu Ala Val Glu Met Ala Glu Asn Asp Asn Arg Trp Trp         275 280 285 Phe Phe Asp Ala Ile Ile Arg Gly Glu Ile Thr Arg Gly Asn Glu Lys     290 295 300 Ile Val Arg Asp Asp Leu Lys Gly Arg Leu Asp Trp Ile Gly Val Asn 305 310 315 320 Tyr Tyr Thr Arg Thr Val Val Lys Arg Thr Glu Lys Gly Tyr Val Ser                 325 330 335 Leu Gly Gly Tyr Gly His Gly Cys Glu Arg Asn Ser Val Ser Leu Ala             340 345 350 Gly Leu Pro Thr Ser Asp Phe Gly Trp Glu Phe Phe Pro Glu Gly Leu         355 360 365 Tyr Asp Val Leu Thr Lys Tyr Trp Asn Arg Tyr His Leu Tyr Met Tyr     370 375 380 Val Thr Glu Asn Gly Ile Ala Asp Asp Ala Asp Tyr Gln Arg Pro Tyr 385 390 395 400 Tyr Leu Val Ser His Val Tyr Gln Val His Arg Ala Ile Asn Ser Gly                 405 410 415 Ala Asp Val Arg Gly Tyr Leu His Trp Ser Leu Ala Asp Asn Tyr Glu             420 425 430 Trp Ala Ser Gly Phe Ser Met Arg Phe Gly Leu Leu Lys Val Asp Tyr         435 440 445 Asn Thr Lys Arg Leu Tyr Trp Arg Pro Ser Ala Leu Val Tyr Arg Glu     450 455 460 Ile Ala Thr Asn Gly Ala Ile Thr Asp Glu Ile Glu His Leu Asn Ser 465 470 475 480 Val Pro Pro Val Lys Pro Leu Arg His                 485  

Claims (10)

A composition for preparing a ginsenoside compound K containing a high temperature beta-galactosidase. The composition of claim 1, wherein the pyrogenic beta-galactosidase has an optimum activity temperature of 70 to 100 ° C. According to claim 1, wherein the high-temperature beta-galactosidase is a super-temperature microorganism SulfoRobus Solfataricus ( Sulfolobus solfataricus ) ginsenoside compound K composition for producing from the strain. According to claim 3, wherein the high temperature beta-galactosidase has a amino acid sequence of SEQ ID NO: 4 composition for preparing ginsenoside compound k. A method of preparing a ginsenoside compound k by reacting a high temperature beta-galactosidase with any one of ginsenosides Rb1, Rb2, Rc, Rd and a mixture thereof in a reaction solvent. The method of claim 5, wherein the high-temperature beta-galactosidase is a super high temperature microorganism SulfoRobus Solfataricus ( Sulfolobus solfataricus ) method for producing a ginsenoside compound k, characterized in that derived from the strain. 7. The method of claim 6, wherein the pyrogenic beta-galactosidase has an amino acid sequence of SEQ ID NO: 4. [6] The ginsenoside compound k according to claim 5, wherein the mixture is ginseng saponin mixture or extract obtained by extracting and extracting from the root or ground portion of Korean ginseng, samchil ginseng, American ginseng, bamboo ginseng, Himalayan ginseng or Vietnamese ginseng. How to prepare. The method of claim 5, wherein the reaction process is a method for producing a ginsenoside compound k, characterized in that in the range of pH 4.5 to 7.0. The method of claim 5, wherein the reaction is performed at a temperature in the range of 70 to 100 ° C.

Images